Suppressing Pyroptosis Augments Post-Transplant Survival of Stem Cells and Cardiac Function Following Ischemic Injury
Abstract
1. Introduction
2. Results
2.1. Macrophages Are Recruited Following I/R Injury to Heart
2.2. Pro-Pyroptotic Mediator IL-1β Increases in I/R Injured Heart
2.3. Pyroptosis-Related Gene and Protein Expression Increases in I/R Injured Heart
2.4. Pro-Inflammatory M1 Polarized Macrophage Increases Pyroptosis-Related Gene Expressions in Human Adipose-Derived Stem Cells
2.5. IL-1β Mediates the Induction of Pyroptosis in hASCs
2.6. miRNA-762 Regulates IL-1β Production during I/R Injury
2.7. miRNA-762 Augmentation Increases Post-Transplant Survival of hASC and Improves Cardiac Function Following I/R Injury
3. Discussion
4. Materials and Methods
4.1. Culture of Human Adipose Derived Stem Cells
4.2. Raw264.7 Cells Culture and Culture Medium Preparation
4.3. Experimental Induction of Hypoxia
4.4. MiRNA Transfection
4.5. Transient Knockdown of IL-1β
4.6. Reverse Transcription Polymerase Chain Reaction (RT-PCR)
4.7. Real-Time Quantitative Polymerase Chain Reaction (qRT-PCR)
| Gene | Sequence (F) | Sequence (R) |
|---|---|---|
| Mouse IL-1β | 5′–GGAGAACCAAGCAACGACAAAATA–3′ | 5′–TGGGGAACTCTGCAGACTCAAAC–3′ |
| Mouse ARG1 | 5′–ATGGAAGAGACCTTCAGCTA–3′ | 5′–GCTGTCTTCCCAAGAGTTGG–3′ |
| Mouse NOS2 | 5′–TGCTGTTCTCAGCCAACAA–3′ | 5′–GAACTCAATGGCATGAGGCA–3′ |
| Mouse CD86 | 5′–TCCTGTAGACGTGTTCCAGA–3′ | 5′–TGCTTAGACGTGCAGGTCAA–3′ |
| Mouse GAPDH | 5′–GGGTGTGAACCACGAGAAATA–3′ | 5′–GTCATGAGCCCTTCCACAAT–3′ |
| Rat Caspase1 | 5′–GGGCAAAGAGGAAGCAATTTATC–3′ | 5′–GCCAGGTAGCAGTCTTCATTAC–3′ |
| Rat Caspase11 | 5′–GTGTGGATCAGAGAGTCTTCAG–3′ | 5′–GGTGTGGTGTTGTAGAGTAGAG–3′ |
| Rat GSDMD | 5′–TTTAGTCTGCTTGCCGTACTC–3′ | 5′–GCTGTTGTCTCAACTCCATTTC–3′ |
| Rat IL-1β | 5′–GAGGACATGAGCACCTTCTTT–3′ | 5′–GCCTGTAGTGCAGTTGTCTAA–3′ |
| Rat IL-18 | 5′–AATGGAGACTTGGAATCAGACC–3′ | 5′–GCCAGTCCTCTTACTTCACTATC–3′ |
| Rat GAPDH | 5′–ATGGAGAAGGCTGGGGCTCACCT–3′ | 5′–AGCCCTTCCACGATGCCAAAGTTGT–3′ |
| Human Caspase1 | 5′–GGAAACAAAAGTCGGCAGAG–3′ | 5′–ACGCTGTACCCCAGATTTTG–3′ |
| Human Caspase4 | 5′–AAGAGAAGCAACGTATGGCAGGAC–3′ | 5′–GGACAAAGCTTGAGGGCATCTGTA–3′ |
| Human GSDMD | 5′–AGTGTGTCAACCTGTCTATCAAG–3′ | 5′–ACACTCAGCGAGTACACATTC–3′ |
| Human IL-1β | 5′–TGAGCTCGCCAGTGAAATGA–3′ | 5′–AGATTCGTAGCTGGATGCCG–3′ |
| Human GAPDH | 5′–CATGGGTGTGAACCATGAGA–3′ | 5′–GGTCATGAGTCCTTCCACGA–3′ |
4.8. MicroRNA Quantification
4.9. Immunoblot Analysis
4.10. Immunocytochemistry (ICC)
4.11. Luciferase Assay
4.12. Induction of I/R Injury and Cell Transplantation
4.13. Total RNA Sequencing and Data Analyses
4.14. Immunohistochemistry (IHC)
4.15. Hematoxylin-Eosin (H&E) Staining
4.16. Left Ventricular Catheterization for Heart Function Test
4.17. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Strauer, B.E.; Brehm, M.; Zeus, T.; Bartsch, T.; Schannwell, C.; Antke, C.; Sorg, R.V.; Kögler, G.; Wernet, P.; Müller, H.-W.; et al. Regeneration of Human Infarcted Heart Muscle by Intracoronary Autologous Bone Marrow Cell Transplantation in Chronic Coronary Artery Disease: The IACT Study. J. Am. Coll. Cardiol. 2005, 46, 1651–1658. [Google Scholar] [CrossRef] [Scilit]
