The Acquisition of Colistin Resistance Is Associated to the Amplification of a Large Chromosomal Region in Klebsiella pneumoniae kp52145
Abstract
1. Introduction
2. Results
2.1. The Acquisition of Colistin Resistance Does Not Involve Cross-Resistance to Other Antibiotics
2.2. Colistin Resistance Is Not Associated with Previously Described Resistance Mutations
2.3. Chromosomal Amplifications Are Associated with Colistin Resistance
3. Discussion
4. Materials and Methods
4.1. Strain and Culture Medium
4.2. Antibiotic Susceptibility
4.3. Colistin Evolution Assay
4.4. Genomic DNA Extraction and Re-Sequencing of the Evolved Populations
4.5. Bioinformatic Analysis
4.6. Real-Time PCR
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Govil, D.; Gupta, S.; Malhotra, A.; Kakar, P.N.; Arora, D.; Das, S.; Govil, P.; Prakash, O. Colistin and polymyxin B: A re-emergence. Indian J. Crit. Care Med. 2009, 13, 49–53. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, J.; Nation, R.L.; Milne, R.W.; Turnidge, J.D.; Coulthard, K. Evaluation of colistin as an agent against multi-resistant Gram-negative bacteria. Int. J. Antimicrob. Agents 2005, 25, 11–25. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Karaiskos, I.; Giamarellou, H. Multidrug-resistant and extensively drug-resistant Gram-negative pathogens: Current and emerging therapeutic approaches. Expert Opin. Pharmacother. 2014, 15, 1351–1370. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Falagas, M.E.; Rafailidis, P.I.; Matthaiou, D.K. Resistance to polymyxins: Mechanisms, frequency and treatment options. Drug Resist. Update 2010, 13, 132–138. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bialvaei, A.Z.; Kafil, H.S. Colistin, mechanisms and prevalence of resistance. Curr. Med Res. Opin. 2015, 31, 707–721. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Baron, S.; Hadjadj, L.; Rolain, J.-M.; Olaitan, A.O. Molecular mechanisms of polymyxin resistance: Knowns and unknowns. Int. J. Antimicrob. Agents 2016, 48, 583–591. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Olaitan, A.O.; Morand, S.; Rolain, J.-M. Mechanisms of polymyxin resistance: Acquired and intrinsic resistance in bacteria. Front. Microbiol. 2014, 5, 643. [Google Scholar] [CrossRef] [Scilit]
- Liu, Y.-Y.; Wang, Y.; Walsh, T.R.; Yi, L.-X.; Zhang, R.; Spencer, J.D.; Doi, Y.; Tian, G.; Dong, B.; Huang, X.; et al. Emergence of plasmid-mediated colistin resistance mechanism MCR-1 in animals and human beings in China: A microbiological and molecular biological study. Lancet Infect. Dis. 2016, 16, 161–168. [Google Scholar] [CrossRef] [Scilit]
- Pragasam, A.K.; Shankar, C.; Veeraraghavan, B.; Biswas, I.; Nabarro, L.E.B.; Inbanathan, F.Y.; George, B.; Verghese, S. Molecular Mechanisms of Colistin Resistance in Klebsiella pneumoniae Causing Bacteremia from India—A First Report. Front. Microbiol. 2017, 7, 2135. [Google Scholar] [CrossRef] [Scilit]
- Granata, G.; Petrosillo, N. Resistance to Colistin in Klebsiella pneumoniae: A 4.0 Strain? Infect. Dis. Rep. 2017, 9, 69–72. [Google Scholar] [CrossRef] [Scilit]
