Fragrance in Pandanus amaryllifolius Roxb. Despite the Presence of a Betaine Aldehyde Dehydrogenase 2
Abstract
:1. Introduction
2. Results
2.1. De Novo Transcriptome Assembly and Analysis
2.2. Isolation of PaBADH2 Transcriptome Sequence and Its Comparison with Other BADH2 Sequences
2.3. Comparative Amino Acid Sequence Analysis
2.4. Docking Analysis
2.5. BADH2 Enzyme Activity and Gene Expression Analysis
2.6. Quantification of 2AP and Other Metabolites
2.7. Enzyme Activity of Δ1-Pyrroline-5-Carboxylate Synthetase (P5CS) and Expression Analysis
3. Discussion
3.1. De Novo Transcriptomics Analysis
3.2. P. amaryllifolius Exhibits Functional BADH2 Gene
3.3. Comparative Amino Acid Sequence Analysis
3.4. Docking Analysis
3.5. Role of Precursors in the High Expression of 2AP in P. amaryllifolius
3.6. BADH2-Independent 2AP Synthesis in P. amaryllifolius?
4. Material and Methods
4.1. Plant Material
4.2. Transcriptome Analysis
4.3. RNA Sequencing, De Novo Assembly, and Functional Annotation of Unigenes
4.4. Isolation of PaBADH2 Gene Using Transcriptome Sequence
4.5. PaBADH2 Transcript Comparative Sequence Analysis
4.6. Homology Modeling and Molecular Docking of BADH2
4.7. Estimation of BADH Enzyme Activity
4.8. Quantitative Real-Time Expression of BADH2 Gene
4.9. Quantification of 2AP Using HS-SPME with GC-MS
4.10. Quantification of Proline, Methylglyoxal, and GABA
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Buttery, R. Identification of rice aroma compound 2-acetyl-1-pyrroline in pandan leaves. Chem. Ind. 1983, 1983, 478. [Google Scholar]
- Wongpornchai, S.; Sriseadka, T.; Choonvisase, S. Identification and quantitation of the rice aroma compound, 2-acetyl-1-pyrroline, in bread flowers (Vallaris glabra Ktze). J. Agric. Food Chem. 2003, 51, 457–462. [Google Scholar] [CrossRef] [PubMed]
- Nadaf, A.; Krishnan, S.; Wakte, K. Histochemical and biochemical analysis of major aroma compound (2-acetyl-1-pyrroline) in basmati and other scented rice (Oryza sativa L.). Curr. Sci. 2006, 91, 1533–1536. [Google Scholar]
- Bhattacharjee, P.; Kshirsagar, A.; Singhal, R.S. Supercritical carbon dioxide extraction of 2-acetyl-1-pyrroline from Pandanus amaryllifoliusRoxb. Food Chem. 2005, 91, 255–259. [Google Scholar] [CrossRef]
- Vartak, V. Note on Ambemohor Pat (Pandanus amaryllifoliusRoxb.) from western India. J. Bombay Nat. Hist. Soc. 1981, 78, 196–198. [Google Scholar]
- Wakte, K.V.; Nadaf, A.B.; Krishnan, S.; Thengane, R.J. Studies on lower epidermal papillae, the site of storage of basmati rice aroma compounds in Pandanus amaryllifoliusRoxb. Curr. Sci. 2007, 93, 238–242. [Google Scholar]
- Wakte, K.V.; Kad, T.D.; Zanan, R.L.; Nadaf, A.B. Mechanism of 2-acetyl-1-pyrroline biosynthesis in BassialatifoliaRoxb. flowers. Physiol. Mol. Biol. Plants 2011, 17, 231–237. [Google Scholar] [CrossRef] [Green Version]
