Resveratrol Butyrate Esters Inhibit BPA-Induced Liver Damage in Male Offspring Rats by Modulating Antioxidant Capacity and Gut Microbiota
Abstract
:1. Introduction
2. Results
2.1. Changes in the Plasma Biochemical Markers in Male Offspring Rats
2.2. Gene Expression and Enzymatic Activities of Antioxidant Enzymes in the Liver Tissues of Male Offspring Rats
2.3. Hematoxylin and Eosin (H&E) and Immunohistochemical (IHC) Staining of Liver Tissue Sections of Male Offspring Rats
2.4. Changes in Intestinal Flora Type and Abundance, and SCFA Concentration in the Guts of Male Offspring Rats
3. Discussion
3.1. Effects of RBE on BPA-Induced Physiological and Biochemical Changes in Offspring Rats
3.2. RBE Attenuated BPA-Induced Damage by Enhancing the Expression of Selected Genes and the Activities of Antioxidant Enzymes and Proteins
3.3. RBE Exerted Protective Effects against Liver Damage in Male Offspring Rats via Alterations of Gut Microbiota
4. Materials and Methods
4.1. Synthesis of Resveratrol Butyrate Ester
4.2. Experimental Animals
4.3. Plasma Biochemistry Assay
4.3.1. Plasma TG Concentration
4.3.2. Plasma TC Concentration
4.3.3. Plasma HDL and LDL Concentrations
4.3.4. Plasma AST Activity
4.3.5. Plasma ALT Activity
4.3.6. Plasma MDA Concentration
4.4. Gene Expression Analyses
4.5. Analyses of Antioxidant Enzyme Activity in the Liver
4.5.1. SOD Activity Analyses
4.5.2. GSH Concentration Analyses
4.5.3. CAT Activity Analyses
4.6. Histopathology Staining
4.7. Immunocytochemistry Staining
4.8. Next-Generation Sequencing (NGS) Analysis
4.9. Bioinformatics Analysis and Statistics
4.10. SCFA Measurement in the Feces and Analysis by GC–MS
4.11. Statistical Analyses
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Appendix A
Compounds | Structure | Pharmacokinetics * | ||||
---|---|---|---|---|---|---|
GI Absorption | BBB Permeant | P-gp Substrate | Log Kp (Skin Permeation) | CYP-Family Inhibitor | ||
Resveratrol | High | Yes | No | −5.47 cm/s | Some yes, some no | |
Resveratrol mono-ester (1) | High | Yes | No | −5.24 cm/s | Some yes, some no | |
Resveratrol mono-ester (2) | High | Yes | No | −5.24 cm/s | Some yes, some no | |
Resveratrol diester | High | No | No | −5.00 cm/s | Some yes, some no |
References
- Smith, C.J.; Perfetti, T.A.; Hayes, A.W.; Berry, S.C. Clinical epidemiology studies on potential effects of endocrine disrupting chemicals (EDCs) should exclude subjects with obesity as determined by BMI. Regul. Toxicol. Pharmacol. 2020. [Google Scholar] [CrossRef]
- Pelch, K.; Wignall, J.A.; Goldstone, A.E.; Ross, P.K.; Blain, R.B.; Shapiro, A.J.; Holmgren, S.D.; Hsieh, J.H.; Svoboda, D.; Auerbach, S.S.; et al. A scoping review of the health and toxicological activity of bisphenol A (BPA) structural analogues and functional alternatives. Toxicology 2019, 424, 152235. [Google Scholar] [CrossRef] [PubMed]
- Rodríguez-Carrillo, A.; Mustieles, V.; Pérez-Lobato, R.; Molina-Molina, J.M.; Reina-Pérez, I.; Vela-Soria, F.; Rubio, S.; Olea, N.; Fernández, M.F. Bisphenol A and cognitive function in school-age boys: Is BPA predominantly related to behavior? Neurotoxicology 2019, 74, 162–171. [Google Scholar] [CrossRef] [PubMed]