- Andrade, F.F.; Silva, D.; Rodrigues, A.; Pina-Vaz, C. Colistin Update on Its Mechanism of Action and Resistance, Present and Future Challenges. Microorganisms 2020, 8, 1716. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Boucher, H.W.; Talbot, G.H.; Bradley, J.S.; Edwards, J.E.; Gilbert, D.; Rice, L.B.; Scheld, M.; Spellberg, B.; Bartlett, J. Bad bugs, no drugs: No ESKAPE! An update from the Infectious Diseases Society of America. Clinical infectious diseases. Infect. Dis. Soc. Am. 2009, 48, 1–12. [Google Scholar]
- Cannatelli, A.; Di Pilato, V.; Giani, T.; Arena, F.; Ambretti, S.; Gaibani, P.; D’Andrea, M.M.; Rossolini, G.M. In VivoEvolution to Colistin Resistance by PmrB Sensor Kinase Mutation in KPC-Producing Klebsiella pneumoniae Is Associated with Low-Dosage Colistin Treatment. Antimicrob. Agents Chemother. 2014, 58, 4399–4403. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cheng, Y.-H.; Lin, T.-L.; Lin, Y.-T.; Wang, J.-T. Amino Acid Substitutions of CrrB Responsible for Resistance to Colistin through CrrC in Klebsiella pneumoniae. Antimicrob. Agents Chemother. 2016, 60, 3709–3716. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jayol, A.; Nordmann, P.; Brink, A.; Poirel, L. Heteroresistance to Colistin in Klebsiella pneumoniae Associated with Alterations in the PhoPQ Regulatory System. Antimicrob. Agents Chemother. 2015, 59, 2780–2784. [Google Scholar] [CrossRef] [Scilit]
- Jayol, A.; Poirel, L.; Brink, A.; Villegas, M.-V.; Yilmaz, M.; Nordmann, P. Resistance to Colistin Associated with a Single Amino Acid Change in Protein PmrB among Klebsiella pneumoniae Isolates of Worldwide Origin. Antimicrob. Agents Chemother. 2014, 58, 4762–4766. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Poirel, L.; Jayol, A.; Nordmann, P. Polymyxins: Antibacterial Activity, Susceptibility Testing, and Resistance Mechanisms Encoded by Plasmids or Chromosomes. Clin. Microbiol. Rev. 2017, 30, 557–596. [Google Scholar] [CrossRef] [Scilit]
- Wright, M.S.; Suzuki, Y.; Jones, M.B.; Marshall, S.H.; Rudin, S.D.; Van Duin, D.; Kaye, K.; Jacobs, M.R.; Bonomo, R.A.; Adams, M.D. Genomic and Transcriptomic Analyses of Colistin-Resistant Clinical Isolates of Klebsiella pneumoniae Reveal Multiple Pathways of Resistance. Antimicrob. Agents Chemother. 2014, 59, 536–543. [Google Scholar] [CrossRef] [Scilit]
- Moffatt, J.H.; Harper, M.; Harrison, P.; Hale, J.D.F.; Vinogradov, E.; Seemann, T.; Henry, R.; Crane, B.; Michael, F.S.; Cox, A.D.; et al. Colistin Resistance in Acinetobacter baumannii Is Mediated by Complete Loss of Lipopolysaccharide Production. Antimicrob. Agents Chemother. 2010, 54, 4971–4977. [Google Scholar] [CrossRef] [Scilit]
- Cannatelli, A.; Giani, T.; D’Andrea, M.M.; Di Pilato, V.; Arena, F.; Conte, V.; Tryfinopoulou, K.; Vatopoulos, A.; Rossolini, G.M. MgrB Inactivation Is a Common Mechanism of Colistin Resistance in KPC-Producing Klebsiella pneumoniae of Clinical Origin. Antimicrob. Agents Chemother. 2014, 58, 5696–5703. [Google Scholar] [CrossRef] [Scilit]
- Poirel, L.; Jayol, A.; Bontron, S.; Villegas, M.-V.; Ozdamar, M.; Türkoglu, S.; Nordmann, P. The mgrB gene as a key target for acquired resistance to colistin in Klebsiella pneumoniae. J. Antimicrob. Chemother. 2014, 70, 75–80. [Google Scholar] [CrossRef] [Scilit]
