Prevention of High Glucose-Mediated EMT by Inhibition of Hsp70 Chaperone
Abstract
:1. Introduction
2. Results
2.1. Expression of Hsp70 Links to the Capacity of Hyperglycemia-Induced EMT
2.2. Suppressing Hsp70 Reduces the Ability of Colon Cancer Cells to Pass EMT under Hyperglycemia Conditions
2.3. Inhibition of Chaperonic Function Leads to Downregulation of EMT in Colon Cancer Cells
3. Materials and Methods
3.1. Cells and Treatment
3.2. Wound Healing Assay
3.3. Chemicals
3.4. Western Blotting
3.5. RNA Isolation and Quantitative Real-Time PCR
3.6. Immunocytochemistry
3.7. Chap-ELISA
3.8. Statistics
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Weitz, J.; Koch, M.; Debus, J.; Höhler, T.; Galle, P.R.; Büchler, M.W. Colorectal cancer. Lancet 2005, 365, 153–165. [Google Scholar] [CrossRef]
- Brenner, H.; Kloor, M.; Pox, C.P. Colorectal cancer. Lancet 2014, 383, 1490–1502. [Google Scholar] [CrossRef]
- de Jong, M.C.; Pulitano, C.; Ribero, D.; Strub, J.; Mentha, G.; Schulick, R.D.; Choti, M.A.; Aldrighetti, L.; Capussotti, L.; Pawlik, T.M. Rates and patterns of recurrence following curative intent surgery for colorectal liver metastasis: An international multi-institutional analysis of 1669 patients. Ann. Surg. 2009, 250, 440–448. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cao, H.; Xu, E.; Liu, H.; Wan, L.; Lai, M. Epithelial-mesenchymal transition in colorectal cancer metastasis: A system review. Pathol. Res. Pract. 2015, 211, 557–569. [Google Scholar] [CrossRef]
- Børretzen, A.; Gravdal, K.; Haukaas, S.A.; Mannelqvist, M.; Beisland, C.; Akslen, L.A.; Halvorsen, O.J. The epithelial-mesenchymal transition regulators Twist, Slug, and Snail are associated with aggressive tumour features and poor outcome in prostate cancer patients. J. Pathol. Clin. Res. 2021, 19. [Google Scholar] [CrossRef]
- Warburg, O. On the origin of cancer cells. Science 1956, 123, 309–314. [Google Scholar] [CrossRef] [PubMed]
- Garg, S.K.; Maurer, H.; Reed, K.; Selagamsetty, R. Diabetes and cancer: Two diseases with obesity as a common risk factor. Diabetes Obes. Metab. 2014, 16, 97–110. [Google Scholar] [CrossRef]
- Alisson-Silva, F.; Freire-de-Lima, L.; Donadio, J.L.; Lucena, M.C.; Penha, L.; Sá-Diniz, J.N.; Dias, W.B.; Todeschini, A.R. Increase of O-glycosylated oncofetal fibronectin in high glucose-induced epithelial-mesenchymal transition of cultured human epithelial cells. PLoS ONE 2013, 8, e60471. [Google Scholar] [CrossRef] [Green Version]
- Hanahan, D.; Weinberg, R.A. Hallmarks of cancer: The next generation. Cell 2011, 144, 646–674. [Google Scholar] [CrossRef] [Green Version]
- Flores-López, L.A.; Martínez-Hernández, M.G.; Viedma-Rodríguez, R.; Díaz-Flores, M.; Baiza-Gutman, L.A. High glucose and insulin enhance uPA expression, ROS formation and invasiveness in breast cancer-derived cells. Cell Oncol. 2016, 39, 365–378. [Google Scholar] [CrossRef]
