Pannexin 1 Transgenic Mice: Human Diseases and Sleep-Wake Function Revision
Abstract
:1. Introduction
2. Results
2.1. Generation of Mouse Models
2.1.1. Generation of the Panx1 Knockout Mice Strain
2.1.2. Generation of Arg217His Mice
- C57BL/6J-Panx1em1Koral/Icg—a strain of mice with knockout of the Panx1 gene by deletion of 3 and 4 exons;
- C57BL/6J-Panx1em2Koral/Icg—a line of mice with a target change in the fourth exon of the Panx1 gene: at position # 216, the CGG codon (codes for arginine) was replaced by the CAC codon (codes for histidine).
2.2. Gross Characteristics of Two Generated Strains of Mice
2.3. The Results of Polysomnographical Study
3. Discussion
4. Materials and Methods
4.1. CRISPR/Cas9 Design and Cytoplasmic Microinjection
4.2. Recording of the EEG and Motor Activity in Chronically Instrumented Mice
5. Conclusions
- (1)
- The previously observed changes in the wakefulness cycle and the behavior of Panx1 knockout mice [20] were apparently associated not with the target, but with passenger mutation(s). Hence, our hypothesis on the possible role of the pannexin 1 protein in the regulation of the sleep-wakefulness cycle [21] should be revised.
- (2)
- The absence of noticeable changes in such fundamental characteristics, as an appearance, general behavior, reproductive function, and sleep-wakefulness cycle in mice with an artificial point mutation of the Panx1 gene (Arg217His) doubts the previously reported data on the association of this mutation with multisystem dysfunction in the human organism [30]. Consequently, our hypothesis about the presence of a certain number of such patients [55] is questioned.
- (3)
- Further studies of the role of pannexins at the systemic level are needed.
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
CTT | cleavage of the C-terminal tail |
ESC | embryonic stem cells |
GJ | gap junctions |
HDR | homology-directed repair |
KO2017 | Panx1−/− strain developed by Dvoryantchikova et al. |
KO2020 | mice with Panx1 knockout generated in 2020 |
NHEJ | non-homologous end-joining |
REM | rapid eye movement sleep |
ssODN | short single-stranded DNA template |
ST2020 | mice with Arg217His substitution in Panx1 generated in 2020 |
SWS | slow-wave sleep |
WT2017 | C57Bl/6J mice, control to KO2017 |
WT2000 | wild type group from the study by Huber et al. [38] |
WT2020 | C57BL/6J mice, genetic background for WT2020 and ST2020 |
References
- Panchin, Y.; Kelmanson, I.; Matz, M.; Lukyanov, K.; Usman, N.; Lukyanov, S. A ubiquitous family of putative gap junction mole-cules. Curr. Biol. 2000, 10, R473–R474. [Google Scholar] [CrossRef] [Green Version]
- Bruzzone, R.; Hormuzdi, S.G.; Barbe, M.T.; Herb, A.; Monyer, H. Pannexins, a family of gap junction proteins expressed in brain. Proc. Natl. Acad. Sci. USA 2003, 100, 13644–13649. [Google Scholar] [CrossRef] [Green Version]
- Baranova, A.; Ivanov, D.; Petrash, N.; Pestova, A.; Skoblov, M.; Kelmanson, I.; Shagin, D.; Nazarenko, S.; Geraymovych, E.; Litvin, O.; et al. The mammalian pannexin family is homologous to the invertebrate innexin gap junction proteins. Genomics 2004, 83, 706–716. [Google Scholar] [CrossRef]
- VandenAbeele, F.; Bidaux, G.; Gordienko, D.; Beck, B.; Panchin, Y.V.; Baranova, A.V.; Ivanov, D.V.; Skryma, R.; Prevarskaya, N. Functional implications of calcium permeability of the channel formed by pannexin 1. J. Cell Biol. 2006, 174, 535–546. [Google Scholar] [CrossRef] [Green Version]
- Shestopalov, V.I.; Panchin, Y. Pannexins and gap junction protein diversity. Cell. Mol. Life Sci. 2008, 65, 376–394. [Google Scholar] [CrossRef]
