Ionising Radiation Promotes Invasive Potential of Breast Cancer Cells: The Role of Exosomes in the Process
Abstract
1. Introduction
2. Results
2.1. Investigation of Invasive Potential of MCF-7 Cells Following Conditioned Media Transfer
2.2. Investigation of Invasive Potential of MCF-7 Cells Following Exosome Transfer
2.2.1. Characterisation of Exosomes by qNano
2.2.2. Characterisation of Exosomes by Western Blot
2.2.3. Invasive Potential of MCF-7 Cells
2.2.4. Vimentin and E-Cadherin Expression Levels
2.2.5. qPCR Analysis of EMT Coupled Transcription Factors
2.2.6. TGF-β Expression Levels
2.2.7. GalNAc-T6 Expression
2.3. Investigation of Exosome Cargo
2.3.1. Expression of Let-7a, miR-30a, miR-200b, miR-9a in Exosomes
2.3.2. Expression of TGF-β Protein in Exosomes
2.3.3. Exosome Cargo Inhibition Experiments
3. Discussion
4. Materials and Methods
4.1. Cell Culture
4.2. Irradiation
4.3. Conditioned Media Transfer
4.4. Exosome Isolation, Purification and Characterisation
4.5. Exosome Incubations
4.6. Inhibition of Exosome Cargo (RNase-A and Heat Treatments)
4.7. Invasion Assays
4.8. Immuno- and Lectin Cytochemistry
4.9. Flow Cytometry
4.10. Reverse Transcription and Quantitative Polymerase Chain Reaction
4.11. Western Blot
4.12. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- van Niel, G.; D’Angelo, G.; Raposo, G. Shedding light on the cell biology of extracellular vesicles. Nat. Rev. Mol. Cell Biol. 2018, 19, 213–228. [Google Scholar] [CrossRef] [PubMed]
 - Mathieu, M.; Martin-Jaular, L.; Lavieu, G.; Thery, C. Specificities of secretion and uptake of exosomes and other extracellular vesicles for cell-to-cell communication. Nat. Cell Biol. 2019, 21, 9–17. [Google Scholar] [CrossRef] [PubMed]
 - Schey, K.L.; Luther, J.M.; Rose, K.L. Proteomics characterization of exosome cargo. Methods 2015, 87, 75–82. [Google Scholar] [CrossRef]
 - van den Boorn, J.G.; Dassler, J.; Coch, C.; Schlee, M.; Hartmann, G. Exosomes as nucleic acid nanocarriers. Adv. Drug Deliv. Rev. 2013, 65, 331–335. [Google Scholar] [CrossRef]
 - Skotland, T.; Sandvig, K.; Llorente, A. Lipids in exosomes: Current knowledge and the way forward. Prog. Lipid Res. 2017, 66, 30–41. [Google Scholar] [CrossRef] [PubMed]
 - Puhka, M.; Takatalo, M.; Nordberg, M.E.; Valkonen, S.; Nandania, J.; Aatonen, M.; Yliperttula, M.; Laitinen, S.; Velagapudi, V.; Mirtti, T.; et al. Metabolomic Profiling of Extracellular Vesicles and Alternative Normalization Methods Reveal Enriched Metabolites and Strategies to Study Prostate Cancer-Related Changes. Theranostics 2017, 7, 3824–3841. [Google Scholar] [CrossRef] [PubMed]
 - Kharaziha, P.; Ceder, S.; Li, Q.; Panaretakis, T. Tumor cell-derived exosomes: A message in a bottle. Biochim. Biophys. Acta 2012, 1826, 103–111. [Google Scholar] [CrossRef] [PubMed]
 - el Andaloussi, S.; Mager, I.; Breakefield, X.O.; Wood, M.J. Extracellular vesicles: Biology and emerging therapeutic opportunities. Nat. Rev. Drug Discov. 2013, 12, 347–357. [Google Scholar] [CrossRef]
 - Wortzel, I.; Dror, S.; Kenific, C.M.; Lyden, D. Exosome-Mediated Metastasis: Communication from a Distance. Dev. Cell 2019, 49, 347–360. [Google Scholar] [CrossRef] [PubMed]