- Viedma-Rodríguez, R.; Martínez-Hernández, M.G.; Flores-López, L.A.; Baiza-Gutman, L.A. Epsilon-aminocaproic acid prevents high glucose and insulin induced-invasiveness in MDA-MB-231 breast cancer cells, modulating the plasminogen activator system. Mol. Cell. Biochem. 2018, 437, 65–80. [Google Scholar] [CrossRef] [PubMed]
- Sun, X.F.; Shao, Y.B.; Liu, M.G.; Chen, Q.; Liu, Z.J.; Xu, B.; Luo, S.X.; Liu, H. High-concentration glucose enhances invasion in invasive ductal breast carcinoma by promoting Glut1/MMP2/MMP9 axis expression. Oncol. Lett. 2017, 13, 2989–2995. [Google Scholar] [CrossRef] [Green Version]
- Li, W.; Zhang, X.; Sang, H.; Zhou, Y.; Shang, C.; Wang, Y.; Zhu, H. Effects of hyperglycemia on the progression of tumor diseases. J. Exp. Clin. Cancer Res. 2019, 38, 327. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Calderwood, S.K.; Gong, J. Heat Shock Proteins Promote Cancer: It’s a Protection Racket. Trends Biochem. Sci. 2016, 41, 311–323. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gabai, V.L.; Meriin, A.B.; Mosser, D.D.; Caron, A.W.; Rits, S.; Shifrin, V.I.; Sherman, M.Y. Hsp70 prevents activation of stress kinases. A novel pathway of cellular thermotolerance. J. Biol. Chem. 1997, 272, 18033–18037. [Google Scholar] [CrossRef] [Green Version]
- Beere, H.M.; Wolf, B.B.; Cain, K.; Mosser, D.D.; Mahboubi, A.; Kuwana, T.; Tailor, P.; Morimoto, R.I.; Cohen, G.M.; Green, D.R. Heat-shock protein 70 inhibits apoptosis by preventing recruitment of procaspase-9 to the Apaf-1 apoptosome. Nat. Cell Biol. 2000, 2, 469–475. [Google Scholar] [CrossRef] [PubMed]
- Komarova, E.Y.; Afanasyeva, E.A.; Bulatova, M.M.; Cheetham, M.E.; Margulis, B.A.; Guzhova, I.V. Downstream caspases are novel targets for the antiapoptotic activity of the molecular chaperone hsp70. Cell Stress Chaperones 2004, 9, 265–275. [Google Scholar] [CrossRef] [Green Version]
- Gunaldi, M.; Kocoglu, H.; Okuturlar, Y.; Gedikbasi, A.; Karabulut, M.; Alis, H.; Hursitoglu, M. Heat shock protein 70 is a useful marker for predicting colorectal cancer. J. BUON 2015, 20, 1464–1470. [Google Scholar]
- Xiong, J.; Jiang, X.M.; Mao, S.S.; Yu, X.N.; Huang, X.X. Heat shock protein 70 downregulation inhibits proliferation, migration and tumorigenicity in hepatocellular carcinoma cells. Oncol. Lett. 2017, 14, 2703–2708. [Google Scholar] [CrossRef] [Green Version]
- Kluger, H.M.; Chelouche Lev, D.; Kluger, Y.; McCarthy, M.M.; Kiriakova, G.; Camp, R.L.; Rimm, D.L.; Price, J.E. Using a xenograft model of human breast cancer metastasis to find genes associated with clinically aggressive disease. Cancer Res. 2005, 65, 5578–5587. [Google Scholar] [CrossRef] [Green Version]