- Panchin, Y.V. Evolution of gap junction proteins—The pannexin alternative. J. Exp. Biol. 2005, 208, 1415–1419. [Google Scholar] [CrossRef] [Green Version]
- Prochnow, N.; Abdulazim, A.; Kurtenbach, S.; Wildförster, V.; Dvoriantchikova, G.; Hanske, J.; Petrasch-Parwez, E.; Shestopalov, V.I.; Dermietzel, R.; Manahan-Vaughan, D.; et al. Pannexin1 stabilizes synaptic plasticity and is needed for learning. PLoS ONE 2012, 7, e51767. [Google Scholar] [CrossRef] [Green Version]
- Penuela, S.; Gehi, R.; Laird, D.W. The biochemistry and function of pannexin channels. Biochim. Biophys. Acta 2013, 1828, 15–22. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Velasquez, S.; Eugenin, E.A. Role of Pannexin-1 hemichannels and purinergic receptors in the pathogenesis of human diseases. Front. Physiol. 2014, 5, 96. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dalkara, T.; Alarcon-Martinez, L. Cerebral microvascular pericytes and neurogliovascular signaling in health and disease. Brain Res. 2015, 1623, 3–17. [Google Scholar] [CrossRef] [PubMed]
- Michalski, K.; Syrjanen, J.L.; Henze, E.; Kumpf, J.; Furukawa, H.; Kawate, T. The Cryo-EM structure of a pannexin 1 reveals unique motifs for ion selection and inhibition. eLife 2020, 9. [Google Scholar] [CrossRef] [Green Version]
- Deng, Z.; He, Z.; Maksaev, G.; Bitter, R.M.; Rau, M.; Fitzpatrick, J.A.J.; Yuan, P. Cryo-EM structures of the ATP release channel pannexin 1. Nat. Struct. Mol. Biol. 2020, 27, 373–381. [Google Scholar] [CrossRef] [PubMed]
- Mou, L.; Ke, M.; Song, M.; Shan, Y.; Xiao, Q.; Liu, Q.; Li, J.; Sun, K.; Pu, L.; Guo, L.; et al. Structural basis for gating mechanism of Pannexin 1 channel. Cell Res. 2020, 30, 452–454. [Google Scholar] [CrossRef] [Green Version]
- Ruan, Z.; Orozco, I.J.; Du, J.; Lü, W. Structures of human pannexin 1 reveal ion pathways and mechanism of gating. Nature 2020, 584, 646–651. [Google Scholar] [CrossRef]
- Ishikawa, M.; Iwamoto, T.; Nakamura, T.; Doyle, A.; Fukumoto, S.; Yamada, Y. Pannexin 3 functions as an ER Ca2+ channel, hemichannel, and gap junction to promote osteoblast differentiation. J. Cell Biol. 2011, 193, 1257–1274. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sahu, G.; Sukumaran, S.; Bera, A.K. Pannexins form gap junctions with electrophysiological and pharmacological properties distinct from connexins. Sci. Rep. 2014, 4, 4955. [Google Scholar] [CrossRef] [Green Version]
- Boassa, D.; Ambrosi, C.; Qiu, F.; Dahl, G.; Gaietta, G.; Sosinsky, G. Pannexin1 channels contain a glycosylation site that targets the hexamer to the plasma membrane. J. Biol. Chem. 2007, 282, 31733–31743. [Google Scholar] [CrossRef] [Green Version]
- Slivko-Koltchik, G.A.; Kuznetsov, V.P.; Panchin, Y.V. Are there gap junctions without connexins or pannexins? BMC Evol. Biol. 2019, 19. [Google Scholar] [CrossRef] [Green Version]
- Dahl, G. ATP release through pannexon channels. Philos. Trans. R. Soc. B Biol. Sci. 2015, 370, 20140191. [Google Scholar] [CrossRef]
- Kovalzon, V.M.; Moiseenko, L.S.; Ambaryan, A.V.; Kurtenbach, S.; Shestopalov, V.I.; Panchin, Y.V. Sleep-wakefulness cycle and behavior in pannexin1 knockout mice. Behav. Brain Res. 2017, 318, 24–27. [Google Scholar] [CrossRef] [PubMed]