- Becker, K.; Göen, T.; Seiwert, M.; Conrad, A.; Pick-Fuß, H.; Müller, J.; Wittassek, M.; Schulz, C.; Kolossa-Gehring, M. GerES IV: Phthalate metabolites and bisphenol A in urine of German children. Int. J. Hyg. Environ. Health 2009, 212, 685–692. [Google Scholar] [CrossRef]
- Calafat, A.M.; Ye, X.; Wong, L.-Y.; Reidy, J.A.; Needham, L.L. Exposure of the U.S. population to Bisphenol A and 4-tertiary-octylphenol: 2003–2004. Environ. Health Perspect. 2008, 116, 39–44. [Google Scholar] [CrossRef] [Green Version]
- Casas, L.; Fernández, M.F.; Llop, S.; Guxens, M.; Ballester, F.; Olea, N.; Irurzun, M.B.; Rodríguez, L.S.M.; Riaño, I.; Tardón, A.; et al. Urinary concentrations of phthalates and phenols in a population of Spanish pregnant women and children. Environ. Int. 2011, 37, 858–866. [Google Scholar] [CrossRef]
- Lee, I.; Park, Y.J.; Kim, M.J.; Kim, S.; Choi, S.; Park, J.; Cho, Y.H.; Hong, S.; Yoo, J.; Park, H.; et al. Associations of urinary concentrations of phthalate metabolites, bisphenol A, and parabens with obesity and diabetes mellitus in a Korean adult population: Korean National Environmental Health Survey (KoNEHS) 2015–2017. Environ. Int. 2021, 146, 106227. [Google Scholar] [CrossRef]
- Engin, A.B.; Engin, A. The effect of environmental Bisphenol A exposure on breast cancer associated with obesity. Environ. Toxicol. Pharmacol. 2021, 81. [Google Scholar] [CrossRef] [PubMed]
- Tain, Y.-L.; Chan, J.Y.H.; Lee, C.-T.; Hsu, C.-N. Maternal melatonin therapy attenuates methyl-donor diet-induced programmed hypertension in male adult rat offspring. Nutrients 2018, 10, 1407. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tain, Y.-L.; Lin, Y.-J.; Chan, J.Y.H.; Lee, C.-T.; Hsu, C.-N. Maternal melatonin or agomelatine therapy prevents programmed hypertension in male offspring of mother exposed to continuous light. Biol. Reprod. 2017, 97, 636–643. [Google Scholar] [CrossRef]
- Sergeyev, O.V.; Nikitin, A.I. Developmental origins of health and disease (DOHaD) and paternal origins of health and disease (POHaD). Multigenerational inheritance. Obstet. Gynecol. Reprod. 2019, 13, 326–336. [Google Scholar] [CrossRef]
- Tain, Y.-L.; Lin, Y.-J.; Sheen, J.-M.; Yu, H.-R.; Tiao, M.-M.; Chen, C.-C.; Tsai, C.-C.; Huang, L.-T.; Hsu, C.-N. High Fat Diets Sex-Specifically Affect the Renal Transcriptome and Program Obesity, Kidney Injury, and Hypertension in the Offspring. Nutrients 2017, 9, 357. [Google Scholar] [CrossRef] [Green Version]
- Ahmed, T.; Javed, S.S.; Javed, S.S.; Tariq, A.; Šamec, D.; Tejada, S.; Nabavi, S.M.F.; Braidy, N.; Nabavi, S.M.F. Resveratrol and Alzheimer’s Disease: Mechanistic Insights. Mol. Neurobiol. 2017, 54, 2622–2635. [Google Scholar] [CrossRef] [PubMed]
- Baur, J.A.; Pearson, K.J.; Price, N.L.; Jamieson, H.A.; Lerin, C.; Kalra, A.; Prabhu, V.V.; Allard, J.S.; Lopez-Lluch, G.; Lewis, K.; et al. Resveratrol improves health and survival of mice on a high-calorie diet. Nature 2006, 444, 337–342. [Google Scholar] [CrossRef]