- Wakte, K.V.; Thengane, R.J.; Jawali, N.; Nadaf, A.B. Optimization of HS-SPME conditions for quantification of 2-acetyl-1-pyrroline and study of other volatiles in Pandanus amaryllifoliusRoxb. Food Chem. 2010, 121, 595–600. [Google Scholar] [CrossRef]
- Wakte, K.V.; Zanan, R.L.; Saini, A.; Jawali, N.; Thengane, R.J.; Nadaf, A.B. Genetic diversity assessment in Pandanus amaryllifoliusRoxb. populations of India. Genet. Res. Crop Evol. 2012, 59, 1583–1595. [Google Scholar] [CrossRef]
- Bradbury, L.M.; Fitzgerald, T.L.; Henry, R.J.; Jin, Q.; Waters, D.L. The gene for fragrance in rice. Plant Biotechnol. J. 2005, 3, 363–370. [Google Scholar] [CrossRef]
- Bradbury, L.M.; Gillies, S.A.; Brushett, D.J.; Waters, D.L.; Henry, R.J. Inactivation of an aminoaldehyde dehydrogenase is responsible for fragrance in rice. Plant Mol. Biol. 2008, 68, 439–449. [Google Scholar] [CrossRef] [Green Version]
- Fitzgerald, T.L.; Waters, D.L.E.; Brooks, L.O.; Henry, R.J. Fragrance in rice (Oryza sativa) is associated with reduced yield under salt treatment. Environ. Exp. Bot. 2010, 69, 223. [Google Scholar] [CrossRef]
- Farres, J.; Wang, T.T.; Cunningham, S.J.; Weiner, H. Investigation of the active site cysteine residue of rat liver mitochondrial aldehyde dehydrogenase by site-directed mutagenesis. Biochemistry 1995, 34, 2592–2598. [Google Scholar] [CrossRef]
- Perez-Miller, S.J.; Hurley, T.D. Coenzyme isomerization is integral to catalysis in aldehyde dehydrogenase. Biochemistry 2003, 42, 7100–7109. [Google Scholar] [CrossRef]
- Wang, X.; Weiner, H. Involvement of glutamate 268 in the active site of human liver mitochondrial (class 2) aldehyde dehydrogenase as probed by site-directed mutagenesis. Biochemistry 1995, 34, 237–243. [Google Scholar] [CrossRef]
- Cheetangdee, V.; Chaiseri, S. Free amino acid and reducing sugar composition of pandan (Pandanus amaryllifolius) leaves. Agric. Nat. Res. 2006, 40, 67–74. [Google Scholar]
- Thimmaraju, R.; Bhagyalakshmi, N.; Narayan, M.; Venkatachalam, L.; Ravishankar, G. In vitro culture of Pandanus amaryllifolius and enhancement of 2-acetyl-1-pyrroline, the major flavouring compound of aromatic rice, by precursor feeding of L-proline. J. Sci. Food Agric. 2005, 85, 2527–2534. [Google Scholar] [CrossRef]
- Suprasanna, P.; Ganapathi, T.; Ramaswamy, N.; Surendranathan, K.; Rao, P. Aroma synthesis in cell and callus cultures of rice. Rice Genet News 1998, 15, 123–125. [Google Scholar]
- Yoshihashi, T.; Nguyen, T.T.H.; Kabaki, N. Area dependency of 2-acetyl-1-pyrroline content in an aromatic rice variety, Khao Dawk Mali 105. Jpn. Agric. Res. Q. 2004, 38, 105–109. [Google Scholar] [CrossRef] [Green Version]
- Arora, V.; Sultana, M.; Kumar, V.; Gangopadhyay, G. Isolation and characterization of BADH2 gene from in vitro propagated Pandanus amaryllifoliusRoxb. Plant. Cell Tissue Organ Cult. 2017, 130, 131–140. [Google Scholar] [CrossRef]