- Canöz, O.; Belenli, O.; Patiroglu, T.E. General features of gastric carcinomas and comparison of HSP70 and NK cell immunoreactivity with prognostic factors. Pathol. Oncol. Res. 2002, 8, 262–269. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yun, C.H.; Yoon, S.Y.; Nguyen, T.T.; Cho, H.Y.; Kim, T.H.; Kim, S.T.; Kim, B.C.; Hong, Y.S.; Kim, S.J.; Lee, H.J. Geldanamycin inhibits TGF-beta signaling through induction of Hsp70. Arch. Biochem. Biophys. 2010, 495, 8–13. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Kang, X.; Wang, Q. HSP70 decreases receptor-dependent phosphorylation of Smad2 and blocks TGF-β-induced epithelial-mesenchymal transition. J. Genet. Genom. 2011, 38, 111–116. [Google Scholar] [CrossRef] [PubMed]
- Lazarev, V.F.; Onokhin, K.V.; Antimonova, O.I.; Polonik, S.G.; Guzhova, I.V.; Margulis, B.A. Kinetics of chaperone activity of proteins Hsp70 and Hdj1 in human leukemia u-937 cells after preconditioning with thermal shock or compound U-133. Biochemistry 2011, 76, 590–595. [Google Scholar] [CrossRef] [PubMed]
- Ekimova, I.V.; Plaksina, D.V.; Pastukhov, Y.F.; Lapshina, K.V.; Lazarev, V.F.; Mikhaylova, E.R.; Polonik, S.G.; Pani, B.; Margulis, B.A.; Guzhova, I.V.; et al. New HSF1 inducer as a therapeutic agent in a rodent model of Parkinson’s disease. Exp. Neurol. 2018, 306, 199–208. [Google Scholar] [CrossRef]
- Nikotina, A.D.; Koludarova, L.; Komarova, E.Y.; Mikhaylova, E.R.; Aksenov, N.D.; Suezov, R.; Kartzev, V.G.; Margulis, B.A.; Guzhova, I.V. Discovery and optimization of cardenolides inhibiting HSF1 activation in human colon HCT-116 cancer cells. Oncotarget 2018, 9, 27268–27279. [Google Scholar] [CrossRef]
- Yang, J.; Gong, W.; Wu, S.; Zhang, H.; Perrett, S. PES inhibits human-inducible Hsp70 by covalent targeting of cysteine residues in the substrate-binding domain. J. Biol. Chem. 2020, 296, 100210. [Google Scholar] [CrossRef]
- Sheng, L.; Tang, T.; Liu, Y.; Ma, Y.; Wang, Z.; Tao, H.; Zhang, Y.; Qi, Z. Inducible HSP70 antagonizes cisplatin-induced cell apoptosis through inhibition of the MAPK signaling pathway in HGC-27 cells. Int. J. Mol. Med. 2018, 42, 2089–2097. [Google Scholar] [CrossRef] [Green Version]
- Weiser, M.R. AJCC 8th Edition: Colorectal Cancer. Ann. Surg. Oncol. 2018, 25, 1454–1455. [Google Scholar] [CrossRef] [Green Version]
- World Medical Association Declaration of Helsinki: Ethical Principles for Medical Research Involving Human Subjects. JAMA 2013, 310, 2191–2194. [CrossRef] [Green Version]
- Polonik, S.G.; Tolkach, A.M.; Uvarova, N.I. Glycosidation of echinochrome and related hydroxynaphthazarins by orthoester method. Rus. J. Org. Chem. 1994, 30, 248–253. (In Russian) [Google Scholar]
- Kondoh, Y.; Osada, H. High-throughput screening identifies small molecule inhibitors of molecular chaperones. Curr. Pharm. Des. 2013, 19, 473–492. [Google Scholar] [CrossRef] [PubMed]
- Weidenfeld, K.; Barkan, D. EMT and Stemness in Tumor Dormancy and Outgrowth: Are They Intertwined Processes? Front. Oncol. 2018, 8, 381. [Google Scholar] [CrossRef] [PubMed]
- Shnaider, P.V.; Ivanova, O.M.; Malyants, I.K.; Anufrieva, K.S.; Semenov, I.A.; Pavlyukov, M.S.; Lagarkova, M.A.; Govorun, V.M.; Shender, V.O. New Insights into Therapy-Induced Progression of Cancer. Int. J. Mol. Sci. 2020, 21, 7872. [Google Scholar] [CrossRef]