 - Logozzi, M.; Spugnini, E.; Mizzoni, D.; di Raimo, R.; Fais, S. Extracellular acidity and increased exosome release as key phenotypes of malignant tumors. Cancer Metastasis Rev. 2019, 38, 93–101. [Google Scholar] [CrossRef]
 - Riches, A.; Campbell, E.; Borger, E.; Powis, S. Regulation of exosome release from mammary epithelial and breast cancer cells—A new regulatory pathway. Eur. J. Cancer 2014, 50, 1025–1034. [Google Scholar] [CrossRef]
 - Greening, D.W.; Ji, H.; Chen, M.; Robinson, B.W.; Dick, I.M.; Creaney, J.; Simpson, R.J. Secreted primary human malignant mesothelioma exosome signature reflects oncogenic cargo. Sci. Rep. 2016, 6, 32643. [Google Scholar] [CrossRef] [PubMed]
 - Pfeffer, S.R.; Grossmann, K.F.; Cassidy, P.B.; Yang, C.H.; Fan, M.; Kopelovich, L.; Leachman, S.A.; Pfeffer, L.M. Detection of Exosomal miRNAs in the Plasma of Melanoma Patients. J. Clin. Med. 2015, 4, 2012–2027. [Google Scholar] [CrossRef] [PubMed]
 - Skotland, T.; Ekroos, K.; Kauhanen, D.; Simolin, H.; Seierstad, T.; Berge, V.; Sandvig, K.; Llorente, A. Molecular lipid species in urinary exosomes as potential prostate cancer biomarkers. Eur. J. Cancer 2017, 70, 122–132. [Google Scholar] [CrossRef] [PubMed]
 - Roberg-Larsen, H.; Lund, K.; Seterdal, K.E.; Solheim, S.; Vehus, T.; Solberg, N.; Krauss, S.; Lundanes, E.; Wilson, S.R. Mass spectrometric detection of 27-hydroxycholesterol in breast cancer exosomes. J. Steroid Biochem. Mol. Biol. 2017, 169, 22–28. [Google Scholar] [CrossRef] [PubMed]
 - Vella, L.J. The emerging role of exosomes in epithelial-mesenchymal-transition in cancer. Front. Oncol. 2014, 4, 361. [Google Scholar] [CrossRef]
 - Yang, J.; Weinberg, R.A. Epithelial-mesenchymal transition: At the crossroads of development and tumor metastasis. Dev. Cell 2008, 14, 818–829. [Google Scholar] [CrossRef] [PubMed]
 - De Craene, B.; Berx, G. Regulatory networks defining EMT during cancer initiation and progression. Nat. Rev. Cancer 2013, 13, 97–110. [Google Scholar] [CrossRef]
 - Lu, W.; Kang, Y. Epithelial-Mesenchymal Plasticity in Cancer Progression and Metastasis. Dev. Cell 2019, 49, 361–374. [Google Scholar] [CrossRef]
 - Derynck, R.; Weinberg, R.A. EMT and Cancer: More Than Meets the Eye. Dev. Cell 2019, 49, 313–316. [Google Scholar] [CrossRef]
 - Xu, J.; Wang, A.H.; Oses-Prieto, J.; Makhijani, K.; Katsuno, Y.; Pei, M.; Yan, L.; Zheng, Y.G.; Burlingame, A.; Bruckner, K.; et al. Arginine Methylation Initiates BMP-Induced Smad Signaling. Mol. Cell 2013, 51, 5–19. [Google Scholar] [CrossRef] [PubMed]
 - Jakowlew, S.B. Transforming growth factor-beta in cancer and metastasis. Cancer Metastasis Rev. 2006, 25, 435–457. [Google Scholar] [CrossRef] [PubMed]
 - Miyazono, K.; Katsuno, Y.; Koinuma, D.; Ehata, S.; Morikawa, M. Intracellular and extracellular TGF-beta signaling in cancer: Some recent topics. Front. Med. 2018, 12, 387–411. [Google Scholar] [CrossRef] [PubMed]
 - Katsuno, Y.; Lamouille, S.; Derynck, R. TGF-beta signaling and epithelial-mesenchymal transition in cancer progression. Curr. Opin. Oncol. 2013, 25, 76–84. [Google Scholar] [CrossRef] [PubMed]