- Yadav, S.K.; Singla-Pareek, S.L.; Ray, M.; Reddy, M.; Sopory, S. Methylglyoxal levels in plants under salinity stress are dependent on glyoxalase I and glutathione. Biochem. Biophys. Res. Commun. 2005, 337, 61–67. [Google Scholar] [CrossRef] [PubMed]
- Shelp, B.J.; Mullen, R.T.; Waller, J.C. Compartmentation of GABA metabolism raises intriguing questions. Trends Plant Sci. 2012, 17, 57–59. [Google Scholar] [CrossRef] [PubMed]
- Rashmi, D.; Nadaf, A. Understanding the Mechanism of Salt Tolerance in Pandanus odorifer L. Proc. Natl. Acad. Sci. India Sect. B Biol. Sci. 2018, 88, 1557–1563. [Google Scholar] [CrossRef]
- Kaikavoosi, K.; Kad, T.D.; Zanan, R.L.; Nadaf, A.B. 2-Acetyl-1-pyrroline augmentation in scented indica rice (Oryza sativa L.) varieties through Δ 1-pyrroline-5-carboxylate synthetase (P5CS) gene transformation. Appl. Biochem. Biotechnol. 2015, 177, 1466–1479. [Google Scholar] [CrossRef] [PubMed]
- Rashmi, D.; Barvkar, V.T.; Nadaf, A.; Mundhe, S.; Kadoo, N.Y. Integrative omics analysis in Pandanus odorifer (Forssk.) Kuntze reveals the role of Asparagine synthetase in salinity tolerance. Sci. Rep. 2019, 9, 932. [Google Scholar] [CrossRef] [PubMed]
- Tylichová, M.; Kopečný, D.; Moréra, S.; Briozzo, P.; Lenobel, R.; Snégaroff, J.; Šebela, M. Structural and functional characterization of plant aminoaldehyde dehydrogenase from Pisum sativum with a broad specificity for natural and synthetic aminoaldehydes. J. Mol. Biol. 2010, 396, 870–882. [Google Scholar] [CrossRef] [PubMed]
- Baicharoen, A.; Vijayan, R.; Pongprayoon, P. Structural insights into betaine aldehyde dehydrogenase (BADH2) from Oryza sativa explored by modeling and simulations. Sci. Rep. 2018, 8, 12892. [Google Scholar] [CrossRef] [Green Version]
- Kopečný, D.; Tylichová, M.; Snegaroff, J.; Popelková, H.; Šebela, M. Carboxylate and aromatic active-site residues are determinants of high-affinity binding of ω-aminoaldehydes to plant aminoaldehyde dehydrogenases. FEBS J. 2011, 278, 3130–3139. [Google Scholar] [CrossRef] [Green Version]
- Mann, C.J.; Weiner, H. Differences in the roles of conserved glutamic acid residues in the active site of human class 3 and class 2 aldehyde dehydrogenases. Protein Sci. 1999, 8, 1922–1929. [Google Scholar] [CrossRef] [Green Version]
- Kamaraj, B.; Purohit, R. In-silico analysis of Betaine Aldehyde Dehydrogenase2 of Oryza sativa and significant mutations responsible for fragrance. J. Plant Interact. 2013, 8, 321–333. [Google Scholar] [CrossRef]
- Srivong, P.; Wangsomnuk, P.; Pongdontri, P. Characterization of a fragrant gene and enzymatic activity of betaine aldehyde dehydrogenase in aromatic and nonaromatic thai rice cultivars. KKU Sci. J. 2008, 36, 290–301. [Google Scholar]
- Arakawa, K.; Katayama, M.; Takabe, T. Levels of betaine and betaine aldehyde dehydrogenase activity in the green leaves, and etiolated leaves and roots of barley. Plant Cell Physiol. 1990, 31, 797–803. [Google Scholar]