- Campos, M.A.; Vargas, M.A.; Regueiro, V.; Llompart, C.M.; Albertí, S.; Bengoechea, J.A. Capsule Polysaccharide Mediates Bacterial Resistance to Antimicrobial Peptides. Infect. Immun. 2004, 72, 7107–7114. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Padilla, E.; Llobet, E.; Doménech-Sánchez, A.; Martínez-Martínez, L.; Bengoechea, J.A.; Albertí, S. Klebsiella pneumoniae AcrAB Efflux Pump Contributes to Antimicrobial Resistance and Virulence. Antimicrob. Agents Chemother. 2009, 54, 177–183. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Srinivasan, V.B.; Rajamohan, G. KpnEF, a New Member of the Klebsiella pneumoniae Cell Envelope Stress Response Regulon, Is an SMR-Type Efflux Pump Involved in Broad-Spectrum Antimicrobial Resistance. Antimicrob. Agents Chemother. 2013, 57, 4449–4462. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sanz-Garcia, F.; Hernando-Amado, S.; Martinez, J.L. Mutation-driven evolution of Pseudomonas aeruginosa in the presence of either ceftazidime or ceftazidime/avibactam. Antimicrob. Agents Chemother. 2018, 62, e01379-18. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sanz-García, F.; Sánchez, M.B.; Hernando-Amado, S.; Martínez, J.L. Evolutionary landscapes of Pseudomonas aeruginosa towards ribosome-targeting antibiotic resistance depend on selection strength. Int. J. Antimicrob. Agents 2020, 55, 105965. [Google Scholar] [CrossRef] [Scilit]
- Hernando-Amado, S.; Sanz-García, F.; Martínez, J.L. Antibiotic Resistance Evolution Is Contingent on the Quorum-Sensing Response in Pseudomonas aeruginosa. Mol. Biol. Evol. 2019, 36, 2238–2251. [Google Scholar] [CrossRef] [Scilit]
- Sanz-García, F.; Hernando-Amado, S.; Martínez, J.L. Mutational Evolution of Pseudomonas aeruginosa Resistance to Ribosome-Targeting Antibiotics. Front. Genet. 2018, 9, 451. [Google Scholar] [CrossRef] [Scilit]
- Blanco, P.; Corona, F.; Martínez, J.L. Involvement of the RND efflux pump transporter SmeH in the acquisition of resistance to ceftazidime in Stenotrophomonas maltophilia. Sci. Rep. 2019, 9, 1–14. [Google Scholar] [CrossRef] [Scilit]
- Blanco, P.; Corona, F.; Martínez, J.L. Mechanisms and phenotypic consequences of acquisition of tigecycline resistance by Stenotrophomonas maltophilia. J. Antimicrob. Chemother. 2019, 74, 3221–3230. [Google Scholar] [CrossRef] [Scilit]
- Nassif, X.; Sansonetti, P.J. Correlation of the virulence of Klebsiella pneumoniae K1 and K2 with the presence of a plasmid encoding aerobactin. Infect. Immun. 1986, 54, 603–608. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Storey, D.; McNally, A.; Åstrand, M.; Sa-Pessoa Graca Santos, J.S.-P.G.; Rodriguez-Escudero, I.; Elmore, B.; Palacios, L.; Marshall, H.; Hobley, L.; Molina, M.; et al. Klebsiella pneumoniae type VI secretion system-mediated microbial competition is PhoPQ controlled and reactive oxygen species dependent. PLoS Pathog. 2020, 16, e1007969. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Holt, K.E.; Wertheim, H.; Zadoks, R.N.; Baker, S.; Whitehouse, C.A.; Dance, D.; Jenney, A.; Connor, T.R.; Hsu, L.Y.; Severin, J.; et al. Genomic analysis of diversity, population structure, virulence, and antimicrobial resistance in Klebsiella pneumoniae, an urgent threat to public health. Proc. Natl. Acad. Sci. USA 2015, 112, E3574–E3581. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Humphries, R.M.; Green, D.A.; Schuetz, A.N.; Bergman, Y.; Lewis, S.; Yee, R.; Stump, S.; Lopez, M.; Macesic, N.; Uhlemann, A.-C.; et al. Multicenter Evaluation of Colistin Broth Disk Elution and Colistin Agar Test: A Report from the Clinical and Laboratory Standards Institute. J. Clin. Microbiol. 2019, 57, e01269-19. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Martínez, J.L.; Coque, T.M.; Baquero, F. What is a resistance gene? Ranking risk in resistomes. Nat. Rev. Genet. 2015, 13, 116–123. [Google Scholar] [CrossRef] [Scilit]
- Dafopoulou, K.; Zarkotou, O.; Dimitroulia, E.; Hadjichristodoulou, C.; Gennimata, V.; Pournaras, S.; Tsakris, A. Comparative Evaluation of Colistin Susceptibility Testing Methods among Carbapenem-Nonsusceptible Klebsiella pneumoniae and Acinetobacter baumannii Clinical Isolates. Antimicrob. Agents Chemother. 2015, 59, 4625–4630. [Google Scholar] [CrossRef] [Scilit]
- Cingolani, P.; Patel, V.M.; Coon, M.; Nguyen, T.; Land, S.J.; Ruden, D.M.; Lu, X. Using Drosophila melanogaster as a Model for Genotoxic Chemical Mutational Studies with a New Program, SnpSift. Front. Genet. 2012, 3, 35. [Google Scholar] [CrossRef] [Scilit]
- Hjort, K.; Nicoloff, H.; Andersson, D.I. Unstable tandem gene amplification generates heteroresistance (variation in resistance within a population) to colistin in Salmonella enterica. Mol. Microbiol. 2016, 102, 274–289. [Google Scholar] [CrossRef] [Scilit]
- Xie, C.; Tammi, M.T. CNV-seq, a new method to detect copy number variation using high-throughput sequencing. BMC Bioinform. 2009, 10, 1–9. [Google Scholar]
- Madeira, F.; Park, Y.M.; Lee, J.; Buso, N.; Gur, T.; Madhusoodanan, N.; Basutkar, P.; Tivey, A.R.N.; Potter, S.C.; Finn, R.D.; et al. The EMBL-EBI search and sequence analysis tools APIs in 2019. Nucleic Acids Res. 2019, 47, W636–W641. [Google Scholar] [CrossRef] [Scilit]
- Pontarollo, R.; Rioux, C.R.; Potter, A. Cloning and characterization of bacteriophage-like DNA from Haemophilus somnus homologous to phages P2 and HP1. J. Bacteriol. 1997, 179, 1872–1879. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Weaver, L.; Matthews, B. Structure of bacteriophage T4 lysozyme refined at 1.7 Å resolution. J. Mol. Biol. 1987, 193, 189–199. [Google Scholar] [CrossRef] [Scilit]
- Wu, B.; Gong, J.; Liu, L.; Li, T.; Wei, T.; Bai, Z. Evolution of prokaryotic homologues of the eukaryotic SEFIR protein domain. Gene 2012, 492, 160–166. [Google Scholar] [CrossRef] [Scilit]
- Hsu, M.Y.; Inouye, M.; Inouye, S. Retron for the 67-base multicopy single-stranded DNA from Escherichia coli: A potential transposable element encoding both reverse transcriptase and Dam methylase functions. Proc. Natl. Acad. Sci. USA 1990, 87, 9454–9458. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dodd, I.B.; Egan, J.B. The Escherichia coli retrons Ec67 and Ec86 replace DNA between the cos site and a transcription terminator of a 186-related prophage. Virology 1996, 219, 115–124. [Google Scholar] [CrossRef] [Scilit]