- Ryu, S.W.; Stewart, R.; Pectol, D.C.; Ender, N.A.; Wimalarathne, O.; Lee, J.H.; Zanini, C.P.; Harvey, A.; Huibregtse, J.M.; Mueller, P.; et al. Proteome-wide identification of HSP70/HSC70 chaperone clients in human cells. PLoS Biol. 2020, 18, e3000606. [Google Scholar] [CrossRef]
- Gong, J.; Weng, D.; Eguchi, T.; Murshid, A.; Sherman, M.Y.; Song, B.; Calderwood, S.K. Targeting the hsp70 gene delays mammary tumor initiation and inhibits tumor cell metastasis. Oncogene 2015, 34, 5460–5471. [Google Scholar] [CrossRef]
- Zaimoku, R.; Miyashita, T.; Tajima, H.; Takamura, H.; Harashima, A.I.; Munesue, S.; Yamamoto, Y.; Ninomiya, I.; Fushida, S.; Harada, K. Monitoring of Heat Shock Response and Phenotypic Changes in Hepatocellular Carcinoma after Heat Treatment. Anticancer Res. 2019, 39, 5393–5401. [Google Scholar] [CrossRef] [PubMed]
- Qi, Z.; Tang, T.; Sheng, L.; Ma, Y.; Liu, Y.; Yan, L.; Qi, S.; Ling, L.; Zhang, Y. Salidroside inhibits the proliferation and migration of gastric cancer cells via suppression of Src-associated signaling pathway activation and heat shock protein 70 expression. Mol. Med. Rep. 2018, 18, 147–156. [Google Scholar] [CrossRef]
- Kasioumi, P.; Vrazeli, P.; Vezyraki, P.; Zerikiotis, S.; Katsouras, C.; Damalas, A.; Angelidis, C. Hsp70 (HSP70A1A) downregulation enhances the metastatic ability of cancer cells. Int. J. Oncol. 2019, 54, 821–832. [Google Scholar] [CrossRef]
- Shi, F.; Ma, M.; Zhai, R.; Ren, Y.; Li, K.; Wang, H.; Xu, C.; Huang, X.; Wang, N.; Zhou, F.; et al. Overexpression of heat shock protein 70 inhibits epithelial-mesenchymal transition and cell migration induced by transforming growth factor-β in A549 cells. Cell Stress Chaperones 2021, 17. [Google Scholar] [CrossRef]
- Wang, G.; Wang, J.J.; Yin, P.H.; Xu, K.; Wang, Y.Z.; Shi, F.; Gao, J.; Fu, X.L. New strategies for targeting glucose metabolism-mediated acidosis for colorectal cancertherapy. J. Cell Physiol. 2018, 234, 348–368. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dong, B.; Jaeger, A.M.; Thiele, D.J. Inhibiting Heat Shock Factor 1 in Cancer: A Unique Therapeutic Opportunity. Trends Pharmacol. Sci. 2019, 40, 986–1005. [Google Scholar] [CrossRef] [PubMed]
- Yang, S.; Chen, J.; Guo, Z.; Xu, X.M.; Wang, L.; Pei, X.F.; Yang, J.; Underhill, C.B.; Zhang, L. Triptolide inhibits the growth and metastasis of solid tumors. Mol. Cancer Ther. 2003, 2, 65–72. [Google Scholar] [PubMed]
- Hou, W.; Liu, B.; Xu, H. Triptolide: Medicinal chemistry, chemical biology and clinical progress. Eur. J. Med. Chem. 2019, 176, 378–392. [Google Scholar] [CrossRef]
- Chen, K.; Qian, W.; Li, J.; Jiang, Z.; Cheng, L.; Yan, B.; Cao, J.; Sun, L.; Zhou, C.; Lei, M.; et al. Loss of AMPK activation promotes the invasion and metastasis of pancreatic cancer through an HSF1-dependent pathway. Mol. Oncol. 2017, 11, 1475–1492. [Google Scholar] [CrossRef]