 - Yu, L.; Hebert, M.C.; Zhang, Y.E. TGF-beta receptor-activated p38 MAP kinase mediates Smad-independent TGF-beta responses. EMBO J. 2002, 21, 3749–3759. [Google Scholar] [CrossRef] [PubMed]
 - Lamouille, S.; Connolly, E.; Smyth, J.W.; Akhurst, R.J.; Derynck, R. TGF-beta-induced activation of mTOR complex 2 drives epithelial-mesenchymal transition and cell invasion. J. Cell Sci. 2012, 125 Pt 5, 1259–1273. [Google Scholar] [CrossRef]
 - Kim, Y.W.; Park, J.; Lee, H.J.; Lee, S.Y.; Kim, S.J. TGF-beta sensitivity is determined by N-linked glycosylation of the type II TGF-beta receptor. Biochem. J. 2012, 445, 403–411. [Google Scholar] [CrossRef] [PubMed]
 - Partridge, E.A.; le Roy, C.; di Guglielmo, G.M.; Pawling, J.; Cheung, P.; Granovsky, M.; Nabi, I.R.; Wrana, J.L.; Dennis, J.W. Regulation of cytokine receptors by Golgi N-glycan processing and endocytosis. Science 2004, 306, 120–124. [Google Scholar] [CrossRef] [PubMed]
 - Hauselmann, I.; Borsig, L. Altered tumor-cell glycosylation promotes metastasis. Front. Oncol. 2014, 4, 28. [Google Scholar] [CrossRef]
 - Van den Steen, P.; Rudd, P.M.; Dwek, R.A.; Opdenakker, G. Concepts and principles of O-linked glycosylation. Crit. Rev. Biochem. Mol. Biol. 1998, 33, 151–208. [Google Scholar] [CrossRef]
 - Fenlon, S.; Ellis, I.O.; Bell, J.; Todd, J.H.; Elston, C.W.; Blamey, R.W. Helix pomatia and Ulex europeus lectin binding in human breast carcinoma. J. Pathol. 1987, 152, 169–176. [Google Scholar] [CrossRef] [PubMed]
 - Alam, S.M.; Whitford, P.; Cushley, W.; George, W.D.; Campbell, A.M. Flow cytometric analysis of cell surface carbohydrates in metastatic human breast cancer. Br. J. Cancer 1990, 62, 238–242. [Google Scholar] [CrossRef] [PubMed]
 - Noguchi, M.; Thomas, M.; Kitagawa, H.; Kinoshita, K.; Ohta, N.; Nagamori, M.; Miyazaki, I. Further analysis of predictive value of Helix pomatia lectin binding to primary breast cancer for axillary and internal mammary lymph node metastases. Br. J. Cancer 1993, 67, 1368–1371. [Google Scholar] [CrossRef] [PubMed]
 - Brooks, S.A.; Leathem, A.J.C.; Camplejohn, R.S.; Gregory, W. Markers of prognosis in breast cancer--the relationship between binding of the lectin HPA and histological grade, SPF, and ploidy. Breast Cancer Res. Treat. 1993, 25, 247–256. [Google Scholar] [CrossRef]
 - Parameswaran, R.; Brooks, S.; Sadler, G.P. Molecular pathogenesis of follicular cell derived thyroid cancers. Int. J. Surg. 2010, 8, 186–193. [Google Scholar] [CrossRef] [PubMed]
 - Yoshida, Y.; Okamura, T.; Shirakusa, T. An immunohistochemical study of helix pomatia agglutinin binding on carcinomas of the esophagus. Surg. Gynecol. Obstet. 1993, 177, 299–302. [Google Scholar]
 - Maehara, Y.; Okuyama, T.; Kakeji, Y.; Endo, K.; Yamamoto, M.; Sugimachi, K. A tumour-associated cell-surface glycoprotein accompanying p53 overexpression and higher growth potential for gastric cancer. Br. J. Cancer 1995, 71, 999–1002. [Google Scholar] [CrossRef] [PubMed]
 - Schumacher, U.; Higgs, D.; Loizidou, M.; Pickering, R.; Leathem, A.; Taylor, I. Helix pomatia agglutinin binding is a useful prognostic indicator in colorectal carcinoma. Cancer 1994, 74, 3104–3107. [Google Scholar] [CrossRef]