- Ur Rasheed, M.S.; Tripathi, M.K.; Mishra, A.K.; Shukla, S.; Singh, M.P. Resveratrol Protects from Toxin-Induced Parkinsonism: Plethora of Proofs Hitherto Petty Translational Value. Mol. Neurobiol. 2016, 53, 2751–2760. [Google Scholar] [CrossRef] [PubMed]
- Szkudelski, T.; Szkudelska, K. Resveratrol and diabetes: From animal to human studies. Biochim. Biophys. Acta Mol. Basis Dis. 2015, 1852, 1145–1154. [Google Scholar] [CrossRef] [Green Version]
- Rauf, A.; Imran, M.; Sulera, H.A.R.; Ahmad, B.; Peters, D.G.; Mubarak, M.S. A comprehensive review of the health perspectives of resveratrol. Food Funct. 2017, 8, 4284–4305. [Google Scholar] [CrossRef]
- Fernández-Quintela, A.; Milton-Laskibar, I.; González, M.; Portillo, M.P. Antiobesity effects of resveratrol: Which tissues are involved? Ann. N. Y. Acad. Sci. 2017, 1403, 118–131. [Google Scholar] [CrossRef] [PubMed]
- Diamante, G.; Cely, I.; Zamora, Z.; Ding, J.; Blencowe, M.; Lang, J.; Bline, A.; Singh, M.; Lusis, A.J.A.J.; Yang, X. Systems toxicogenomics of prenatal low-dose BPA exposure on liver metabolic pathways, gut microbiota, and metabolic health in mice. Environ. Int. 2021, 146, 106260. [Google Scholar] [CrossRef] [PubMed]
- Meng, Z.; Tian, S.; Yan, J.; Jia, M.; Yan, S.; Li, R.; Zhang, R.; Zhu, W.; Zhou, Z. Effects of perinatal exposure to BPA, BPF and BPAF on liver function in male mouse offspring involving in oxidative damage and metabolic disorder. Environ. Pollut. 2019, 247, 935–943. [Google Scholar] [CrossRef]
- Desai, M.; Ferrini, M.G.; Han, G.; Jellyman, J.K.; Ross, M.G. In vivo maternal and in vitro BPA exposure effects on hypothalamic neurogenesis and appetite regulators. Environ. Res. 2018. [Google Scholar] [CrossRef]
- Shaw, O.E.F.; Yager, J.Y. Preventing childhood and lifelong disability: Maternal dietary supplementation for perinatal brain injury. Pharmacol. Res. 2019, 139, 228–242. [Google Scholar] [CrossRef]
- Netto, C.A.; Sanches, E.F.; Odorcyk, F.; Duran-Carabali, L.E.; Sizonenko, S.V. Pregnancy as a valuable period for preventing hypoxia-ischemia brain damage. Int. J. Dev. Neurosci. 2018, 70, 12–24. [Google Scholar] [CrossRef]
- Milagro, F.I.; Mansego, M.L.; DeMiguel, C.; Martínez, J.A. Dietary factors, epigenetic modifications and obesity outcomes: Progresses and perspectives. Mol. Asp. Med. 2013, 34, 782–812. [Google Scholar] [CrossRef] [PubMed]
- Kubo, K.; Arai, O.; Omura, M.; Watanabe, R.; Ogata, R.; Aou, S. Low dose effects of bisphenol A on sexual differentiation of the brain and behavior in rats. Neurosci. Res. 2003, 45, 345–356. [Google Scholar] [CrossRef]
- Hsu, C.-N.; Lin, Y.-J.; Tain, Y.-L. Maternal Exposure to Bisphenol A Combined with High-Fat Diet-Induced Programmed Hypertension in Adult Male Rat Offspring: Effects of Resveratrol. Int. J. Mol. Sci. 2019, 18, 4382. [Google Scholar] [CrossRef] [Green Version]
- Hsu, C.-N.; Hou, C.-Y.; Chang-Chien, G.-P.; Lin, S.; Yang, H.-W.; Tain, Y.-L. Perinatal Resveratrol Therapy Prevents Hypertension Programmed by Maternal Chronic Kidney Disease in Adult Male Offspring: Implications of the Gut Microbiome and Their Metabolites. Biomedicines 2020, 8, 567. [Google Scholar] [CrossRef] [PubMed]