- McClelland, M.; Sanderson, K.E.; Spieth, J.; Clifton, S.W.; Latreille, P.; Courtney, L.; Porwollik, S.; Ali, J.; Dante, M.; Du, F.; et al. Complete genome sequence of Salmonella enterica serovar Typhimurium LT2. Nat. Cell Biol. 2001, 413, 852–856. [Google Scholar] [CrossRef] [Scilit]
- Munoz-Price, L.S.; Poirel, L.; Bonomo, R.A.; Schwaber, M.J.; Daikos, G.L.; Cormican, M.; Cornaglia, G.; Garau, J.; Gniadkowski, M.; Hayden, M.K.; et al. Clinical epidemiology of the global expansion of Klebsiella pneumoniae carbapenemases. Lancet Infect. Dis. 2013, 13, 785–796. [Google Scholar] [CrossRef] [Scilit]
- Torres-Barceló, C. The disparate effects of bacteriophages on antibiotic-resistant bacteria. Emerg. Microbes Infect. 2018, 7, 1–12. [Google Scholar] [CrossRef] [Scilit]
- Wang, X.; Kim, Y.; Ma, Q.; Hong, S.H.; Pokusaeva, K.; Sturino, J.M.; Wood, T.K. Cryptic prophages help bacteria cope with adverse environments. Nat. Commun. 2010, 1, 147. [Google Scholar] [CrossRef] [Scilit]
- Sandegren, L.; Andersson, D.I. Bacterial gene amplification: Implications for the evolution of antibiotic resistance. Nat. Rev. Genet. 2009, 7, 578–588. [Google Scholar] [CrossRef] [Scilit]
- Nassif, X.; Fournier, J.M.; Arondel, J.; Sansonetti, P.J. Mucoid phenotype of Klebsiella pneumoniae is a plasmid-encoded virulence factor. Infect. Immun. 1989, 57, 546–552. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tomas, A.; Lery, L.; Regueiro, V.; Perez-Gutierrez, C.; Martinez, V.; Moranta, D.; Llobet, E.; Gonzalez-Nicolau, M.; Insua, J.L.; Tomas, J.M.; et al. Functional Genomic Screen Identifies Klebsiella pneumoniae Factors Implicated in Blocking Nuclear Factor kappaB (NF-kappaB) Signaling. J. Biol. Chem. 2015, 290, 16678–16697. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Atlas, R. Handbook of Microbiological Media; CRC Press: Boca Raton, FL, USA, 1993. [Google Scholar]
- Satlin, M.J.; Lewis, J.S.; Weinstein, M.P.; Patel, J.; Humphries, R.M.; Kahlmeter, G.; Giske, C.G.; Turnidge, J. Clinical and Laboratory Standards Institute and European Committee on Antimicrobial Susceptibility Testing Position Statements on Polymyxin B and Colistin Clinical Breakpoints. Clin. Infect. Dis. 2020, 71, e523–e529. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Llobet, E.; Campos, M.A.; Giménez, P.; Moranta, D.; Bengoechea, J.A. Analysis of the Networks Controlling the Antimicrobial-Peptide-Dependent Induction of Klebsiella pneumoniae Virulence Factors. Infect. Immun. 2011, 79, 3718–3732. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Langmead, B.; Salzberg, S.L. Fast gapped-read alignment with Bowtie 2. Nat. Methods 2012, 9, 357–359. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, H. A statistical framework for SNP calling, mutation discovery, association mapping and population genetical parameter estimation from sequencing data. Bioinformatics 2011, 27, 2987–2993. [Google Scholar] [CrossRef] [Scilit]
- Li, H.; Handsaker, B.; Wysoker, A.; Fennell, T.; Ruan, J.; Homer, N.; Marth, G.; Abecasis, G.; Durbin, R.; Project, G.; et al. The Sequence Alignment/Map format and SAMtools. Bioinformatics 2009, 25, 2078–2079. [Google Scholar] [CrossRef] [Scilit]
