The Expression Levels and Cellular Localization of Pigment Epithelium Derived Factor (PEDF) in Mouse Testis: Its Possible Involvement in the Differentiation of Spermatogonial Cells
Abstract
:1. Introduction
2. Results
2.1. Immunostaining of PEDF and Its Levels in Testicular Tissue and Sertoli Cells
2.2. Cellular Localization of PEDF in Testicular Cells
2.3. Cellular Localization and Expression Levels of PEDF-R in Testicular Tissue and Cells
2.4. Effect of PEDF on the Development of Spermatogenesis In Vitro
3. Discussion
4. Materials and Methods
4.1. Animals
4.2. Preparation of Testicular Homogenates
4.3. Isolation of Tubular/Spermatogonial Cells
4.4. Preparation of Conditioned Media from Sertoli Cell Cultures
4.5. Culture of Isolated Spermatogonial Cells in Methylcellulose Culture System (MCS)
4.6. Testicular Tissues and Cells Immunostaining
4.7. Preparation of Testicular Homogenates and Total Protein Quantification
4.8. Gene Expression–PCR Amplification
Real-Time Quantitative PCR
4.9. Data Handling and Statistical Evaluation
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Becerra, S.P.; Sagasti, A.; Spinella, P.; Notario, V. Pigment Epithelium-Derived Factor Behaves Like a Noninhibitory Serpin Neurotrophic Activity does not Require the Serpin Reactive Loop. Available online: http://www.jbc.org/ (accessed on 21 December 2020).
- Gong, Q.; Yang, X.; Cai, W.; Gao, G.; Yang, Z. Expression and purification of functional epitope of pigment epithelium-derived factor in E. coli with inhibiting effect on endothelial cells. Protein J. 2010, 29, 167–173. [Google Scholar] [CrossRef] [PubMed]
- Tombran-Tink, J.; Mazuruk, K.; Rodriguez, I.; Vis, D.C.-M. Organization, Evolutionary Conservation, Expression and Unusual Alu Density of the Human Gene for Pigment Epithelium-Derived Factor, a Unique Neurotrophic. 1996. Available online: http://www.molvis.org/molvis/v2/a11/ (accessed on 21 December 2020).
- Tombran-Tink, J.; Shivaram, S.M.; Chader, G.J.; Johnson, L.V.; Bok, D. Expression, Secretion, and Age-Related Downregulation of Pigment Epithelium-Derived Factor, a Serpin with Neurotrophic Activity. 1995. Available online: https://www.jneurosci.org/content/15/7/4992.short (accessed on 21 December 2020).
- Pignolo, R.J.; Cristofalos, V.J.; Rotenberg, M. The Journal of Biological Chemistry Senescent Wi-38 Cells Fail to Express EPC-1, a Gene Induced in Young Cells Upon Entry Into the Go State. 1993. Available online: https://www.jbc.org/content/268/12/8949.short (accessed on 21 December 2020).
- Loss of EPC-1/PEDF Expression during Skin Aging In Vivo; Elsevier: Amsterdam, The Netherlands; Available online: https://www.sciencedirect.com/science/article/pii/S0022202X15308186 (accessed on 21 December 2020).
- Barnstable, C.J. Neuroprotective and Antiangiogenic Actions of PEDF in the Eye: Molecular Targets and Therapeutic Potential; Elsevier: Amsterdam, The Netherlands, 2004; Available online: https://www.sciencedirect.com/science/article/pii/S1350946204000400 (accessed on 21 December 2020).
- Filleur, S.; Nelius, T.; de Riese, W.; Kennedy, R.C. Characterization of pedf: A multi-functional serpin family protein. J. Cell. Biochem. 2009, 106, 769–775. [Google Scholar] [CrossRef] [PubMed]
- Bouck, N. PEDF: Anti-Angiogenic Guardian of Ocular Function; Elsevier: Amsterdam, The Netherlands, 2002; Available online: https://www.sciencedirect.com/science/article/pii/S1471491402023626 (accessed on 21 December 2020).