- Braunwald, E. Cell-Based Therapy in Cardiac Regeneration: An Overview. Circ. Res. 2018, 123, 132–137. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Alrefai, M.; Murali, D.; Paul, A.; Ridwan, K.; Connell, J.; Shum-Tim, D. Cardiac tissue engineering and regeneration using cell-based therapy. Stem Cells Cloning Adv. Appl. 2015, 8, 81–101. [Google Scholar] [CrossRef] [Scilit]
- Strauer, B.E.; Kornowski, R. Stem Cell Therapy in Perspective. Circulation 2003, 107, 929–934. [Google Scholar] [CrossRef] [Scilit]
- Yau, T.M.; Pagani, F.D.; Mancini, D.M.; Chang, H.L.; Lala, A.; Woo, Y.J.; Acker, M.A.; Selzman, C.H.; Soltesz, E.G.; Kern, J.A.; et al. Intramyocardial Injection of Mesenchymal Precursor Cells and Successful Temporary Weaning From Left Ventricular Assist Device Support in Patients with Advanced Heart Failure: A Randomized Clinical Trial. JAMA 2019, 321, 1176–1186. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Curfman, G. Stem Cell Therapy for Heart Failure: An Unfulfilled Promise? JAMA 2019, 321, 1186–1187. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tögel, F.; Westenfelder, C. Adult bone marrow–derived stem cells for organ regeneration and repair. Dev. Dyn. 2007, 236, 3321–3331. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bussolati, B. Stem cells for organ repair: Support or replace? Organogenesis 2011, 7, 95. [Google Scholar] [CrossRef] [Scilit]
- Hwang, H.J.; Chang, W.; Song, B.-W.; Song, H.; Cha, M.-J.; Kim, I.-K.; Lim, S.; Choi, E.J.; Ham, O.; Lee, S.-Y.; et al. Antiarrhythmic Potential of Mesenchymal Stem Cell Is Modulated by Hypoxic Environment. J. Am. Coll. Cardiol. 2012, 60, 1698–1706. [Google Scholar] [CrossRef] [Scilit]
- Panth, N.; Paudel, K.R.; Parajuli, K. Reactive Oxygen Species: A Key Hallmark of Cardiovascular Disease. Adv. Med. 2016, 2016, 9152732. [Google Scholar] [CrossRef] [Scilit]
- Savla, J.J.; Levine, B.D.; Sadek, H.A. The Effect of Hypoxia on Cardiovascular Disease: Friend or Foe? High Alt. Med. Biol. 2018, 19, 124–130. [Google Scholar] [CrossRef] [Scilit]
- Granger, D.N. Ischemia-reperfusion: Mechanisms of microvascular dysfunction and the influence of risk factors for cardiovascular disease. Microcirculation 1999, 6, 167–178. [Google Scholar] [CrossRef] [PubMed]
- Duprez, L.; Wirawan, E.; Berghe, T.V.; Vandenabeele, P. Major cell death pathways at a glance. Microbes Infect. 2009, 11, 1050–1062. [Google Scholar] [CrossRef] [Scilit]
- Chiong, M.; Wang, Z.V.; Pedrozo, Z.; Cao, D.J.; Troncoso, R.; Ibacache, M.; Criollo, A.; Nemchenko, A.; Hill, J.A.; Lavandero, S. Cardiomyocyte death: Mechanisms and translational implications. Cell Death Dis. 2011, 2, e244. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cookson, B.T.; Brennan, M.A. Pro-inflammatory programmed cell death. Trends Microbiol. 2001, 9, 113–114. [Google Scholar] [CrossRef] [Scilit]
- Galluzzi, L.; Vitale, I.; Aaronson, S.A.; Abrams, J.M.; Adam, D.; Agostinis, P.; Alnemri, E.S.; Altucci, L.; Amelio, I.; Andrews, D.W.; et al. Molecular mechanisms of cell death: Recommendations of the Nomenclature Committee on Cell Death 2018. Cell Death Differ. 2018, 25, 486–541. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dagenais, M.; Skeldon, A.; Saleh, M. The inflammasome: In memory of Dr. Jurg Tschopp. Cell Death Differ. 2012, 19, 5–12. [Google Scholar] [CrossRef] [Scilit]