- Chen, H.-E.; Lin, Y.-J.; Lin, I.-C.; Yu, H.-R.; Sheen, J.-M.; Tsai, C.-C.; Huang, L.-T.; Tain, Y.-L. Resveratrol prevents combined prenatal NG-nitro-L-arginine-methyl ester (L-NAME) treatment plus postnatal high-fat diet induced programmed hypertension in adult rat offspring: Interplay between nutrient-sensing signals, oxidative stress and gut. J. Nutr. Biochem. 2019, 70, 28–37. [Google Scholar] [CrossRef]
- Amri, A.; Chaumeil, J.C.; Sfar, S.; Charrueau, C. Administration of resveratrol: What formulation solutions to bioavailability limitations? J. Control. Release 2012, 158, 182–193. [Google Scholar] [CrossRef]
- Cottart, C.-H.; Nivet-Antoine, V.; Laguillier-Morizot, C.; Beaudeux, J.-L. Resveratrol Bioavailability and Toxicity in Humans. Mol. Nutr. Food Res. 2010, 54, 7–16. [Google Scholar] [CrossRef] [PubMed]
- Cottart, C.H.; Nivet-Antoine, V.; Beaudeux, J.L. Review of recent data on the metabolism, biological effects, and toxicity of resveratrol in humans. Mol. Nutr. Food Res. 2014, 58, 7–21. [Google Scholar] [CrossRef] [PubMed]
- Biagi, M.; Bertelli, A.A.E. Wine, alcohol and pills: What future for the French paradox? Life Sci. 2015, 131, 19–22. [Google Scholar] [CrossRef] [PubMed]
- Walle, T. Bioavailability of resveratrol. Ann. N. Y. Acad. Sci. 2011, 1215, 9–15. [Google Scholar] [CrossRef] [PubMed]
- Wenzel, E.; Somoza, V. Metabolism and Bioavailability of Trans-Resveratrol. Mol. Nutr. Food Res. 2005, 49, 472–481. [Google Scholar] [CrossRef] [PubMed]
- Walle, T.; Hsieh, F.; DeLegge, M.H.; Oatis, J.E., Jr.; Walle, U.K. High absorption but very low bioavailability of oral resveratrol in humans. Drug Metab. Dispos. 2004, 32, 1377–1382. [Google Scholar] [CrossRef] [Green Version]
- Oh, W.Y.; Shahidi, F. Antioxidant activity of resveratrol ester derivatives in food and biological model systems. Food Chem. 2018, 261, 267–273. [Google Scholar] [CrossRef]
- Hu, X.-P.; Yin, F.-W.; Zhou, D.-Y.; Xie, H.-K.; Zhu, B.-W.; Ma, X.-C.; Tian, X.-G.; Wang, C.; Shahidi, F. Stability of resveratrol esters with caprylic acid during simulated in vitro gastrointestinal digestion. Food Chem. 2019, 276, 675–679. [Google Scholar] [CrossRef]
- Neises, B.; Steglich, W. Simple Method for the Esterification of Carboxylic Acids. Angew. Chem. Int. Ed. Engl. 1978, 17, 522–524. [Google Scholar] [CrossRef]
- Tain, Y.-L.; Jheng, L.-C.; Chang, S.K.C.; Chen, Y.-W.; Huang, L.-T.; Liao, J.-X.; Hou, C.-Y. Synthesis and Characterization of Novel Resveratrol Butyrate Esters That Have the Ability to Prevent Fat Accumulation in a Liver Cell Culture Model. Molecules 2020, 25, 4199. [Google Scholar] [CrossRef]
- Tain, Y.-L.; Chang, S.K.C.; Liao, J.-X.; Chen, Y.-W.; Huang, H.-T.; Li, Y.-L.; Hou, C.-Y. Synthesis of Short-Chain-Fatty-Acid Resveratrol Esters and Their Antioxidant Properties. Antioxidants 2021, 10, 420. [Google Scholar] [CrossRef]
- Fattahi, Y.; Heidari, H.R.; Khosroushahi, A.Y. Review of Short-Chain Fatty Acids Effects on the Immune System and Cancer. Food Biosci. 2020, 38, 100793. [Google Scholar] [CrossRef]