- Hien, N.L.; Yoshihashi, T.; Sarhadi, W.A.; Hirata, Y. Sensory test for aroma and quantitative analysis of 2-acetyl-1-pyrroline in Asian aromatic rice varieties. Plant Product. Sci. 2006, 9, 294–297. [Google Scholar] [CrossRef]
- Huang, T.-C.; Teng, C.-S.; Chang, J.-L.; Chuang, H.-S.; Ho, C.-T.; Wu, M.-L. Biosynthetic mechanism of 2-acetyl-1-pyrroline and its relationship with Δ1-pyrroline-5-carboxylic acid and methylglyoxal in aromatic rice (Oryza sativa L.) callus. J. Agric. Food Chem. 2008, 56, 7399–7404. [Google Scholar] [CrossRef]
- Wu, M.L.; Chou, K.L.; Wu, C.R.; Chen, J.K.; Huang, T.C. Characterization and the possible formation mechanism of 2-acetyl-1-pyrroline in aromatic vegetable soybean (Glycine max L.). J. Food Sci. 2009, 74, S192–S197. [Google Scholar] [CrossRef]
- Chen, S.; Yang, Y.; Shi, W.; Ji, Q.; He, F.; Zhang, Z.; Cheng, Z.; Liu, X.; Xu, M. Badh2, encoding betaine aldehyde dehydrogenase, inhibits the biosynthesis of 2-acetyl-1-pyrroline, a major component in rice fragrance. Plant Cell 2008, 20, 1850–1861. [Google Scholar] [CrossRef] [Green Version]
- Sakthivel, K.; Sundaram, R.; Rani, N.S.; Balachandran, S.; Neeraja, C. Genetic and molecular basis of fragrance in rice. Biotechnol. Adv. 2009, 27, 468–473. [Google Scholar] [CrossRef]
- Fitzgerald, T.L.; Waters, D.L.E.; Henry, R.J. The effect of salt on betaine aldehyde dehydrogenase transcript levels and 2-acetyl-1-pyrroline concentration in fragrant and non-fragrant rice (Oryza sativa). Plant Sci. 2008, 175, 539–546. [Google Scholar] [CrossRef]
- Haas, B.J.; Papanicolaou, A.; Yassour, M.; Grabherr, M.; Blood, P.D.; Bowden, J.; Couger, M.B.; Eccles, D.; Li, B.; Lieber, M. De novo transcript sequence reconstruction from RNA-seq using the Trinity platform for reference generation and analysis. Nat. Protoc. 2013, 8, 1494–1512. [Google Scholar] [CrossRef]
- Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef]
- Deng, W.; Nickle, D.C.; Learn, G.H.; Maust, B.; Mullins, J.I. ViroBLAST: A stand-alone BLAST web server for flexible queries of multiple databases and user’s datasets. Bioinformatics 2007, 23, 2334–2336. [Google Scholar] [CrossRef]
- Trott, O.; Olson, A.J. AutoDock Vina: Improving the speed and accuracy of docking with a new scoring function, efficient optimization, and multithreading. J. Comput. Chem. 2010, 31, 455–461. [Google Scholar] [CrossRef] [Green Version]
- Weretilnyk, E.A.; Hanson, A.D. Betaine aldehyde dehydrogenase from spinach leaves: Purification, in vitro translation of the mRNA, and regulation by salinity. Arch. Biochem. Biophys. 1989, 271, 56–63. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Hinge, V.R.; Patil, H.B.; Nadaf, A.B. Aroma volatile analyses and 2AP characterization at various developmental stages in Basmati and Non-Basmati scented rice (Oryza sativa L.) cultivars. Rice 2016, 9, 38. [Google Scholar] [CrossRef]
- Van Den Dool, H.; Kratz, P.D. A generalization of the retention index system including linear temperature programmed gas-liquid partition chromatography. J. Chromatogr. A 1963, 11, 463–471. [Google Scholar] [CrossRef]
