2-O-Methylhonokiol Suppresses HCV Replication via TRAF6-Mediated NF-kB Activation
Abstract
1. Introduction
2. Results
2.1. Inhibitory Effects of 2-O-Methylhonokiol on HCV Replication
2.2. Comparison of 2-O-Methylhonokiol and Honokiol on Cytotoxicity and HCV Replication Inhibition
2.3. 2-O-Methylhonokiol Suppresses HCV Replication through NF-kB Activation
2.4. 2-O-Methylhonokiol Enhances TRAF6-Mediated NF-kB Activation
2.5. 2-O-Methylhonokiol Stimulates Innate Immune Responses
2.6. Conditioned Media from 2-O-Methylhonokiol-Trated Cells also Inhibit HCV Replication
3. Discussion
4. Materials and Methods
4.1. Cells and Compounds
4.2. Plasmids, siRNAs Transfection
4.3. Cell Viability Assay
4.4. Luciferase Reporter Assay
4.5. Quantitative Real-Time Reverse Transcription Polymerase Chain Reaction (qRT-PCR)
4.6. Western Blotting
4.7. Immunoprecipitation
4.8. Nuclear-Cytosol Fraction
4.9. Confocal Immunofluorescence Microscopy
4.10. IFN-α ELISA
4.11. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
HCV | Hepatitis C virus |
NF-kB | Nuclear factor kappa-light-chain-enhancer of activated B cells |
TRAF6 | Tumor necrosis factor receptor (TNFR)-associated factor 6 |
INF | Interferon |
DAA | Direct Acting Antiviral |
PRRs | Pattern Recognition Receptors |
RLRs | Retinoic acid-inducible gene I product (RIG-I)-like receptors |
TLRs | Toll-like receptors |
PAMPs | Pathogen-associated molecular patterns |
LUBAC | Linear ubiquitin chain assembly complex |
PKR | Protein kinase R |
MxA | Myxovirus resistance protein 1 |
CQ | Chloroquine |
References
- Alter, H.J.; Seeff, L.B. Recovery, persistence, and sequelae in hepatitis C virus infection: A perspective on long-term outcome. Semin. Liver Dis. 2000, 20, 17–35. [Google Scholar] [CrossRef]
- Fernandez-Caso, B.; Fernandez-Caballero, J.A.; Chueca, N.; Rojo, E.; de Salazar, A.; Garcia Buey, L.; Cardenoso, L.; Garcia, F. Infection with multiple hepatitis C virus genotypes detected using commercial tests should be confirmed using next generation sequencing. Sci. Rep. 2019, 9, 9264. [Google Scholar] [CrossRef]
- Polaris Observatory, H.C.V.C. Global prevalence and genotype distribution of hepatitis C virus infection in 2015: A modelling study. Lancet Gastroenterol. Hepatol. 2017, 2, 161–176. [Google Scholar] [CrossRef]
- Messina, J.P.; Humphreys, I.; Flaxman, A.; Brown, A.; Cooke, G.S.; Pybus, O.G.; Barnes, E. Global distribution and prevalence of hepatitis C virus genotypes. Hepatology 2015, 61, 77–87. [Google Scholar] [CrossRef] [PubMed]
- Nguyen, P.; Vutien, P.; Hoang, J.; Trinh, S.; Le, A.; Yasukawa, L.A.; Weber, S.; Henry, L.; Nguyen, M.H. Barriers to care for chronic hepatitis C in the direct-acting antiviral era: A single-centre experience. BMJ Open Gastroenterol. 2017, 4, e000181. [Google Scholar] [CrossRef]