 - Laack, E.; Nikbakht, H.; Peters, A.; Kugler, C.; Jasiewicz, Y.; Edler, L.; Hossfeld, D.K.; Schumacher, U. Lectin histochemistry of resected adenocarcinoma of the lung: Helix pomatia agglutinin binding is an independent prognostic factor. Am. J. Pathol. 2002, 160, 1001–1008. [Google Scholar] [CrossRef]
 - Shiraishi, T.; Atsumi, S.; Yatani, R. Comparative study of prostatic carcinoma bone metastasis among Japanese in Japan and Japanese Americans and whites in Hawaii. Adv. Exp. Med. Biol. 1992, 324, 7–16. [Google Scholar] [PubMed]
 - Baskar, R.; Lee, K.A.; Yeo, R.; Yeoh, K.-W. Cancer and Radiation Therapy: Current Advances and Future Directions. Int. J. Med Sci. 2012, 9, 193–199. [Google Scholar] [CrossRef]
 - Kadhim, M.A.; Hill, M.A. Non-targeted effects of radiation exposure: Recent advances and implications. Radiat. Prot. Dosim. 2015, 166, 118–124. [Google Scholar] [CrossRef]
 - Morgan, W.F.; Sowa, M.B. Non-targeted bystander effects induced by ionizing radiation. Mutat. Res. 2007, 616, 159–164. [Google Scholar] [CrossRef]
 - Cagatay, S.T.; Mayah, A.; Mancuso, M.; Giardullo, P.; Pazzaglia, S.; Saran, A.; Daniel, A.; Traynor, D.; Meade, A.; Lyng, F.; et al. Phenotypic and Functional Characteristics of Exosomes Derived from Irradiated Mouse Organs and Their Role in the Mechanisms Driving Non-Targeted Effects. Int. J. Mol. Sci. 2020, 21, 8389. [Google Scholar] [CrossRef]
 - Al-Mayah, A.; Bright, S.; Chapman, K.; Irons, S.; Luo, P.; Carter, D.; Goodwin, E.; Kadhim, M. The non-targeted effects of radiation are perpetuated by exosomes. Mutat. Res. 2015, 772, 38–45. [Google Scholar] [CrossRef]
 - Song, M.; Wang, Y.; Shang, Z.-F.; Liu, X.-D.; Xie, D.-F.; Wang, Q.; Guan, H.; Zhou, P.-K. Bystander autophagy mediated by radiation-induced exosomal miR-7-5p in non-targeted human bronchial epithelial cells. Sci. Rep. 2016, 6, 30165. [Google Scholar] [CrossRef]
 - Xu, S.; Ding, N.; Pei, H.; Hu, W.; Wei, W.; Zhang, X.; Zhou, G.; Wang, J. MiR-21 is involved in radiation-induced bystander effects. RNA Biol. 2014, 11, 1161–1170. [Google Scholar] [CrossRef] [PubMed]
 - Xu, S.; Wang, J.; Ding, N.; Hu, W.; Zhang, X.; Wang, B.; Hua, J.; Wei, W.; Zhu, Q. Exosome-mediated microRNA transfer plays a role in radiation-induced bystander effect. RNA Biol. 2015, 12, 1355–1363. [Google Scholar] [CrossRef] [PubMed]
 - Arscott, W.; Tandle, A.T.; Zhao, S.; Shabason, J.E.; Gordon, I.K.; Schlaff, C.D.; Zhang, G.; Tofilon, P.J.; Camphausen, K.A. Ionizing radiation and glioblastoma exosomes: Implications in tumor biology and cell migration. Transl. Oncol. 2013, 6, 638–648. [Google Scholar] [CrossRef] [PubMed]
 - Mutschelknaus, L.; Peters, C.; Winkler, K.; Yentrapalli, R.; Heider, T.; Atkinson, M.; Moertl, S. Exosomes Derived from Squamous Head and Neck Cancer Promote Cell Survival after Ionizing Radiation. PLoS ONE 2016, 11, e0152213. [Google Scholar] [CrossRef] [PubMed]
 - Bray, F.; Me, J.F.; Soerjomataram, I.; Siegel, R.L.; Torre, L.A.; Jemal, A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J. Clin. 2018, 68, 394–424. [Google Scholar] [CrossRef]