- Cingolani, P.; Platts, A.; Wang, L.L.; Coon, M.; Nguyen, T.; Wang, L.; Land, S.J.; Lu, X.; Ruden, D.M. A program for annotating and predicting the effects of single nucleotide polymorphisms, SnpEff: SNPs in the genome of Drosophila melanogaster strain w1118; iso-2; iso-3. Fly 2012, 6, 80–92. [Google Scholar] [CrossRef] [Scilit]
- Quinlan, A.; Hall, I.M. BEDTools: A flexible suite of utilities for comparing genomic features. Bioinformatics 2010, 26, 841–842. [Google Scholar] [CrossRef] [Scilit]
- Choi, Y.; Chan, A. PROVEAN web server: A tool to predict the functional effect of amino acid substitutions and indels. Bioinformatics 2015, 31, 2745–2747. [Google Scholar] [CrossRef] [Scilit]
- Zhou, Y.; Liang, Y.; Lynch, K.H.; Dennis, J.J.; Wishart, D.S. PHAST: A Fast Phage Search Tool. Nucleic Acids Res. 2011, 39, W347–W352. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Arndt, D.; Grant, J.R.; Marcu, A.; Sajed, T.; Pon, A.; Liang, Y.; Wishart, D.S. PHASTER: A better, faster version of the PHAST phage search tool. Nucleic Acids Res. 2016, 44, W16–W21. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-DDCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit] [PubMed]



| Evolution a | Population | MIC (µg/mL) b | Copy Number d | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| GM | EM | TC | CL | CI | IP | FX | TZ | CS c | |||
| A | 1 | 0.38 | 32 | 2 | 3 | 0.064 | 0.38 | 4 | 0.19 | 128 | 10.46 |
| 2 | 0.38 | 48 | 2 | 4 | 0.032 | 0.75 | 6 | 0.19 | 48 | 1.50 | |
| 3 | 0.5 | 48 | 2 | 4 | 0.064 | 0.75 | 4 | 0.19 | 64 | 2.20 | |
| 4 | 0.5 | 32 | 1.5 | 4 | 0.064 | 0.5 | 4 | 0.125 | 128 | 3.69 | |
| B | 5 | 0.5 | 48 | 2 | 6 | 0.064 | 0.5 | 4 | 0.125 | 0.75 | 1 |
| 6 | 0.75 | 48 | 1 | 3 | 0.047 | 0.25 | 4 | 0.125 | 0.5 | 1 | |
| 7 | 0.5 | 32 | 1.5 | 4 | 0.047 | 0.38 | 4 | 0.125 | 0.5 | ND | |
| 8 | 0.75 | 48 | 2 | 6 | 0.064 | 0.5 | 4 | 0.125 | 0.5 | ND | |
| C | wt | 0.38 | 32 | 1.5 | 4 | 0.064 | 0.75 | 4 | 0.125 | 0.5 | 1 |
| Position a | Mutation | Type b | Population c | Quality | Coverage (%) d | DP e | Product/Blast Homology | |
|---|---|---|---|---|---|---|---|---|
| 1852616 | C > T | Arg76Cys | MSM | 3 | 225 | 68.97 | 29 | Succinate dehydrogenase cytochrome b556 subunit |
| 2011786 | C > T | intergenic_region | IR | 1 | 225 | 66.66 | 84 | 3′ tyrosine-type recombinase/integrase |
| 2014814 | C > A | Leu48Leu | SS | 1 | 222 | 90.42 | 355 | Phage repressor protein CI |
| 3 | 225 | 56.25 | 51 | |||||
| 4 | 213 | 27.27 | 99 | |||||
| 2014977 | T > C | intergenic region | IR | 1 | 222 | 89.23 | 362 | 5′ Phage repressor protein CI |
| 4 | 225 | 74.58 | 118 | |||||
| 2015036 | A > G | intergenic region | IR | 3 | 225 | 59.52 | 42 | 5′Regulator |
| 2015480 | G > A | Asp61Asn | MSM | 3 | 225 | 51.90 | 80 | Phage regulatory protein CII |
| 2037216 | T > C | Val505Ala | CM | 3 | 225 | 37.87 | 66 | Phage tail protein |
| 4 | 225 | 67.57 | 111 | |||||
| 2043437 | C > T | Ala715Ala | SS | 3 | 225 | 53.57 | 56 | Phage tail tape measure protein |
| 4 | 225 | 73.74 | 99 | |||||
| 2045994 | C > T | intergenic region | IR | 1 | 222 | 89.71 | 418 | 5′ transcriptional activator Ogr/delta |