- Sandmann, L.; Schulte, B.; Manns, M.P.; Maasoumy, B. Treatment of Chronic Hepatitis C: Efficacy, Side Effects and Complications. Visc. Med. 2019, 35, 161–170. [Google Scholar] [CrossRef]
- Puoti, M.; Foster, G.R.; Wang, S.; Mutimer, D.; Gane, E.; Moreno, C.; Chang, T.T.; Lee, S.S.; Marinho, R.; Dufour, J.F.; et al. High SVR12 with 8-week and 12-week glecaprevir/pibrentasvir therapy: An integrated analysis of HCV genotype 1–6 patients without cirrhosis. J. Hepatol. 2018, 69, 293–300. [Google Scholar] [CrossRef] [PubMed]
- Vermehren, J.; Park, J.S.; Jacobson, I.M.; Zeuzem, S. Challenges and perspectives of direct antivirals for the treatment of hepatitis C virus infection. J. Hepatol. 2018, 69, 1178–1187. [Google Scholar] [CrossRef]
- Bastos, J.C.; Padilla, M.A.; Caserta, L.C.; Miotto, N.; Vigani, A.G.; Arns, C.W. Hepatitis C virus: Promising discoveries and new treatments. World J. Gastroenterol. 2016, 22, 6393–6401. [Google Scholar] [CrossRef]
- Liu, S.; Li, L.; Tan, L.; Liang, X. Inhibition of Herpes Simplex Virus-1 Replication by Natural Compound Honokiol. Virol. Sin. 2019, 34, 315–323. [Google Scholar] [CrossRef]
- Sam, S. Importance and effectiveness of herbal medicines. J. Pharmacogn. Phytochem. 2019, 8, 354–357. [Google Scholar]
- Lan, K.H.; Wang, Y.W.; Lee, W.P.; Lan, K.L.; Tseng, S.H.; Hung, L.R.; Yen, S.H.; Lin, H.C.; Lee, S.D. Multiple effects of Honokiol on the life cycle of hepatitis C virus. Liver Int. 2012, 32, 989–997. [Google Scholar] [CrossRef]
- Chaplin, D.D. Overview of the immune response. J. Allergy Clin. Immunol. 2010, 125, S3–S23. [Google Scholar] [CrossRef]
- Lee, J.; Tian, Y.; Chan, S.T.; Kim, J.Y.; Cho, C.; Ou, J.H. TNF-α Induced by Hepatitis C Virus via TLR7 and TLR8 in Hepatocytes Supports Interferon Signaling via an Autocrine Mechanism. PLoS Pathog. 2015, 11, e1004937. [Google Scholar] [CrossRef] [PubMed]
- Takeuchi, O.; Akira, S. Innate immunity to virus infection. Immunol. Rev. 2009, 227, 75–86. [Google Scholar] [CrossRef]
- Horner, S.M.; Gale, M., Jr. Regulation of hepatic innate immunity by hepatitis C virus. Nat. Med. 2013, 19, 879–888. [Google Scholar] [CrossRef]
- Chan, S.T.; Lee, J.; Narula, M.; Ou, J.J. Suppression of Host Innate Immune Response by Hepatitis C Virus via Induction of Autophagic Degradation of TRAF6. J. Virol. 2016, 90, 10928–10935. [Google Scholar] [CrossRef]
- Hayden, M.S.; Ghosh, S. NF-κB in immunobiology. Cell Res. 2011, 21, 223–244. [Google Scholar] [CrossRef]
- Park, J.; Kang, W.; Ryu, S.W.; Kim, W.I.; Chang, D.Y.; Lee, D.H.; Park, D.Y.; Choi, Y.H.; Choi, K.; Shin, E.C.; et al. Hepatitis C virus infection enhances TNFα-induced cell death via suppression of NF-κB. Hepatology 2012, 56, 831–840. [Google Scholar] [CrossRef]