- Amaral, J.; Becerra, S.P. Pigment Epithelium-Derived Factor and Angiogenesis. In Retinal and Choroidal Angiogenesis; Springer: Amsterdam, The Netherlands, 2008; pp. 311–337. [Google Scholar]
- Notari, L.; Baladron, V.; Aroca-Aguilar, J.D.; Balko, N.; Heredia, R.; Meyer, C.; Notario, P.M.; Saravanamuthu, S.; Nueda, M.-L.; Sanchez-Sanchez, F.; et al. Identification of a Lipase-linked Cell Membrane Receptor for Pigment Epithelium-derived Factor. J. Biol. Chem. 2006, 281, 38022–38037. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chung, C.; Doll, J.A.; Gattu, A.K.; Shugrue, C.; Cornwell, M.; Fitchev, P.; Crawford, S.E. Anti-Angiogenic Pigment Epithelium-Derived Factor Regulates Hepatocyte Triglyceride Content Through Adipose Tri-glyceride Lipase (ATGL); Elsevier: Amsterdam, The Netherlands; Available online: https://www.sciencedirect.com/science/article/pii/S0168827807006265 (accessed on 21 December 2020).
- Bernard, A.; Gao-Li, J.; Franco, C.-A.; Bouceba, T.; Huet, A.; Li, Z. Laminin Receptor Involvement in the Anti-angiogenic Activity of Pigment Epithelium-derived Factor. J. Biol. Chem. 2009, 284, 10480–10490. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Anne, S.L.; Govek, E.-E.; Ayrault, O.; Kim, J.H.; Zhu, X.; Murphy, D.A.; Van Aelst, L.; Roussel, M.F.; E Hatten, M. WNT3 inhibits cerebellar granule neuron progenitor proliferation and medulloblastoma formation via MAPK activation. PLoS ONE 2013, 8, e81769. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Notari, L.; Arakaki, N.; Mueller, D.; Meier, S.; Amaral, J.; Becerra, S.P. Pigment epithelium-derived factor binds to cell-surface F1-ATP synthase. FEBS J 2010, 277, 2192–2205. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Subramanian, P.; Notario, P.M.; Becerra, S.P. Pigment epithelium-derived factor receptor (PEDF-R): A plasma membrane-linked phospholipase with PEDF binding affinity. In Advances in Experimental Medicine and Biology; Springer: New York, NY, USA, 2010; Volume 664, pp. 29–37. [Google Scholar] [CrossRef] [Green Version]
- Windschüttl, S.; Kampfer, C.; Mayer, C.; Flenkenthaler, F.; Frohlich, T.; Schwarzer, J.U.; Köhn, F.M.; Urbanski, H.; Arnold, G.J.; Mayerhofer, A. Human Testicular Peritubular Cells Secrete Pigment Epithelium-Derived Factor (PEDF), Which May Be Responsible for the Avascularity of the Seminiferous Tubules. 2015. Available online: https://www.nature.com/articles/srep12820 (accessed on 21 December 2020).
- Conte, M.I.; Cabrillana, M.E.; Lancellotti, T.E.S.; Simon, L.; Funes, A.K.; Cayado-Gutiérrez, N.; Tagle-Delgado, M.G.; Vincenti, A.E.; Lopez, M.E.; Pietrobon, E.O.; et al. Pigment epithelium derived factor (PEDF) expression in the male tract of Wistar rats. Biochem. Biophys. Res. Commun. 2018, 504, 257–262. [Google Scholar] [CrossRef] [PubMed]
- Brasaemle, D.L. thematic review Thematic review series: Adipocyte Biology The perilipin family of structural lipid droplet proteins: Stabilization of lipid droplets and control of lipolysis. J. Lipid Res. 2007, 48, 2547–2559. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Brasaemle, D.L.; Dolios, G.; Shapiro, L.; Wang, R. Proteomic Analysis of Proteins Associated with Lipid Droplets of Basal and Lipolytically Stimulated 3T3-L1 Adipocytes* Downloaded from. J. Biol. Chem 2004, 279, 46835–46842. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Elhija, M.A.; Lunenfeld, E.; Schlatt, S.; Huleihel, M. Differentiation of Murine Male Germ Cells to Spermatozoa in a Soft Agar Culture System. 2012. Available online: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3735096/ (accessed on 21 December 2020).