| 3994455 | A > C | Val502Gly | MSM | 2 | 152 | 40.9 | 22 | PTS beta-glucoside transporter subunit IIABC |
| 5429220 | C > T | Glu601Glu | SS | 1 | 222 | 97.5 | 40 | DEAD/DEAH box helicase |
| Number a | Locus | Position | Strand | Size (bp) | Product/Blast Homology | |
|---|---|---|---|---|---|---|
| First | End | |||||
| 1 | BN49_RS11210 | 2011880 | 2012932 | − | 1053 | Tyrosine-type recombinase/integrase |
| 2 | BN49_RS11215 | 2013019 | 2014008 | − | 990 | Hypothetical protein |
| 3 | BN49_RS28910 | 2014019 | 2014957 | − | 939 | Phage repressor protein CI |
| 4 | BN49_RS28915 | 2015046 | 2015267 | + | 222 | Putative uncharacterized protein ORFA in retron EC67 (E. coli)/ Regulator (E. coli, K. pneumoniae) |
| 5 | BN49_RS11225 | 2015300 | 2015809 | + | 510 | Phage regulatory protein CII |
| 6 | BN49_RS11230 | 2015817 | 2016017 | + | 201 | DUF2724 domain-containing protein |
| 7 | BN49_RS11235 | 2015981 | 2016322 | + | 342 | DUF5347 domain-containing protein |
| 8 | BN49_RS11240 | 2016390 | 2016623 | + | 234 | DUF2732 domain-containing protein |
| 9 | BN49_RS11245 | 2016623 | 2016850 | + | 228 | TraR/DksA family transcriptional regulator |
| 10 | BN49_RS11250 | 2016847 | 2017704 | + | 858 | DNA adenine methylase |
| 11 | BN49_RS11255 | 2017701 | 2020115 | + | 2415 | Replication endonuclease |
| 12 | BN49_RS11260 | 2020269 | 2020457 | + | 189 | levan regulatory domain protein |
| 13 | BN49_RS11265 | 2020468 | 2020701 | + | 234 | DinI family protein |
| 14 | BN49_RS11270 | 2020988 | 2021206 | + | 219 | Multidrug ABC transporter ATPase (E. coli) |
| 15 | BN49_RS11275 | 2021206 | 2022048 | + | 843 | Hypothetical protein |
| 16 | BN49_RS11280 | 2022058 | 2022267 | + | 210 | Hypothetical protein |
| 17 | BN49_RS11285 | 2022264 | 2023697 | + | 1434 | SEFIR domain-containing protein |
| 18 | BN49_RS11290 | 2023732 | 2024772 | − | 1041 | Phage portal protein |
| 19 | BN49_RS11295 | 2024769 | 2025494 | − | 726 | Terminase-like family protein |
| 20 | BN49_RS11300 | 2025494 | 2027260 | − | 1767 | Terminase ATPase subunit |
| 21 | BN49_RS11305 | 2027403 | 2028236 | + | 834 | Phage capsid protein |
| 22 | BN49_RS11310 | 2028253 | 2029311 | + | 1059 | Phage major capsid protein, P2 family |
| 23 | BN49_RS11315 | 2029315 | 2029965 | + | 651 | Terminase endonuclease subunit |
| 24 | BN49_RS11320 | 2030061 | 2030525 | + | 465 | Head completion/stabilization protein |
| 25 | BN49_RS11325 | 2030525 | 2030728 | + | 204 | Tail protein X |
| 26 | BN49_RS11330 | 2030732 | 2030947 | + | 216 | Membrane protein (Enterobacteriaceae) |
| 27 | BN49_RS11335 | 2030967 | 2031440 | + | 513 | Lysozyme |
| 28 | BN49_RS11340 | 2031442 | 2031819 | + | 378 | Hypothetical protein |
| 29 | BN49_RS11345 | 2031816 | 2032244 | + | 429 | LysB family phage lysis regulatory protein |
| 30 | BN49_RS11355 | 2032319 | 2032771 | + | 453 | Tail completion protein R |
| 31 | BN49_RS11360 | 2032764 | 2033210 | + | 447 | Phage virion morphogenesis protein |
| 32 | BN49_RS11365 | 2033279 | 2033857 | + | 579 | Phage baseplate assembly protein V |
| 33 | BN49_RS11370 | 2033854 | 2034213 | + | 360 | Baseplate assembly protein |
| 34 | BN49_RS11375 | 2034200 | 2035108 | + | 909 | Baseplate assembly protein |