- Sandanger, Ø.; Ranheim, T.; Vinge, L.E.; Bliksøen, M.; Alfsnes, K.; Finsen, A.V.; Dahl, C.P.; Askevold, E.T.; Florholmen, G.; Christensen, G.; et al. The NLRP3 inflammasome is up-regulated in cardiac fibroblasts and mediates myocardial ischaemia—Reperfusion injury. Cardiovasc. Res. 2013, 99, 164–174. [Google Scholar] [CrossRef] [Scilit]
- Toldo, S.; Mauro, A.G.; Cutter, Z.S.; Abbate, A. Inflammasome, pyroptosis, and cytokines in myocardial ischemia-reperfusion injury. Am. J. Physiol. Circ. Physiol. 2018, 315, H1553–H1568. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pellegrini, C.; Antonioli, L.; Lopez-Castejon, G.; Blandizzi, C.; Fornai, M. Canonical and Non-Canonical Activation of NLRP3 Inflammasome at the Crossroad between Immune Tolerance and Intestinal Inflammation. Front. Immunol. 2017, 8, 36. [Google Scholar] [CrossRef] [Scilit]
- Fink, S.; Cookson, B.T. Caspase-1-dependent pore formation during pyroptosis leads to osmotic lysis of infected host macrophages. Cell. Microbiol. 2006, 8, 1812–1825. [Google Scholar] [CrossRef] [Scilit]
- Bergsbaken, T.; Fink, S.; Cookson, B.T. Pyroptosis: Host cell death and inflammation. Nat. Rev. Genet. 2009, 7, 99–109. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fink, S.L.; Cookson, B.T. Apoptosis, Pyroptosis, and Necrosis: Mechanistic Description of Dead and Dying Eukaryotic Cells. Infect. Immun. 2005, 73, 1907–1916. [Google Scholar] [CrossRef] [Scilit]
- Baker, P.J.; Boucher, D.; Bierschenk, D.; Tebartz, C.; Whitney, P.G.; D’Silva, D.B.; Tanzer, M.C.; Monteleone, M.; Robertson, A.A.B.; Cooper, M.A.; et al. NLRP3 inflammasome activation downstream of cytoplasmic LPS recognition by both caspase-4 and caspase-5. Eur. J. Immunol. 2015, 45, 2918–2926. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ruan, J.; Xia, S.; Liu, X.; Lieberman, J.; Wu, H. Cryo-EM structure of the gasdermin A3 membrane pore. Nat. Cell Biol. 2018, 557, 62–67. [Google Scholar] [CrossRef] [Scilit]
- Mangan, M.S.J.; Olhava, E.J.; Roush, W.R.; Seidel, H.M.; Glick, G.D.; Latz, E. Targeting the NLRP3 inflammasome in inflammatory diseases. Nat. Rev. Drug Discov. 2018, 17, 588–606. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- LaRock, C.N.; Cookson, B.T. Burning Down the House: Cellular Actions during Pyroptosis. PLoS Pathog. 2013, 9, e1003793. [Google Scholar] [CrossRef] [Scilit]
- Zhu, H.; Sun, A. Programmed necrosis in heart disease: Molecular mechanisms and clinical implications. J. Mol. Cell. Cardiol. 2018, 116, 125–134. [Google Scholar] [CrossRef] [Scilit]
- Shen, H.; Kreisel, D.; Goldstein, D.R. Processes of Sterile Inflammation. J. Immunol. 2013, 191, 2857–2863. [Google Scholar] [CrossRef] [Scilit]
- Rider, P.; Carmi, Y.; Guttman, O.; Braiman, A.; Cohen, I.; Voronov, E.; White, M.R.; Dinarello, C.A.; Apte, R.N. IL-1α and IL-1β Recruit Different Myeloid Cells and Promote Different Stages of Sterile Inflammation. J. Immunol. 2011, 187, 4835–4843. [Google Scholar] [CrossRef] [Scilit]