 - Peart, O. Metastatic Breast Cancer. Radiol. Technol. 2017, 88, 519M–539M. [Google Scholar]
 - Langlands, F.E.; Horgan, K.; Dodwell, D.D.; Smith, L. Breast cancer subtypes: Response to radiotherapy and potential radiosensitisation. Br. J. Radiol.. 2013, 86, 20120601. [Google Scholar] [CrossRef] [PubMed]
 - Tian, W.; Liu, S.; Li, B. Potential Role of Exosomes in Cancer Metastasis. BioMed Res. Int. 2019, 2019, 4649705. [Google Scholar] [CrossRef] [PubMed]
 - Jelonek, K.; Wojakowska, A.; Marczak, L.; Müer, A.; Tinhofer-Keilholz, I.; Lysek-Gladysinska, M.; Widlak, P.; Pietrowska, M. Ionizing radiation affects protein composition of exosomes secreted in vitro from head and neck squamous cell carcinoma. Acta Biochim. Pol. 2015, 62, 265–272. [Google Scholar] [CrossRef] [PubMed]
 - Dutta, S.; Bandyopadhyay, C.; Bottero, V.; Veettil, M.V.; Wilson, L.; Pins, M.R.; Johnson, K.E.; Warshall, C.; Chandran, B. Angiogenin interacts with the plasminogen activation system at the cell surface of breast cancer cells to regulate plasmin formation and cell migration. Mol. Oncol. 2014, 8, 483–507. [Google Scholar] [CrossRef] [PubMed]
 - Abramowicz, A.; Łabaj, W.; Mika, J.; Szołtysek, K.; Ślęzak-Prochazka, I.; Mielańczyk, Ł.; Story, M.D.; Pietrowska, M.; Polański, A.; Widłak, P. MicroRNA Profile of Exosomes and Parental Cells is Differently Affected by Ionizing Radiation. Radiat. Res. 2020, 194, 133–142. [Google Scholar] [CrossRef]
 - Polyak, K.; Weinberg, R.A. Transitions between epithelial and mesenchymal states: Acquisition of malignant and stem cell traits. Nat. Rev. Cancer 2009, 9, 265–273. [Google Scholar] [CrossRef]
 - Gilles, C.; Polette, M.; Zahm, J.M.; Tournier, J.M.; Volders, L.; Foidart, J.M.; Birembaut, P. Vimentin contributes to human mammary epithelial cell migration. J. Cell Sci. 1999, 112 Pt 24, 4615–4625. [Google Scholar] [CrossRef] [PubMed]
 - Sarrió, D.; Rodriguez-Pinilla, S.M.; Hardisson, D.; Cano, A.; Moreno-Bueno, G.; Palacios, J. Epithelial-mesenchymal transition in breast cancer relates to the basal-like phenotype. Cancer Res. 2008, 68, 989–997. [Google Scholar] [CrossRef]
 - Vuoriluoto, K.; Haugen, H.; Kiviluoto, S.; Mpindi, J.-P.; Nevo, J.; Gjerdrum, C.; Tiron, C.; Lorens, J.B.; Ivaska, J. Vimentin regulates EMT induction by Slug and oncogenic H-Ras and migration by governing Axl expression in breast cancer. Oncogene 2011, 30, 1436–1448. [Google Scholar] [CrossRef] [PubMed]
 - Nieto, M.A.; Huang, R.Y.; Jackson, R.A.; Thiery, J.P. Emt: 2016. Cell 2016, 166, 21–45. [Google Scholar] [CrossRef] [PubMed]
 - Olmeda, D.; Moreno-Bueno, G.; Flores, J.M.; Fabra, A.; Portillo, F.; Cano, A. SNAI1 is required for tumor growth and lymph node metastasis of human breast carcinoma MDA-MB-231 cells. Cancer Res. 2007, 67, 11721–11731. [Google Scholar] [CrossRef]
 - Vesuna, F.; van Diest, P.; Chen, J.H.; Raman, V. Twist is a transcriptional repressor of E-cadherin gene expression in breast cancer. Biochem. Biophys. Res. Commun. 2008, 367, 235–241. [Google Scholar] [CrossRef]