- Carey, R.A.; Montag, D. Exploring the relationship between gut microbiota and exercise: Short-chain fatty acids and their role in metabolism. BMJ Open Sport Exerc. Med. 2021, 7. [Google Scholar] [CrossRef]
- Aho, V.T.E.; Houser, M.C.; Pereira, P.A.B.; Chang, J.; Rudi, K.; Paulin, L.; Hertzberg, V.; Auvinen, P.; Tansey, M.G.; Scheperjans, F. Relationships of gut microbiota, short-chain fatty acids, inflammation, and the gut barrier in Parkinson’s disease. Mol. Neurodegener. 2021, 16. [Google Scholar] [CrossRef] [PubMed]
- Iván, J.; Major, E.; Sipos, A.; Kovács, K.; Horváth, D.; Tamás, I.; Bay, P.; Dombrádi, V.; Lontay, B. The Short-Chain Fatty Acid Propionate Inhibits Adipogenic Differentiation of Human Chorion-Derived Mesenchymal Stem Cells Through the Free Fatty Acid Receptor 2. Stem Cells Dev. 2017, 26, 1724–1733. [Google Scholar] [CrossRef] [PubMed]
- Behary, J.; Amorim, N.; Jiang, X.-T.; Raposo, A.; Gong, L.; McGovern, E.; Ibrahim, R.; Chu, F.; Stephens, C.; Jebeili, H.; et al. Gut microbiota impact on the peripheral immune response in non-alcoholic fatty liver disease related hepatocellular carcinoma. Nat. Commun. 2021, 12. [Google Scholar] [CrossRef] [PubMed]
- Yang, F.; Chen, H.; Gao, Y.; An, N.; Li, X.; Pan, X.; Yang, X.; Tian, L.; Sun, J.; Xiong, X.; et al. Gut Microbiota-Derived Short-Chain Fatty Acids and Hypertension: Mechanism and Treatment. Biomed. Pharmacotherap. 2020, 130, 110503. [Google Scholar] [CrossRef]
- Wang, M.; Wichienchot, S.; He, X.; Fu, X.; Huang, Q.; Zhang, B. In vitro colonic fermentation of dietary fibers: Fermentation rate, short-chain fatty acid production and changes in microbiota. Trends Food Sci. Technol. 2019, 88, 1–9. [Google Scholar] [CrossRef]
- Konjevod, M.; Nikolac Perkovic, M.; Sáiz, J.; Svob Strac, D.; Barbas, C.; Rojo, D. Metabolomics analysis of microbiota-gut-brain axis in neurodegenerative and psychiatric diseases. J. Pharm. Biomed. Anal. 2020, 113681. [Google Scholar] [CrossRef]
- Rose, S.; Bennuri, S.C.; Davis, J.E.; Wynne, R.; Slattery, J.C.; Tippett, M.; Delhey, L.; Melnyk, S.; Kahler, S.G.; MacFabe, D.F.; et al. Butyrate enhances mitochondrial function during oxidative stress in cell lines from boys with autism. Transl. Psychiatry 2018. [Google Scholar] [CrossRef]
- Li, Y.; Faden, H.S.; Zhu, L. The Response of the Gut Microbiota to Dietary Changes in the First Two Years of Life. Front. Pharmacol. 2020, 11, 1–7. [Google Scholar] [CrossRef] [Green Version]
- Szentirmai, É.; Millican, N.S.; Massie, A.R.; Kapás, L. Butyrate, a metabolite of intestinal bacteria, enhances sleep. Sci. Rep. 2019, 9, 1–9. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Miyoshi, M.; Sakaki, H.; Usami, M.; Iizuka, N.; Shuno, K.; Aoyama, M.; Usami, Y. Oral administration of tributyrin increases concentration of butyrate in the portal vein and prevents lipopolysaccharide-induced liver injury in rats. Clin. Nutr. 2011, 30, 252–258. [Google Scholar] [CrossRef]
- Daina, A.; Michielin, O.; Zoete, V. SwissADME: A free web tool to evaluate pharmacokinetics, drug-likeness and medicinal chemistry friendliness of small molecules. Sci. Rep. 2017, 7. [Google Scholar] [CrossRef] [Green Version]