- Chen, Y.; He, L.; Peng, Y.; Shi, X.; Chen, J.; Zhong, J.; Chen, X.; Cheng, G.; Deng, H. The hepatitis C virus protein NS3 suppresses TNF-α-stimulated activation of NF-κB by targeting LUBAC. Sci. Signal. 2015, 8, ra118. [Google Scholar] [CrossRef]
- Dreux, M.; Gastaminza, P.; Wieland, S.F.; Chisari, F.V. The autophagy machinery is required to initiate hepatitis C virus replication. Proc. Natl. Acad. Sci. USA 2009, 106, 14046–14051. [Google Scholar] [CrossRef]
- Taguwa, S.; Kambara, H.; Fujita, N.; Noda, T.; Yoshimori, T.; Koike, K.; Moriishi, K.; Matsuura, Y. Dysfunction of autophagy participates in vacuole formation and cell death in cells replicating hepatitis C virus. J. Virol. 2011, 85, 13185–13194. [Google Scholar] [CrossRef]
- Shrivastava, S.; Bhanja Chowdhury, J.; Steele, R.; Ray, R.; Ray, R.B. Hepatitis C virus upregulates Beclin1 for induction of autophagy and activates mTOR signaling. J. Virol. 2012, 86, 8705–8712. [Google Scholar] [CrossRef] [PubMed]
- Bjorkoy, G.; Lamark, T.; Brech, A.; Outzen, H.; Perander, M.; Overvatn, A.; Stenmark, H.; Johansen, T. p62/SQSTM1 forms protein aggregates degraded by autophagy and has a protective effect on huntingtin-induced cell death. J. Cell Biol. 2005, 171, 603–614. [Google Scholar] [CrossRef]
- Kabeya, Y.; Mizushima, N.; Ueno, T.; Yamamoto, A.; Kirisako, T.; Noda, T.; Kominami, E.; Ohsumi, Y.; Yoshimori, T. LC3, a mammalian homologue of yeast Apg8p, is localized in autophagosome membranes after processing. EMBO J. 2000, 19, 5720–5728. [Google Scholar] [CrossRef]
- Mizui, T.; Yamashina, S.; Tanida, I.; Takei, Y.; Ueno, T.; Sakamoto, N.; Ikejima, K.; Kitamura, T.; Enomoto, N.; Sakai, T.; et al. Inhibition of hepatitis C virus replication by chloroquine targeting virus-associated autophagy. J. Gastroenterol. 2010, 45, 195–203. [Google Scholar] [CrossRef]
- Luo, S.; Wang, Y.; Zhao, M.; Lu, Q. The important roles of type I interferon and interferon-inducible genes in systemic lupus erythematosus. Int. Immunopharmacol. 2016, 40, 542–549. [Google Scholar] [CrossRef]
- Bave, U.; Nordmark, G.; Lovgren, T.; Ronnelid, J.; Cajander, S.; Eloranta, M.L.; Alm, G.V.; Ronnblom, L. Activation of the type I interferon system in primary Sjogren’s syndrome: A possible etiopathogenic mechanism. Arthritis Rheum. 2005, 52, 1185–1195. [Google Scholar] [CrossRef]
- Kim, K.; Lee, Y.S.; Jeong, S.; Kim, D.; Chon, S.; Pak, Y.K.; Kim, S.; Ha, J.; Kang, I.; Choe, W. A Small Molecule, 4-Phenylbutyric Acid, Suppresses HCV Replication via Epigenetically Induced Hepatic Hepcidin. Int. J. Mol. Sci. 2020, 21, 5516. [Google Scholar] [CrossRef]
- Meng, X.; Yang, D.; Yu, R.; Zhu, H. EPSTI1 Is Involved in IL-28A-Mediated Inhibition of HCV Infection. Mediators Inflamm. 2015, 2015, 716315. [Google Scholar] [CrossRef]
- Shi, X.; Jiao, B.; Chen, Y.; Li, S.; Chen, L. MxA is a positive regulator of type I IFN signaling in HCV infection. J. Med. Virol. 2017, 89, 2173–2180. [Google Scholar] [CrossRef]