- Ong, S.-B.; Hernández-Reséndiz, S.; Crespo-Avilan, G.E.; Mukhametshina, R.T.; Kwek, X.-Y.; Cabrera-Fuentes, H.A.; Hausenloy, D.J. Inflammation following acute myocardial infarction: Multiple players, dynamic roles, and novel therapeutic opportunities. Pharmacol. Ther. 2018, 186, 73–87. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Davis, M.J.; Tsang, T.M.; Qiu, Y.; Dayrit, J.K.; Freij, J.B.; Huffnagle, G.B.; Olszewski, M. Macrophage M1/M2 Polarization Dynamically Adapts to Changes in Cytokine Microenvironments in Cryptococcus neoformans Infection. mBio 2013, 4, e00264-13. [Google Scholar] [CrossRef] [Scilit]
- Jablonski, K.A.; Amici, S.A.; Webb, L.M.; Ruiz-Rosado, J.D.D.; Popovich, P.G.; Partida-Sanchez, S.; Guerau-De-Arellano, M. Novel Markers to Delineate Murine M1 and M2 Macrophages. PLoS ONE 2015, 10, e0145342. [Google Scholar] [CrossRef] [Scilit]
- Eyang, Z.; Ming, X.-F. Functions of Arginase Isoforms in Macrophage Inflammatory Responses: Impact on Cardiovascular Diseases and Metabolic Disorders. Front. Immunol. 2014, 5, 533. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Viganò, E.; Diamond, C.E.; Spreafico, R.; Balachander, A.; Sobota, R.M.; Mortellaro, A. Human caspase-4 and caspase-5 regulate the one-step non-canonical inflammasome activation in monocytes. Nat. Commun. 2015, 6, 8761. [Google Scholar] [CrossRef] [Scilit]
- Brunt, K.R.; Weisel, R.D.; Li, R.-K. Stem cells and regenerative medicine—Future perspectives. Can. J. Physiol. Pharmacol. 2012, 90, 327–335. [Google Scholar] [CrossRef] [Scilit]
- Takahashi, K.; Yamanaka, S. Induction of Pluripotent Stem Cells from Mouse Embryonic and Adult Fibroblast Cultures by Defined Factors. Cell 2006, 126, 663–676. [Google Scholar] [CrossRef] [Scilit]
- Takahashi, K.; Tanabe, K.; Ohnuki, M.; Narita, M.; Ichisaka, T.; Tomoda, K.; Yamanaka, S. Induction of Pluripotent Stem Cells from Adult Human Fibroblasts by Defined Factors. Cell 2007, 131, 861–872. [Google Scholar] [CrossRef] [Scilit]
- Zuk, P.A.; Zhu, M.; Ashjian, P.; De Ugarte, D.A.; Huang, J.I.; Mizuno, H.; Alfonso, Z.C.; Fraser, J.K.; Benhaim, P.; Hedrick, M.H. Human Adipose Tissue Is a Source of Multipotent Stem Cells. Mol. Biol. Cell 2002, 13, 4279–4295. [Google Scholar] [CrossRef] [Scilit]
- Wu, S.M.; Hochedlinger, K. Harnessing the potential of induced pluripotent stem cells for regenerative medicine. Nat. Cell Biol. 2011, 13, 497–505. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Herberts, C.A.; Kwa, M.S.G.; Hermsen, H.P.H. Risk factors in the development of stem cell therapy. J. Transl. Med. 2011, 9, 29. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sart, S.; Ma, T.; Li, Y. Preconditioning Stem Cells for In Vivo Delivery. BioRes. Open Access 2014, 3, 137–149. [Google Scholar] [CrossRef] [Scilit]
- Lee, S.; Choi, E.; Cha, M.-J.; Hwang, K.-C. Cell Adhesion and Long-Term Survival of Transplanted Mesenchymal Stem Cells: A Prerequisite for Cell Therapy. Oxid. Med. Cell. Longev. 2015, 2015, 632902. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.; Abarbanell, A.M.; Herrmann, J.L.; Weil, B.R.; Manukyan, M.C.; Poynter, J.A.; Meldrum, D.R. TLR4 Inhibits Mesenchymal Stem Cell (MSC) STAT3 Activation and Thereby Exerts Deleterious Effects on MSC-Mediated Cardioprotection. PLoS ONE 2010, 5, e14206. [Google Scholar] [CrossRef] [Scilit]