- Zou, Y.; Zuo, Q.; Huang, S.; Yu, X.; Jiang, Z.; Zou, S.; Fan, M.; Sun, L. Resveratrol Inhibits Trophoblast Apoptosis through Oxidative Stress in Preeclampsia-Model Rats. Molecules 2014, 19, 20570–20579. [Google Scholar] [CrossRef] [Green Version]
- Franco, J.G.; Lisboa, P.C.; Lima, N.S.; Amaral, T.A.S.; Peixoto-Silva, N.; Resende, A.C.; Oliveira, E.; Passos, M.C.F.; Moura, E.G. Resveratrol attenuates oxidative stress and prevents steatosis and hypertension in obese rats programmed by early weaning. J. Nutr. Biochem. 2013, 24, 960–966. [Google Scholar] [CrossRef] [PubMed]
- vom Saal, F.S.; Nagel, S.C.; Coe, B.L.; Angle, B.M.; Taylor, J.A. The estrogenic endocrine disrupting chemical bisphenol A (BPA) and obesity. Mol. Cell. Endocrinol. 2012, 354, 74–84. [Google Scholar] [CrossRef] [Green Version]
- Carr, S.S.; Hooper, A.J.; Sullivan, D.R.; Burnett, J.R. Non-HDL-cholesterol and apolipoprotein B compared with LDL-cholesterol in atherosclerotic cardiovascular disease risk assessment. Pathology 2019, 51, 148–154. [Google Scholar] [CrossRef] [PubMed]
- Rašković, A.; Ćućuz, V.; Torović, L.; Tomas, A.; Gojković-Bukarica, L.; Ćebović, T.; Milijašević, B.; Stilinović, N.; Cvejić Hogervorst, J.R. Resveratrol supplementation improves metabolic control in rats with induced hyperlipidemia and type 2 diabetes. Saudi Pharm. J. 2019, 27, 1036–1043. [Google Scholar] [CrossRef] [PubMed]
- Schreibelt, G.; van Horssen, J.; van Rossum, S.; Dijkstra, C.D.; Drukarch, B.; de Vries, H.E. Therapeutic potential and biological role of endogenous antioxidant enzymes in multiple sclerosis pathology. Brain Res. Rev. 2007, 56, 322–330. [Google Scholar] [CrossRef]
- Anet, A.; Olakkaran, S.; Kizhakke Purayil, A.; Hunasanahally Puttaswamygowda, G. Bisphenol A induced oxidative stress mediated genotoxicity in Drosophila melanogaster. J. Hazard. Mater. 2019, 370, 42–53. [Google Scholar] [CrossRef] [PubMed]
- Hosseini, H.; Teimouri, M.; Shabani, M.; Koushki, M.; Babaei Khorzoughi, R.; Namvarjah, F.; Izadi, P.; Meshkani, R. Resveratrol alleviates non-alcoholic fatty liver disease through epigenetic modification of the Nrf2 signaling pathway. Int. J. Biochem. Cell Biol. 2020. [Google Scholar] [CrossRef] [PubMed]
- Mendt, M.; Cardier, J.E. Role of SDF-1 (CXCL12) in regulating hematopoietic stem and progenitor cells traffic into the liver during extramedullary hematopoiesis induced by G-CSF, AMD3100 and PHZ. Cytokine 2015, 76, 214–221. [Google Scholar] [CrossRef] [PubMed]
- Piotrowska, M.; Swierczynski, M.; Fichna, J.; Piechota-Polanczyk, A. The Nrf2 in the pathophysiology of the intestine: Molecular mechanisms and therapeutic implications for inflammatory bowel diseases. Pharmacol. Res. 2020, 105243. [Google Scholar] [CrossRef]
- Loboda, A.; Damulewicz, M.; Pyza, E.; Jozkowicz, A.; Dulak, J. Role of Nrf2/HO-1 system in development, oxidative stress response and diseases: An evolutionarily conserved mechanism. Cell. Mol. Life Sci. 2016, 73, 3221–3247. [Google Scholar] [CrossRef] [Green Version]