- Huleihel, M.; Fadlon, E.; Abuelhija, A.; Haber, E.P.; Lunenfeld, E. Glial Cell Line-Derived Neurotrophic Factor (GDNF) Induced Migration of Spermatogonial Cells In Vitro via MEK and NF-kB Pathways; Elsevier: Amsterdam, The Netherlands, 2013; Available online: https://www.sciencedirect.com/science/article/pii/S0301468113000467 (accessed on 21 December 2020).
- AbuMadighem, A.; Solomon, R.; Stepanovsky, A.; Kapelushnik, J.; Shi, Q.; Meese, E.; Lunenfeld, E.; Huleihel, M. Development of Spermatogenesis In Vitro in Three-Dimensional Culture from Spermatogonial Cells of Busulfan-Treated Immature Mice. 2018. Available online: https://www.mdpi.com/1422-0067/19/12/3804 (accessed on 21 December 2020).
- Huleihel, M.; Nourashrafeddin, S.; Plant, T.M. Application of three-dimensional culture systems to study mammalian spermatogenesis, with an emphasis on the rhesus monkey (Macaca mulatta). 2015. Available online: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4814948/ (accessed on 21 December 2020).
- Abofoul-Azab, M.; AbuMadighem, A.; Lunenfeld, E.; Kapelushnik, J.; Shi, Q.; Pinkas, H.; Huleihel, M. Development of Postmeiotic Cells in Vitro from Spermatogonial Cells of Prepubertal Cancer Patients. Stem Cells Dev. 2018, 27, 1007–1020. [Google Scholar] [CrossRef] [PubMed]
Factor/Marker | Primers | |
---|---|---|
PEDF | forward | AGGCGAACTTACCAAGTCTCTG |
reverse | TGTTCCACTTGGGTGAGCTT | |
PEDF-R | forward | TCAGGCGAGAGTGACATCTG |
reverse | GTTGGGTTGGTTCAGTAGGC | |
VASA | forward | AGTATTCATGGTGATCGGGAGCAG |
reverse | GCAACAAGAACTGGGCACTTTCCA | |
BOULE | forward | AACCCAACAAGTGGCCCAAGATAC |
reverse | CTTTGGACACTCCAGCTCTGTCAT | |
ACROSINE | forward | TGTCCGTGGTTGCCAAGGATAACA |
reverse | AATCCGGGTACCTGCTTGTGAGTT | |
GAPDH | forward | ACCACAGTCCATGCCATCAC |
reverse | CACCACCCTGTTGCTGTAGCC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bagdadi, N.; Sawaied, A.; AbuMadighem, A.; Lunenfeld, E.; Huleihel, M. The Expression Levels and Cellular Localization of Pigment Epithelium Derived Factor (PEDF) in Mouse Testis: Its Possible Involvement in the Differentiation of Spermatogonial Cells. Int. J. Mol. Sci. 2021, 22, 1147. https://doi.org/10.3390/ijms22031147
Bagdadi N, Sawaied A, AbuMadighem A, Lunenfeld E, Huleihel M. The Expression Levels and Cellular Localization of Pigment Epithelium Derived Factor (PEDF) in Mouse Testis: Its Possible Involvement in the Differentiation of Spermatogonial Cells. International Journal of Molecular Sciences. 2021; 22(3):1147. https://doi.org/10.3390/ijms22031147
Chicago/Turabian StyleBagdadi, Noy, Alaa Sawaied, Ali AbuMadighem, Eitan Lunenfeld, and Mahmoud Huleihel. 2021. "The Expression Levels and Cellular Localization of Pigment Epithelium Derived Factor (PEDF) in Mouse Testis: Its Possible Involvement in the Differentiation of Spermatogonial Cells" International Journal of Molecular Sciences 22, no. 3: 1147. https://doi.org/10.3390/ijms22031147
APA StyleBagdadi, N., Sawaied, A., AbuMadighem, A., Lunenfeld, E., & Huleihel, M. (2021). The Expression Levels and Cellular Localization of Pigment Epithelium Derived Factor (PEDF) in Mouse Testis: Its Possible Involvement in the Differentiation of Spermatogonial Cells. International Journal of Molecular Sciences, 22(3), 1147. https://doi.org/10.3390/ijms22031147