- Mangi, A.A.; Noiseux, N.; Kong, D.; He, H.; Rezvani, M.; Ingwall, J.S.; Dzau, V.J. Mesenchymal stem cells modified with Akt prevent remodeling and restore performance of infarcted hearts. Nat. Med. 2003, 9, 1195–1201. [Google Scholar] [CrossRef] [Scilit]
- Wang, X.; Zhao, T.; Huang, W.; Wang, T.; Qian, J.; Xu, M.; Kranias, E.G.; Wang, Y.; Fan, G.-C. Hsp20-Engineered Mesenchymal Stem Cells are Resistant to Oxidative Stress Via Enhanced Activation of Akt and Increased Secretion of Growth Factors. Stem Cells 2009, 27, 3021–3031. [Google Scholar] [CrossRef] [Scilit]
- Liu, N.; Zhang, Y.; Fan, L.; Yuan, M.; Du, H.; Cheng, R.; Liu, D.; Lin, F. Effects of transplantation with bone marrow-derived mesenchymal stem cells modified by Survivin on experimental stroke in rats. J. Transl. Med. 2011, 9, 105. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Copland, I.B.; Lord-Dufour, S.; Cuerquis, J.; Coutu, D.L.; Annabi, B.; Wang, E.; Galipeau, J. Improved Autograft Survival of Mesenchymal Stromal Cells by Plasminogen Activator Inhibitor 1 Inhibition. Stem Cells 2009, 27, 467–477. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Song, H.; Chang, W.; Lim, S.; Seo, H.-S.; Shim, C.Y.; Park, S.; Yoo, K.-J.; Kim, B.-S.; Min, B.-H.; Lee, H.; et al. Tissue Transglutaminase Is Essential for Integrin-Mediated Survival of Bone Marrow-Derived Mesenchymal Stem Cells. Stem Cells 2007, 25, 1431–1438. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Benoit, D.S.; Tripodi, M.C.; Blanchette, J.O.; Langer, S.J.; Leinwand, L.A.; Anseth, K.S. Integrin-linked kinase production prevents anoikis in human mesenchymal stem cells. J. Biomed. Mater. Res. Part A 2007, 81, 259–268. [Google Scholar] [CrossRef] [Scilit]
- Hahn, J.-Y.; Cho, H.-J.; Kang, H.-J.; Kim, T.-S.; Kim, M.-H.; Chung, J.-H.; Bae, J.-W.; Oh, B.-H.; Park, Y.-B.; Kim, H.-S. Pre-Treatment of Mesenchymal Stem Cells With a Combination of Growth Factors Enhances Gap Junction Formation, Cytoprotective Effect on Cardiomyocytes, and Therapeutic Efficacy for Myocardial Infarction. J. Am. Coll. Cardiol. 2008, 51, 933–943. [Google Scholar] [CrossRef] [Scilit]
- Yu, J.; Yin, S.; Zhang, W.; Gao, F.; Liu, Y.; Chen, Z.; Zhang, M.; He, J.; Zheng, S. Hypoxia preconditioned bone marrow mesenchymal stem cells promote liver regeneration in a rat massive hepatectomy model. Stem Cell Res. Ther. 2013, 4, 83. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hu, X.; Yu, S.P.; Fraser, J.L.; Lu, Z.; Ogle, M.E.; Wang, J.-A.; Wei, L. Transplantation of hypoxia-preconditioned mesenchymal stem cells improves infarcted heart function via enhanced survival of implanted cells and angiogenesis. J. Thorac. Cardiovasc. Surg. 2008, 135, 799–808. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lu, G.; Haider, H.K.; Jiang, S.; Ashraf, M. Sca-1 + Stem Cell Survival and Engraftment in the Infarcted Heart: Dual role for preconditioning-induced connexin-43. Circulation 2009, 119, 2587–2596. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chang, W.; Song, B.-W.; Lim, S.; Song, H.; Shim, C.Y.; Cha, M.-J.; Ahn, D.H.; Jung, Y.-G.; Lee, D.