 - Eger, A.; Aigner, K.; E Sonderegger, S.; Dampier, B.; Oehler, S.; Schreiber, M.; Berx, G.; Cano, A.; Beug, H.; Foisner, R. DeltaEF1 is a transcriptional repressor of E-cadherin and regulates epithelial plasticity in breast cancer cells. Oncogene 2005, 24, 2375–2385. [Google Scholar] [CrossRef] [PubMed]
 - Shirakihara, T.; Saitoh, M.; Miyazono, K. Differential regulation of epithelial and mesenchymal markers by deltaEF1 proteins in epithelial mesenchymal transition induced by TGF-beta. Mol. Biol. Cell 2007, 18, 3533–3544. [Google Scholar] [CrossRef]
 - Gubelmann, C.; Schwalie, P.C.; Raghav, S.K.; Roder, E.; Delessa, T.; Kiehlmann, E.; Waszak, S.M.; Corsinotti, A.; Udin, G.; Holcombe, W.; et al. Identification of the transcription factor ZEB1 as a central component of the adipogenic gene regulatory network. Elife 2014, 3, e03346. [Google Scholar] [CrossRef] [PubMed]
 - Sciacovelli, M.; Frezza, C. Oncometabolites: Unconventional triggers of oncogenic signalling cascades. Free Radic. Biol. Med. 2016, 100, 175–181. [Google Scholar] [CrossRef] [PubMed]
 - Ten Hagen, K.G.; Fritz, T.A.; Tabak, L.A. All in the family: The UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferases. Glycobiology 2003, 13, 1R–16R. [Google Scholar] [CrossRef] [PubMed]
 - Berois, N.; Mazal, D.; Ubillos, L.; Trajtenberg, F.; Nicolas, A.; Sastre-Garau, X.; Magdelenat, H.; Osinaga, E. UDP-N-acetyl-D-galactosamine: Polypeptide N-acetylgalactosaminyltransferase-6 as a new immunohistochemical breast cancer marker. J. Histochem. Cytochem. 2006, 54, 317–328. [Google Scholar] [CrossRef]
 - Gomes, J.; Marcos, N.T.; Berois, N.; Osinaga, E.; Magalhaes, A.; Pinto-De-Sousa, J.; Almeida, R.; Gärtner, F.; Reis, C.A. Expression of UDP-N-acetyl-D-galactosamine: Polypeptide N-acetylgalactosaminyltransferase-6 in gastric mucosa, intestinal metaplasia, and gastric carcinoma. J. Histochem. Cytochem. 2009, 57, 79–86. [Google Scholar] [CrossRef] [PubMed]
 - Lavrsen, K.; Dabelsteen, S.; Vakhrushev, S.Y.; Levann, A.M.R.; Haue, A.D.; Dylander, A.; Mandel, U.; Hansen, L.; Frodin, M.; Bennett, E.P.; et al. De novo expression of human polypeptide N-acetylgalactosaminyltransferase 6 (GalNAc-T6) in colon adenocarcinoma inhibits the differentiation of colonic epithelium. J. Biol. Chem. 2018, 293, 1298–1314. [Google Scholar] [CrossRef] [PubMed]
 - Park, J.-H.; Katagiri, T.; Chung, S.; Kijima, K.; Nakamura, Y. Polypeptide N-acetylgalactosaminyltransferase 6 disrupts mammary acinar morphogenesis through O-glycosylation of fibronectin. Neoplasia 2011, 13, 320–326. [Google Scholar] [CrossRef]
 - Freire-De-Lima, L.; Gelfenbeyn, K.; Ding, Y.; Mandel, U.; Clausen, H.; Handa, K.; Hakomori, S.-I. Involvement of O-glycosylation defining oncofetal fibronectin in epithelial-mesenchymal transition process. Proc. Natl. Acad. Sci. USA 2011, 108, 17690–17695. [Google Scholar] [CrossRef] [PubMed]
 - Ding, Y.; Gelfenbeyn, K.; Freire-De-Lima, L.; Handa, K.; Hakomori, S.-I. Induction of epithelial-mesenchymal transition with O-glycosylated oncofetal fibronectin. FEBS Lett. 2012, 586, 1813–1820. [Google Scholar] [CrossRef] [PubMed]
 - Zaravinos, A. The Regulatory Role of MicroRNAs in EMT and Cancer. J. Oncol. 2015, 2015, 865816. [Google Scholar] [CrossRef]