- Albakova, Z.; Armeev, G.A.; Kanevskiy, L.M.; Kovalenko, E.I.; Sapozhnikov, A.M. HSP70 Multi-Functionality in Cancer. Cells 2020, 9, 587. [Google Scholar] [CrossRef] [Green Version]
- Kim, J.S.; Son, Y.; Jung, M.G.; Jeong, Y.J.; Kim, S.H.; Lee, S.J.; Lee, Y.J.; Lee, H.J. Geranylgeranylacetone alleviates radiation-induced lung injury by inhibiting epithelial-to-mesenchymal transition signaling. Mol. Med. Rep. 2016, 13, 4666–4670. [Google Scholar] [CrossRef]
- Shevtsov, M.; Multhoff, G.; Mikhaylova, E.; Shibata, A.; Guzhova, I.; Margulis, B. Combination of Anti-Cancer Drugs with Molecular Chaperone Inhibitors. Int. J. Mol. Sci. 2019, 20, 5284. [Google Scholar] [CrossRef] [Green Version]






| Antibodies to: | Manufacturer | Catalogue Number |
|---|---|---|
| Vimentin | Abcam | ab137321 |
| E-cadherin | Abcam | ab40772 |
| Hsp70 | Homemade | clone 2E4 |
| GAPDH | Thermo Fisher | AM4300 |
| ß-tubulin | Thermo Fisher | MA1-80017 |
| HSF1 | Cell Signaling | #4356 |
| GAM | Abcam | ab6789 |
| GARabbit | Abcam | ab6721 |
| GARat | Sigma-Aldrich (Merck) | AP136P |
| Goat pAb to Ms IgG Alexa647 | Abcam | ab150115 |
| β-actin | Forward | CCATCATGAAGTGTGACGTGG |
| Reverse | GTCCGCCTAGAAGCATTTGCG | |
| Snail | Forward | CATCCTTCTCACTGCCATG |
| Reverse | GTCTTCATCAAAGTCCTGTGG | |
| E-cadherin | Forward | AGGCCAAGCAGCAGTACATT |
| Reverse | ATTCACATCCAGCACATCCA | |
| Slug | Forward | ATGAGGAATCTGGCTGCTGT |
| Reverse | CAGGAGAAAATGCCTTTGGA | |
| Twist | Forward | TGCATGCATTCTCAAGAGGT |
| Reverse | CTATGGTTTTGCAGGCCAGT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Nikotina, A.D.; Vladimirova, S.A.; Komarova, E.Y.; Alexeev, D.; Efremov, S.; Leonova, E.; Pavlov, R.; Kartsev, V.G.; Polonik, S.G.; Margulis, B.A.; et al. Prevention of High Glucose-Mediated EMT by Inhibition of Hsp70 Chaperone. Int. J. Mol. Sci. 2021, 22, 6902. https://doi.org/10.3390/ijms22136902
Nikotina AD, Vladimirova SA, Komarova EY, Alexeev D, Efremov S, Leonova E, Pavlov R, Kartsev VG, Polonik SG, Margulis BA, et al. Prevention of High Glucose-Mediated EMT by Inhibition of Hsp70 Chaperone. International Journal of Molecular Sciences. 2021; 22(13):6902. https://doi.org/10.3390/ijms22136902
Chicago/Turabian StyleNikotina, Alina D., Snezhana A. Vladimirova, Elena Y. Komarova, Dmitry Alexeev, Sergey Efremov, Elizaveta Leonova, Rostislav Pavlov, Viktor G. Kartsev, Sergey G. Polonik, Boris A. Margulis, and et al. 2021. "Prevention of High Glucose-Mediated EMT by Inhibition of Hsp70 Chaperone" International Journal of Molecular Sciences 22, no. 13: 6902. https://doi.org/10.3390/ijms22136902
APA StyleNikotina, A. D., Vladimirova, S. A., Komarova, E. Y., Alexeev, D., Efremov, S., Leonova, E., Pavlov, R., Kartsev, V. G., Polonik, S. G., Margulis, B. A., & Guzhova, I. V. (2021). Prevention of High Glucose-Mediated EMT by Inhibition of Hsp70 Chaperone. International Journal of Molecular Sciences, 22(13), 6902. https://doi.org/10.3390/ijms22136902