-H.; Chung, J.H.; et al. Mesenchymal Stem Cells Pretreated with Delivered Hph-1-Hsp70 Protein Are Protected from Hypoxia-Mediated Cell Death and Rescue Heart Functions from Myocardial Injury. Stem Cells 2009, 27, 2283–2292. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Song, L.; Yang, Y.-J.; Dong, Q.-T.; Qian, H.-Y.; Gao, R.-L.; Qiao, S.-B.; Shen, R.; He, Z.-X.; Lu, M.; Zhao, S.-H.; et al. Atorvastatin Enhance Efficacy of Mesenchymal Stem Cells Treatment for Swine Myocardial Infarction via Activation of Nitric Oxide Synthase. PLoS ONE 2013, 8, e65702. [Google Scholar] [CrossRef] [Scilit]
- Huang, F.; Li, M.-L.; Fang, Z.-F.; Hu, X.-Q.; Liu, Q.-M.; Liu, Z.-J.; Tang, L.; Zhao, Y.-S.; Zhou, S.-H. Overexpression of MicroRNA-1 Improves the Efficacy of Mesenchymal Stem Cell Transplantation after Myocardial Infarction. Cardiology 2013, 125, 18–30. [Google Scholar] [CrossRef] [Scilit]
- Zhaolin, Z.; Guohua, L.; Shiyuan, W.; Zuo, W. Role of pyroptosis in cardiovascular disease. Cell Prolif. 2019, 52, e12563. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, R.; Yang, L.; Zhang, Y.; Li, J.; Xu, L.; Xiao, Y.; Zhang, Q.; Bai, L.; Zhao, S.; Liu, E.; et al. Porcine reproductive and respiratory syndrome virus induces HMGB1 secretion via activating PKC-delta to trigger inflammatory response. Virology 2018, 518, 172–183. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Qiu, Z.; Lei, S.; Zhao, B.; Wu, Y.; Su, W.; Liu, M.; Meng, Q.; Zhou, B.; Leng, Y.; Xia, Z.-Y. NLRP3 Inflammasome Activation-Mediated Pyroptosis Aggravates Myocardial Ischemia/Reperfusion Injury in Diabetic Rats. Oxidative Med. Cell. Longev. 2017, 2017, 9743280. [Google Scholar] [CrossRef] [Scilit]
- Liu, Y.; Li, P.; Qiao, C.; Wu, T.; Sun, X.; Wen, M.; Zhang, W. Chitosan Hydrogel Enhances the Therapeutic Efficacy of Bone Marrow–Derived Mesenchymal Stem Cells for Myocardial Infarction by Alleviating Vascular Endothelial Cell Pyroptosis. J. Cardiovasc. Pharmacol. 2020, 75, 75–83. [Google Scholar] [CrossRef] [Scilit]
- Yang, J.; Liu, Z.; Wang, C.; Yang, R.; Rathkey, J.K.; Pinkard, O.W.; Shi, W.; Chen, Y.; Dubyak, G.R.; Abbott, D.W.; et al. Mechanism of gasdermin D recognition by inflammatory caspases and their inhibition by a gasdermin D-derived peptide inhibitor. Proc. Natl. Acad. Sci. USA 2018, 115, 6792–6797. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hofmann, M.; Wollert, K.C.; Meyer, G.P.; Menke, A.; Arseniev, L.; Hertenstein, B.; Ganser, A.; Knapp, W.H.; Drexler, H. Monitoring of Bone Marrow Cell Homing Into the Infarcted Human Myocardium. Circulation 2005, 111, 2198–2202. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schächinger, V.; Aicher, A.; Döbert, N.; Röver, R.; Diener, J.; Fichtlscherer, S.; Assmus, B.; Seeger, F.H.; Menzel, C.; Brenner, W.; et al. Pilot Trial on Determinants of Progenitor Cell Recruitment to the Infarcted Human Myocardium. Circulation 2008, 118, 1425–1432. [Google Scholar] [CrossRef] [Scilit]
- Cordes, K.R.; Srivastava, D. MicroRNA Regulation of Cardiovascular Development. Circ. Res. 2009, 104, 724–732. [Google Scholar] [CrossRef] [Scilit]
- Latronico, M.V.G.; Condorelli, G. MicroRNAs and cardiac pathology. Nat. Rev. Cardiol. 2009, 6, 418–429. [Google Scholar] [CrossRef] [Scilit]