 - Koturbash, I.; Boyko, A.; Rodriguez-Juarez, R.; McDonald, R.J.; Tryndyak, V.; Kovalchuk, I.; Pogribny, I.P.; Kovalchuk, O. Role of epigenetic effectors in maintenance of the long-term persistent bystander effect in spleen in vivo. Carcinogenesis 2007, 28, 1831–1838. [Google Scholar] [CrossRef]
 - Koturbash, I.; Zemp, F.J.; Kutanzi, K.; Luzhna, L.; Loree, J.; Kolb, B.; Kovalchuk, O. Sex-specific microRNAome deregulation in the shielded bystander spleen of cranially exposed mice. Cell Cycle 2008, 7, 1658–1667. [Google Scholar] [CrossRef][Green Version]
 - Dickey, J.S.; Zemp, F.J.; Martin, O.A.; Kovalchuk, O. The role of miRNA in the direct and indirect effects of ionizing radiation. Radiat. Environ. Biophys. 2011, 50, 491–499. [Google Scholar] [CrossRef]
 - Melo, S.; Sugimoto, H.; O’Connell, J.T.; Kato, N.; Villanueva, A.; Vidal, A.; Qiu, L.; Vitkin, E.; Perelman, L.T.; Melo, C.A.; et al. Cancer exosomes perform cell-independent microRNA biogenesis and promote tumorigenesis. Cancer Cell 2014, 26, 707–721. [Google Scholar] [CrossRef]
 - Ma, L.; Young, J.; Prabhala, H.; Pan, E.; Mestdagh, P.; Muth, D.; Teruya-Feldstein, J.; Reinhardt, F.; Onder, T.; Valastyan, S.; et al. miR-9, a MYC/MYCN-activated microRNA, regulates E-cadherin and cancer metastasis. Nat. Cell Biol. 2010, 12, 247–256. [Google Scholar] [CrossRef]
 - Park, S.-M.; Gaur, A.B.; Lengyel, E.; Peter, M.E. The miR-200 family determines the epithelial phenotype of cancer cells by targeting the E-cadherin repressors ZEB1 and ZEB2. Genes Dev. 2008, 22, 894–907. [Google Scholar] [CrossRef]
 - Gregory, P.A.; Bert, A.G.; Paterson, E.L.; Barry, S.C.; Tsykin, A.; Farshid, G.; Vadas, M.A.; Khew-Goodall, Y.; Goodall, G.J. The miR-200 family and miR-205 regulate epithelial to mesenchymal transition by targeting ZEB1 and SIP1. Nat. Cell Biol. 2008, 10, 593–601. [Google Scholar] [CrossRef] [PubMed]
 - Korpal, M.; Lee, E.S.; Hu, G.; Kang, Y. The miR-200 family inhibits epithelial-mesenchymal transition and cancer cell migration by direct targeting of E-cadherin transcriptional repressors ZEB1 and ZEB2. J. Biol. Chem. 2008, 283, 14910–14914. [Google Scholar] [CrossRef]
 - Webber, J.; Steadman, R.; Mason, M.D.; Tabi, Z.; Clayton, A. Cancer exosomes trigger fibroblast to myofibroblast differentiation. Cancer Res. 2010, 70, 9621–9630. [Google Scholar] [CrossRef]
 - Gu, J.; Qian, H.; Shen, L.; Zhang, X.; Zhu, W.; Huang, L.; Yan, Y.; Mao, F.; Zhao, C.; Shi, Y.; et al. Gastric cancer exosomes trigger differentiation of umbilical cord derived mesenchymal stem cells to carcinoma-associated fibroblasts through TGF-beta/Smad pathway. PLoS ONE 2012, 7, e52465. [Google Scholar] [CrossRef] [PubMed]
 - Hu, W.; Xu, S.; Yao, B.; Hong, M.; Wu, X.; Pei, H.; Chang, L.; Ding, N.; Gao, X.; Ye, C.; et al. MiR-663 inhibits radiation-induced bystander effects by targeting TGFB1 in a feedback mode. RNA Biol. 2014, 11, 1189–1198. [Google Scholar] [CrossRef] [PubMed]
 - Al-Mayah, A.H.J.; Irons, S.; Pink, R.; Carter, D.R.F.; Kadhim, M.A. Possible role of exosomes containing RNA in mediating nontargeted effect of ionizing radiation. Radiat. Res. 2012, 177, 539–545. [Google Scholar] [CrossRef] [PubMed]