- Giannelli, G.; Guadagnino, G.; Dentico, P.; Antonelli, G.; Antonaci, S. MxA and PKR expression in chronic hepatitis C. J. Interferon Cytokine Res. 2004, 24, 659–663. [Google Scholar] [CrossRef]
- Carmona, F.; Pereira, A.M.S. Herbal medicines: Old and new concepts, truths and misunderstandings. Rev. Bras. Farmacogn. 2013, 23, 379–385. [Google Scholar] [CrossRef]
- Dar, R.A.; Shahnawaz, M.; Qazi, P.H. General overview of medicinal plants: A review. J. Phytopharmacol. 2017, 6, 349–351. [Google Scholar]
- Abdel-Aziz, S.M.; Aeron, A.; Kahil, T.A. Health benefits and possible risks of herbal medicine. In Microbes in Food and Health; Springer: Berlin/Heidelberg, Germany, 2016; pp. 97–116. [Google Scholar]
- Randall, G.; Panis, M.; Cooper, J.D.; Tellinghuisen, T.L.; Sukhodolets, K.E.; Pfeffer, S.; Landthaler, M.; Landgraf, P.; Kan, S.; Lindenbach, B.D.; et al. Cellular cofactors affecting hepatitis C virus infection and replication. Proc. Natl. Acad. Sci. USA 2007, 104, 12884–12889. [Google Scholar] [CrossRef]
- Tian, H.; He, Z. miR-215 Enhances HCV Replication by Targeting TRIM22 and Inactivating NF-κB Signaling. Yonsei Med. J. 2018, 59, 511–518. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Alter, H.J.; Wang, H.; Jia, S.; Wang, E.; Marincola, F.M.; Shih, J.W.; Wang, R.Y. The modulation of hepatitis C virus 1a replication by PKR is dependent on NF-kB mediated interferon beta response in Huh7.5.1 cells. Virology 2013, 438, 28–36. [Google Scholar] [CrossRef]
- Ahn, K.S.; Sethi, G.; Shishodia, S.; Sung, B.; Arbiser, J.L.; Aggarwal, B.B. Honokiol potentiates apoptosis, suppresses osteoclastogenesis, and inhibits invasion through modulation of nuclear factor-kappaB activation pathway. Mol. Cancer Res. 2006, 4, 621–633. [Google Scholar] [CrossRef]
- Fang, C.Y.; Chen, S.J.; Wu, H.N.; Ping, Y.H.; Lin, C.Y.; Shiuan, D.; Chen, C.L.; Lee, Y.R.; Huang, K.J. Honokiol, a Lignan Biphenol Derived from the Magnolia Tree, Inhibits Dengue Virus Type 2 Infection. Viruses 2015, 7, 4894–4910. [Google Scholar] [CrossRef]
- Chen, X.; Hu, Y.; Shan, L.; Yu, X.; Hao, K.; Wang, G.X. Magnolol and honokiol from Magnolia officinalis enhanced antiviral immune responses against grass carp reovirus in Ctenopharyngodon idella kidney cells. Fish Shellfish. Immunol. 2017, 63, 245–254. [Google Scholar] [CrossRef]
- Wu, H.; Arron, J.R. TRAF6, a molecular bridge spanning adaptive immunity, innate immunity and osteoimmunology. Bioessays 2003, 25, 1096–1105. [Google Scholar] [CrossRef]
- Sun, L.; Deng, L.; Ea, C.K.; Xia, Z.P.; Chen, Z.J. The TRAF6 ubiquitin ligase and TAK1 kinase mediate IKK activation by BCL10 and MALT1 in T lymphocytes. Mol. Cell 2004, 14, 289–301. [Google Scholar] [CrossRef]