- Small, E.M.; Frost, R.J.; Olson, E.N. MicroRNAs Add a New Dimension to Cardiovascular Disease. Circulation 2010, 121, 1022–1032. [Google Scholar] [CrossRef] [Scilit]
- Yan, K.; An, T.; Zhai, M.; Huang, Y.; Wang, Q.; Wang, Y.; Zhang, R.; Wang, T.; Liu, J.; Zhang, Y.; et al. Mitochondrial miR-762 regulates apoptosis and myocardial infarction by impairing ND2. Cell Death Dis. 2019, 10, 500. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bencurova, P.; Baloun, J.; Hynst, J.; Oppelt, J.; Kubova, H.; Pospisilova, S.; Brazdil, M. Dynamic miRNA changes during the process of epileptogenesis in an infantile and adult-onset model. Sci. Rep. 2021, 11, 9649. [Google Scholar] [CrossRef] [Scilit]
- Port, J.D.; Walker, L.A.; Polk, J.; Nunley, K.; Buttrick, P.M.; Sucharov, C.C. Temporal expression of miRNAs and mRNAs in a mouse model of myocardial infarction. Physiol. Genom. 2011, 43, 1087–1095. [Google Scholar] [CrossRef] [Scilit]
- Wang, W.-X.; Prajapati, P.; Vekaria, H.J.; Spry, M.; Cloud, A.L.; Sullivan, P.G.; Springer, J.E. Temporal changes in inflammatory mitochondria-enriched microRNAs following traumatic brain injury and effects of miR-146a nanoparticle delivery. Neural Regen. Res. 2021, 16, 514–522. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, S.; Lim, S.; Ham, O.; Lee, S.-Y.; Lee, C.Y.; Park, J.-H.; Lee, J.; Seo, H.-H.; Yun, I.; Han, S.M.; et al. ROS-mediated bidirectional regulation of miRNA results in distinct pathologic heart conditions. Biochem. Biophys. Res. Commun. 2015, 465, 349–355. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Trapnell, C.; Pachter, L.; Salzberg, S.L. TopHat: Discovering splice junctions with RNA-Seq. Bioinformatics 2009, 25, 1105–1111. [Google Scholar] [CrossRef] [Scilit] [PubMed]






Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lee, C.Y.; Lee, S.; Jeong, S.; Lee, J.; Seo, H.-H.; Shin, S.; Park, J.-H.; Song, B.-W.; Kim, I.-K.; Choi, J.-W.; et al. Suppressing Pyroptosis Augments Post-Transplant Survival of Stem Cells and Cardiac Function Following Ischemic Injury. Int. J. Mol. Sci. 2021, 22, 7946. https://doi.org/10.3390/ijms22157946
Lee CY, Lee S, Jeong S, Lee J, Seo H-H, Shin S, Park J-H, Song B-W, Kim I-K, Choi J-W, et al. Suppressing Pyroptosis Augments Post-Transplant Survival of Stem Cells and Cardiac Function Following Ischemic Injury. International Journal of Molecular Sciences. 2021; 22(15):7946. https://doi.org/10.3390/ijms22157946
Chicago/Turabian StyleLee, Chang Youn, Seahyoung Lee, Seongtae Jeong, Jiyun Lee, Hyang-Hee Seo, Sunhye Shin, Jun-Hee Park, Byeong-Wook Song, Il-Kwon Kim, Jung-Won Choi, and et al. 2021. "Suppressing Pyroptosis Augments Post-Transplant Survival of Stem Cells and Cardiac Function Following Ischemic Injury" International Journal of Molecular Sciences 22, no. 15: 7946. https://doi.org/10.3390/ijms22157946
APA StyleLee, C. Y., Lee, S., Jeong, S., Lee, J., Seo, H.-H., Shin, S., Park, J.-H., Song, B.-W., Kim, I.-K., Choi, J.-W., Kim, S. W., Han, G., Lim, S., & Hwang, K.-C. (2021). Suppressing Pyroptosis Augments Post-Transplant Survival of Stem Cells and Cardiac Function Following Ischemic Injury. International Journal of Molecular Sciences, 22(15), 7946. https://doi.org/10.3390/ijms22157946