- Müller, S.G.; Jardim, N.S.; Quines, C.B.; Nogueira, C.W. Diphenyl diselenide regulates Nrf2/Keap-1 signaling pathway and counteracts hepatic oxidative stress induced by bisphenol A in male mice. Environ. Res. 2018, 164, 280–287. [Google Scholar] [CrossRef] [PubMed]
- Feng, D.; Zhang, H.; Jiang, X.; Zou, J.; Li, Q.; Mai, H.; Su, D.; Ling, W.; Feng, X. Bisphenol A exposure induces gut microbiota dysbiosis and consequent activation of gut-liver axis leading to hepatic steatosis in CD-1 mice. Environ. Pollut. 2020, 265, 114880. [Google Scholar] [CrossRef]
- Shukla, P.K.; Meena, A.S.; Dalal, K.; Canelas, C.; Samak, G.; Pierre, J.F.; Rao, R.K. Chronic stress and corticosterone exacerbate alcohol-induced tissue injury in the gut-liver-brain axis. Sci. Rep. 2021, 11. [Google Scholar] [CrossRef]
- Vasco, M.; Paolillo, R.; Schiano, C.; Sommese, L.; Cuomo, O.; Napoli, C. Compromised nutritional status in patients with end-stage liver disease: Role of gut microbiota. Hepatobiliary Pancreat. Dis. Int. 2018, 17, 290–300. [Google Scholar] [CrossRef]
- Wong, V.W.-S.; Wong, G.L.-H.; Chim, A.M.-L.; Chu, W.C.-W.; Yeung, D.K.-W.; Li, K.C.-T.; Chan, H.L.-Y. Treatment of nonalcoholic steatohepatitis with probiotics. A proof-of-concept study. Ann. Hepatol. 2013, 12, 256–262. [Google Scholar] [CrossRef]
- Dhiman, R.K.; Rana, B.; Agrawal, S.; Garg, A.; Chopra, M.; Thumburu, K.K.; Khattri, A.; Malhotra, S.; Duseja, A.; Chawla, Y.K. Probiotic VSL#3 reduces liver disease severity and hospitalization in patients with cirrhosis: A randomized, controlled trial. Gastroenterology 2014. [Google Scholar] [CrossRef]
- Claus, S.P. The Strange Case of Prevotella copri: Dr. Jekyll or Mr. Hyde? Cell Host Microbe 2019, 26, 577–578. [Google Scholar] [CrossRef]
- Wang, Z.; Zhang, X.; Zhu, L.; Yang, X.; He, F.; Wang, T.; Bao, T.; Lu, H.; Wang, H.; Yang, S. Inulin alleviates inflammation of alcoholic liver disease via SCFAs-inducing suppression of M1 and facilitation of M2 macrophages in mice. Int. Immunopharmacol. 2020, 78, 106062. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Cen, S.; Wang, G.; Lee, Y.; Zhao, J.; Zhang, H.; Chen, W. Acetic acid and butyric acid released in large intestine play different roles in the alleviation of constipation. J. Funct. Foods 2020, 69, 103953. [Google Scholar] [CrossRef]
- Joseph, N.; Vasodavan, K.; Saipudin, N.A.; Yusof, B.N.M.; Kumar, S.; Nordin, S.A. Gut microbiota and short-chain fatty acids (SCFAs) profiles of normal and overweight school children in Selangor after probiotics administration. J. Funct. Foods 2019, 57, 103–111. [Google Scholar] [CrossRef]
- Monk, J.M.; Lepp, D.; Wu, W.; Pauls, K.P.; Robinson, L.E.; Power, K.A. Navy and black bean supplementation primes the colonic mucosal microenvironment to improve gut health. J. Nutr. Biochem. 2017, 49, 89–100. [Google Scholar] [CrossRef]
- Tain, Y.-L.; Chan, S.H.H.; Chan, J.Y.H. Biochemical basis for pharmacological intervention as a reprogramming strategy against hypertension and kidney disease of developmental origin. Biochem. Pharmacol. 2018, 153, 82–90. [Google Scholar] [CrossRef] [PubMed]