- Grimm, C.C.; Champagne, E.T.; Lloyd, S.W.; Easson, M.; Condon, B.; McClung, A. Analysis of 2-acetyl-1-pyrroline in rice by HSSE/GC/MS. Cereal Chem. 2011, 88, 271–277. [Google Scholar] [CrossRef]
- Gay, F.; Maraval, I.; Roques, S.; Gunata, Z.; Boulanger, R.; Audebert, A.; Mestres, C. Effect of salinity on yield and 2-acetyl-1-pyrroline content in the grains of three fragrant rice cultivars (Oryza sativa L.) in Camargue (France). Field Crops Res. 2010, 117, 154–160. [Google Scholar] [CrossRef]
- Bates, L.S.; Waldren, R.P.; Teare, I. Rapid determination of free proline for water-stress studies. Plant Soil 1973, 39, 205–207. [Google Scholar] [CrossRef]
- Wild, R.; Ooi, L.; Srikanth, V.; Münch, G. A quick, convenient and economical method for the reliable determination of methylglyoxal in millimolar concentrations: The N-acetyl-L-cysteine assay. Anal. Bioanal. Chem. 2012, 403, 2577–2581. [Google Scholar] [CrossRef] [PubMed]
- García-Ríos, M.; Fujita, T.; LaRosa, P.C.; Locy, R.D.; Clithero, J.M.; Bressan, R.A.; Csonka, L.N. Cloning of a polycistronic cDNA from tomato encoding γ-glutamyl kinase and γ-glutamyl phosphate reductase. Proc. Natl. Acad. Sci. USA 1997, 94, 8249–8254. [Google Scholar] [CrossRef] [Green Version]








| Name of Primer | Primer Sequences |
|---|---|
| F Pan BADH2 (Pandanus) | 5′TGTTGTAAGTCAAGGACAGTATGC3′ |
| R Pan BADH2 (Pandanus) | 5′CCGCCCACCTCCAAATAATATAG3′ |
| F Rice BADH2 (Rice) | 5′ ATTTGTATCTACCGCCAAAAGC3′ |
| R Rice BADH2 (Rice) | 5′CGACATCAGTAATGATTGTGGGT3′ |
| F Pan P5CS (Pandanus) | 5′GAGGCAGCAACAAGCTTGT3′ |
| R Pan P5CS (Pandanus) | 5′GTGTACAAGAAGGGTTTCCAT3′ |
| F Rice P5CS (Rice) | 5′GAAGTGGTAATGGTCTTCTC3′ |
| R Rice P5CS (Rice) | 5′AGCAAATCTGCGATCTCATC3′ |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bhatt, V.; Barvkar, V.T.; Furtado, A.; Henry, R.J.; Nadaf, A. Fragrance in Pandanus amaryllifolius Roxb. Despite the Presence of a Betaine Aldehyde Dehydrogenase 2. Int. J. Mol. Sci. 2021, 22, 6968. https://doi.org/10.3390/ijms22136968
Bhatt V, Barvkar VT, Furtado A, Henry RJ, Nadaf A. Fragrance in Pandanus amaryllifolius Roxb. Despite the Presence of a Betaine Aldehyde Dehydrogenase 2. International Journal of Molecular Sciences. 2021; 22(13):6968. https://doi.org/10.3390/ijms22136968
Chicago/Turabian StyleBhatt, Vacha, Vitthal T. Barvkar, Agnelo Furtado, Robert J. Henry, and Altafhusain Nadaf. 2021. "Fragrance in Pandanus amaryllifolius Roxb. Despite the Presence of a Betaine Aldehyde Dehydrogenase 2" International Journal of Molecular Sciences 22, no. 13: 6968. https://doi.org/10.3390/ijms22136968
APA StyleBhatt, V., Barvkar, V. T., Furtado, A., Henry, R. J., & Nadaf, A. (2021). Fragrance in Pandanus amaryllifolius Roxb. Despite the Presence of a Betaine Aldehyde Dehydrogenase 2. International Journal of Molecular Sciences, 22(13), 6968. https://doi.org/10.3390/ijms22136968