 - Tuncay-Cagatay, S.; Çimen, I.; Savas, B.; Banerjee, S. MTA-1 expression is associated with metastasis and epithelial to mesenchymal transition in colorectal cancer cells. Tumor Biol. 2013, 34, 1189–1204. [Google Scholar] [CrossRef]
 - Lescar, J.; Sanchez, J.-F.; Audfray, A.; Coll, J.-L.; Breton, C.; Mitchell, E.P.; Imberty, A. Structural basis for recognition of breast and colon cancer epitopes Tn antigen and Forssman disaccharide by Helix pomatia lectin. Glycobiology 2007, 17, 1077–1083. [Google Scholar] [CrossRef]
 - Shapiro, H.M. Practical Flow Cytometry, 4th ed.; Wiley-Liss: New York, NY, USA; Great Britain, UK, 2003. [Google Scholar]
 - Kurien, B.T.; Scofield, R.H. Western blotting. Methods 2006, 38, 283–293. [Google Scholar] [CrossRef] [PubMed]
 















| Target Gene | Primer Sequence (5′-3′) | |
|---|---|---|
| Vimentin | F: ATGGCTCGTCACCTTCG R: AGTTTCGTTGATAACCTGTCC  | Primers for EMT related genes  | 
| E-cadherin | F: ACGCATTGCCACATACA R: CGTTAGCCTCGTTCTCA  | |
| TGFβ-1 | F: TAAAGGGTCTAGGATGCGCG R: GACTTTTCCCCAGACCTCGG  | |
| SLUG | F: AGCAGTTGCACTGTGATGCC R: ACACAGCAGCCAGATTCCTC  | |
| SNAIL | F: AATCGGAAGCCTAACTACAGCG R: GTCCCAGATGAGCATTGGCA  | |
| ZEB1 | F: TCCCTGCCAAGAACAATGATCA R: AGGTGATGGGGATGGTGTACTA  | |
| TWIST | F: ACAGCCGCAGAGACCTAAAC R: GGCCTGTCTCGCTTTCTCTT  | |
| GalNAc-T6 | F: AGAGACAGGGCAGAGGGTAG R: CCTTTGTCATGGCATCCCCT  | Primers for glycosylation related gene | 
| has-Let -7a | F: GGGGCTAATACTGCCTGGTAA R: TTCACAATGCGTTATCGGATGT  | Primers for exosomal miRNA | 
| has-miR-200b | F: GTTAGAATTAGGGTTTTTGGGGAGG R: ACCTATCAAACTTCTCAATATAAAC  | |
| has-miR-30a | F: GGGATTCTGAAGGTGGGTGG R: AAGAGAGGCAGCTTTCACCC  | |
| has-miR-9f | F: CCAAGCTTATAAGTGAGCGCATTC R: CGGAATTCGTGTTGGAGAACAGCA  | 
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.  | 
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
AL-Abedi, R.; Tuncay Cagatay, S.; Mayah, A.; Brooks, S.A.; Kadhim, M. Ionising Radiation Promotes Invasive Potential of Breast Cancer Cells: The Role of Exosomes in the Process. Int. J. Mol. Sci. 2021, 22, 11570. https://doi.org/10.3390/ijms222111570
AL-Abedi R, Tuncay Cagatay S, Mayah A, Brooks SA, Kadhim M. Ionising Radiation Promotes Invasive Potential of Breast Cancer Cells: The Role of Exosomes in the Process. International Journal of Molecular Sciences. 2021; 22(21):11570. https://doi.org/10.3390/ijms222111570
Chicago/Turabian StyleAL-Abedi, Raheem, Seda Tuncay Cagatay, Ammar Mayah, Susan A. Brooks, and Munira Kadhim. 2021. "Ionising Radiation Promotes Invasive Potential of Breast Cancer Cells: The Role of Exosomes in the Process" International Journal of Molecular Sciences 22, no. 21: 11570. https://doi.org/10.3390/ijms222111570
APA StyleAL-Abedi, R., Tuncay Cagatay, S., Mayah, A., Brooks, S. A., & Kadhim, M. (2021). Ionising Radiation Promotes Invasive Potential of Breast Cancer Cells: The Role of Exosomes in the Process. International Journal of Molecular Sciences, 22(21), 11570. https://doi.org/10.3390/ijms222111570
        
                                                