- Wei, J.; Sun, X.; Chen, Y.; Li, Y.; Song, L.; Zhou, Z.; Xu, B.; Lin, Y.; Xu, S. Perinatal exposure to bisphenol A exacerbates nonalcoholic steatohepatitis-like phenotype in male rat offspring fed on a high-fat diet. J. Endocrinol. 2014, 222, 313–325. [Google Scholar] [CrossRef] [Green Version]
- Hsu, C.-N.; Lin, Y.-J.; Lu, P.-C.; Tain, Y.-L. Maternal resveratrol therapy protects male rat offspring against programmed hypertension induced by TCDD and dexamethasone exposures: Is it relevant to aryl hydrocarbon receptor? Int. J. Mol. Sci. 2018, 19, 2459. [Google Scholar] [CrossRef] [Green Version]
Groups * | CN | R30 | BPA | BPA + R30 |
---|---|---|---|---|
Body weight (g) | 246.6 ± 8.1 a | 293.2 ± 1.3 b | 276.5 ± 5.2 c | 240.1 ± 8.6 a |
ALT (U/L) | 49.5 ± 2.9 a | 58.4 ± 3.4 b | 86.5 ± 6.5 c | 51.5 ± 6.8 ab |
AST (U/L) | 102.5 ± 9.7 a | 140.8 ± 23.5 b | 204.0 ± 21.3 c | 101.7 ± 10.5 a |
TG (μg/mL) | 60.0 ± 13.1 a | 101.0 ± 17.2 b | 160.0 ± 8.6 c | 93.2 ± 13.4 b |
TC (μg/mL) | 1283.6 ± 12.5 a | 1270.1 ± 21.9 a | 1357.6 ± 19.5 b | 1244.2 ± 4.2 a |
HDL (μg/mL) | 193.3 ± 8.3 a | 197.1 ± 2.0 a | 71.7 ± 16.9 b | 238.9 ± 4.6 c |
LDL (μg/mL) | 592.5 ± 78.2 a | 586.0 ± 57.9 a | 726.3 ± 55.8 b | 575.3 ± 57.4 a |
MDA (pg/mg) | 248.5 ± 7.7 a | 117.6 ± 0.9 b | 308.4 ± 20.4 c | 173.1 ± 7.7 d |
Feces, SCFAs (μmol/g Feces) | CN | R30 | BPA | BPA + R30 |
---|---|---|---|---|
Acetic acid | 13.52 ± 1.78 a | 23.09 ± 1.80 b | 28.56 ± 5.58 b | 25.49 ± 1.73 b |
Propanoic acid | 3.56 ± 0.46 a | 5.06 ± 0.56 ab | 5.68 ± 0.59 b | 5.86 ± 0.77 b |
Butanoic acid | 3.96 ± 0.49 a | 3.86 ± 0.42 a | 5.01 ± 0.55 a | 7.13 ± 0.44 b |
Gene | Forward | Reverse |
---|---|---|
Sod1 | CCACTGCAGGACCTCATTTT | CACCTTTGCCCAAGTCATCT |
Sod2 | CCGAGGAGAAGTACCACGAG | GCTTGATAGCCTCCAGCAAC |
Gpx1 | TGAGAAGTGCGAGGTGAATG | AACACCGTCTGGACCTACCA |
Gpx2 | GACACGAGGAAACCGAAGCA | GGCCCTTCACAACGTCT |
Catalase | ACATGGTCTGGGACTTCTGG | CAAGTTTTTGATGCCCTGGT |
GAPDH | ATGGGAAGCTGGTCATCAAC | GTGGTTCACACCCATCACAA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liao, J.-X.; Chen, Y.-W.; Shih, M.-K.; Tain, Y.-L.; Yeh, Y.-T.; Chiu, M.-H.; Chang, S.K.C.; Hou, C.-Y. Resveratrol Butyrate Esters Inhibit BPA-Induced Liver Damage in Male Offspring Rats by Modulating Antioxidant Capacity and Gut Microbiota. Int. J. Mol. Sci. 2021, 22, 5273. https://doi.org/10.3390/ijms22105273
Liao J-X, Chen Y-W, Shih M-K, Tain Y-L, Yeh Y-T, Chiu M-H, Chang SKC, Hou C-Y. Resveratrol Butyrate Esters Inhibit BPA-Induced Liver Damage in Male Offspring Rats by Modulating Antioxidant Capacity and Gut Microbiota. International Journal of Molecular Sciences. 2021; 22(10):5273. https://doi.org/10.3390/ijms22105273
Chicago/Turabian StyleLiao, Jin-Xian, Yu-Wei Chen, Ming-Kuei Shih, You-Lin Tain, Yao-Tsung Yeh, Min-Hsi Chiu, Sam K. C. Chang, and Chih-Yao Hou. 2021. "Resveratrol Butyrate Esters Inhibit BPA-Induced Liver Damage in Male Offspring Rats by Modulating Antioxidant Capacity and Gut Microbiota" International Journal of Molecular Sciences 22, no. 10: 5273. https://doi.org/10.3390/ijms22105273