- Deng, L.; Wang, C.; Spencer, E.; Yang, L.; Braun, A.; You, J.; Slaughter, C.; Pickart, C.; Chen, Z.J. Activation of the IkappaB kinase complex by TRAF6 requires a dimeric ubiquitin-conjugating enzyme complex and a unique polyubiquitin chain. Cell 2000, 103, 351–361. [Google Scholar] [CrossRef]
- Darnay, B.G.; Ni, J.; Moore, P.A.; Aggarwal, B.B. Activation of NF-κB by RANK requires tumor necrosis factor receptor-associated factor (TRAF) 6 and NF-κB-inducing kinase. Identification of a novel TRAF6 interaction motif. J. Biol. Chem. 1999, 274, 7724–7731. [Google Scholar] [CrossRef] [PubMed]
- Knodler, L.A.; Celli, J. Eating the strangers within: Host control of intracellular bacteria via xenophagy. Cell. Microbiol. 2011, 13, 1319–1327. [Google Scholar] [CrossRef]
- Choi, Y.; Bowman, J.W.; Jung, J.U. Autophagy during viral infection—A double-edged sword. Nat. Rev. Microbiol. 2018, 16, 341–354. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Ou, J.H. Hepatitis C virus and autophagy. Biol. Chem. 2015, 396, 1215–1222. [Google Scholar] [CrossRef]
Gene | Direction | Sequence |
---|---|---|
HCV | Forward | GTCTAGCCATGGCGTTAGTATGAG |
Reverse | CTTGTGGTAGCCTGATAGGGT | |
b-Actin | Forward | CATCGAGCACGGCATCGTCA |
Reverse | TCGAAGTCCAGGGCGACATA | |
TRAF6 | Forward | TTTGCTCTTATGGATTGTCCCC |
Reverse | CATTGATGCAGCACAGTTGTC | |
P65 | Forward | CTGTGCGTGTCTCCATGCA |
Reverse | TCGTCTGTATCTGGCAGGTACTG | |
IFN-α | Forward | TTTCTCCTGCCTGAAGGACAG |
Reverse | GCTCATGATTTCTGCTCTGACA | |
IFN-β | Forward | GAACTTTGACATCCCTGAGGAGATTAAGCAGC |
Reverse | GTTCCTTAGGATTTCCACTCTGACTATGGTCC | |
MxA | Forward | AACAACCTGTGCAGCCAGTA |
Reverse | AAGGGCAACTCCTGAGAGTG | |
PKR | Forward | TCTCTGGCGGTCTTCAGAAT |
Reverse | ACTCCCTGCTTCTGACGGTA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jeong, S.; Lee, Y.-s.; Kim, K.; Yoon, J.-s.; Kim, S.; Ha, J.; Kang, I.; Choe, W. 2-O-Methylhonokiol Suppresses HCV Replication via TRAF6-Mediated NF-kB Activation. Int. J. Mol. Sci. 2021, 22, 6499. https://doi.org/10.3390/ijms22126499
Jeong S, Lee Y-s, Kim K, Yoon J-s, Kim S, Ha J, Kang I, Choe W. 2-O-Methylhonokiol Suppresses HCV Replication via TRAF6-Mediated NF-kB Activation. International Journal of Molecular Sciences. 2021; 22(12):6499. https://doi.org/10.3390/ijms22126499
Chicago/Turabian StyleJeong, Suyun, Young-seok Lee, Kiyoon Kim, Ji-su Yoon, Sungsoo Kim, Joohun Ha, Insug Kang, and Wonchae Choe. 2021. "2-O-Methylhonokiol Suppresses HCV Replication via TRAF6-Mediated NF-kB Activation" International Journal of Molecular Sciences 22, no. 12: 6499. https://doi.org/10.3390/ijms22126499
APA StyleJeong, S., Lee, Y.-s., Kim, K., Yoon, J.-s., Kim, S., Ha, J., Kang, I., & Choe, W. (2021). 2-O-Methylhonokiol Suppresses HCV Replication via TRAF6-Mediated NF-kB Activation. International Journal of Molecular Sciences, 22(12), 6499. https://doi.org/10.3390/ijms22126499