| 35 | BN49_RS11380 | 2035101 | 2035706 | + | 606 | Phage tail protein I |
| 36 | BN49_RS11385 | 2035703 | 2037424 | + | 1722 | Tail fiber protein/phage tail protein |
| 37 | BN49_RS11390 | 2037424 | 2037606 | + | 183 | Phage tail protein |
| 38 | BN49_RS28920 | 2037587 | 2037739 | − | 153 | Tail fiber assembly protein |
| 39 | BN49_RS11395 | 2037760 | 2038207 | − | 448 | IS1 family transposase (Pseudo: partial start) DDE_Tnp_IS1 superfamily |
| 40 | BN49_RS11400 | 2038403 | 2038969 | + | 567 | DNA invertase |
| 41 | BN49_RS11405 | 2039112 | 2040284 | + | 1173 | Major tail sheath protein |
| 42 | BN49_RS11410 | 2040294 | 2040809 | + | 516 | Phage major tail tube protein |
| 43 | BN49_RS11415 | 2040864 | 2041166 | + | 303 | Phage tail assembly protein |
| 44 | BN49_RS11420 | 2041181 | 2041300 | + | 120 | GpE family phage tail protein |
| 45 | BN49_RS11425 | 2041293 | 2044370 | + | 3078 | Phage tail tape measure protein |
| 46 | BN49_RS11430 | 2044367 | 2044852 | + | 486 | Bacteriophage tail protein |
| 47 | BN49_RS11435 | 2044849 | 2045949 | + | 1101 | Phage late control D family protein |
| 48 | BN49_RS28925 | 2046040 | 2046258 | + | 219 | Transcriptional activator Ogr/delta |
| Region Length | Genome Position | Condition a | |
|---|---|---|---|
| 1 | 50 kb | 1506010–1556027 | intact |
| 2 | 34.5 kb | 2011787–2046330 | intact |
| 3 | 33.1 kb | 2346519–2379687 | intact |
| 4 | 50.6 kb | 2700266–2750911 | intact |
| Name | Sequence (5′-3′) |
|---|---|
| RpoB-fwd | GATCCGTGGCGTGACTTATT |
| RpoB-rev | GCCCATGTAGACTTCTTGTTCT |
| RS11300-fwd | CAGGCCATGCTGCTGTACTT |
| RS11300-rev | GTCCAGCGGCCCATAGT |
| RS28910-fwd | CCTTCTGCGGTAACTCCAATAG |
| RS28910-rev | CAGCTCTGTAGCCCAACTTAAA |
| RS11385-fwd | CTAGCTCAGTTGGTTCGTTTATTTC |
| RS11385-rev | GTCGGGCTATCGCTGTTATT |
| RS11425-fwd | GGAGGTGCGTGATCGTATTG |
| RS11425-rev | GGCATCTTCCATGCTGGTATAG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sánchez, M.B.; Sánchez-Gorostiaga, A.; Cuesta, T.; Martínez, J.L. The Acquisition of Colistin Resistance Is Associated to the Amplification of a Large Chromosomal Region in Klebsiella pneumoniae kp52145. Int. J. Mol. Sci. 2021, 22, 649. https://doi.org/10.3390/ijms22020649
Sánchez MB, Sánchez-Gorostiaga A, Cuesta T, Martínez JL. The Acquisition of Colistin Resistance Is Associated to the Amplification of a Large Chromosomal Region in Klebsiella pneumoniae kp52145. International Journal of Molecular Sciences. 2021; 22(2):649. https://doi.org/10.3390/ijms22020649
Chicago/Turabian StyleSánchez, María Blanca, Alicia Sánchez-Gorostiaga, Trinidad Cuesta, and José Luis Martínez. 2021. "The Acquisition of Colistin Resistance Is Associated to the Amplification of a Large Chromosomal Region in Klebsiella pneumoniae kp52145" International Journal of Molecular Sciences 22, no. 2: 649. https://doi.org/10.3390/ijms22020649
APA StyleSánchez, M. B., Sánchez-Gorostiaga, A., Cuesta, T., & Martínez, J. L. (2021). The Acquisition of Colistin Resistance Is Associated to the Amplification of a Large Chromosomal Region in Klebsiella pneumoniae kp52145. International Journal of Molecular Sciences, 22(2), 649. https://doi.org/10.3390/ijms22020649