- Shestopalov, V.I.; Panchin, Y.; Tarasova, O.S.; Gaynullina, D.; Kovalzon, V.M. Pannexins are potential new players in the regulation of cerebral homeostasis during sleep-wake cycle. Front. Cell. Neurosci. 2017, 11. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gaynullina, D.; Shestopalov, V.I.; Panchin, Y.; Tarasova, O.S. Pannexin 1 facilitates arterial relaxation via an endothelium-derived hyperpolarization mechanism. FEBS Lett. 2015, 589, 1164–1170. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gaynullina, D.; Tarasova, O.S.; Kiryukhina, O.O.; Shestopalov, V.I.; Panchin, Y. Endothelial function is impaired in conduit arteries of pannexin1 knockout mice. Biol. Direct 2014, 9. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kiryukhina, O.O.; Gaynullina, D.K.; Panchin, Y.V.; Shestopalov, V.I.; Tarasova, O.S. Alterations of the Purinergic Regulation in Mesenteric Arteries of Pannexin-1-Knockout Mice. Biochem. Suppl. Ser. A Membr. Cell Biol. 2018, 12. [Google Scholar] [CrossRef]
- MacVicar, B.A.; Thompson, R.J. Non-junction functions of pannexin-1 channels. Trends Neurosci. 2010, 33, 93–102. [Google Scholar] [CrossRef]
- Chiu, Y.-H.; Ravichandran, K.S.; Bayliss, D.A. Intrinsic properties and regulation of Pannexin 1 channel. Channels 2014, 8, 103–109. [Google Scholar] [CrossRef] [Green Version]
- Jeon, Y.H.; Youn, D.H. Spinal gap junction channels in neuropathic pain. Korean J. Pain 2015, 28, 231–235. [Google Scholar] [CrossRef]
- Wang, W.; Qu, R.; Dou, Q.; Wu, F.; Wang, W.; Chen, B.; Mu, J.; Zhang, Z.; Zhao, L.; Zhou, Z.; et al. Homozygous variants in PANX1 cause human oocyte death and female infertility. Eur. J. Hum. Genet. 2021. [Google Scholar] [CrossRef] [PubMed]
- Sang, Q.; Zhang, Z.; Shi, J.; Sun, X.; Li, B.; Yan, Z.; Xue, S.; Ai, A.; Lyu, Q.; Li, W.; et al. A pannexin 1 channelopathy causes human oocyte death. Sci. Transl. Med. 2019, 11. [Google Scholar] [CrossRef]
- Shao, Q.; Lindstrom, K.; Shi, R.; Kelly, J.; Schroeder, A.; Juusola, J.; Levine, K.L.; Esseltine, J.L.; Penuela, S.; Jackson, M.F.; et al. A germline variant in the PANX1 gene has reduced channel function and is associated with multisystem dysfunction. J. Biol. Chem. 2016, 291, 12432–12443. [Google Scholar] [CrossRef] [Green Version]
- Vanden Berghe, T.; Hulpiau, P.; Martens, L.; Vandenbroucke, R.E.; Van Wonterghem, E.; Perry, S.W.; Bruggeman, I.; Divert, T.; Choi, S.M.; Vuylsteke, M.; et al. PasSenger Mutations Confound Interpretation of All Genetically Modified Congenic Mice. Immunity 2015, 43, 200–209. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Marziano, N.K.; Casalotti, S.O.; Portelli, A.E.; Becker, D.L.; Forge, A. Mutations in the gene for connexin 26 (GJB2) that cause hearing loss have a dominant negative effect on connexin 30. Hum. Mol. Genet. 2003, 12, 805–812. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kelsell, D.P.; Dunlop, J.; Stevens, H.P.; Lench, N.J.; Liang, J.N.; Parry, G.; Mueller, R.F.; Leigh, I.M. Connexin 26 mutations in he-reditary non-syndromic sensorineural deafness. Nature 1997, 387, 80–83. [Google Scholar] [CrossRef]
- Dvoriantchikova, G.; Ivanov, D.; Barakat, D.; Grinberg, A.; Wen, R.; Slepak, V.Z.; Shestopalov, V.I. Genetic ablation of Pannexin1 protects retinal neurons from ischemic injury. PLoS ONE 2012, 7, e31991. [Google Scholar] [CrossRef] [PubMed]
- Korablev, A.N.; Serova, I.A.; Serov, O.L. Generation of megabase-scale deletions, inversions and duplications involving the Con-tactin-6 gene in mice by CRISPR/Cas9 technology. BMC Genet. 2017, 18. [Google Scholar] [CrossRef] [PubMed]
- Smirnov, A.; Fishman, V.; Yunusova, A.; Korablev, A.; Serova, I.; Skryabin, B.V.; Rozhdestvensky, T.S.; Battulin, N. DNA barcoding reveals that injected transgenes are predominantly processed by homologous recombination in mouse zygote. Nucleic Acids Res. 2020, 48, 719–735. [Google Scholar] [CrossRef] [Green Version]
- Pattanayak, V.; Lin, S.; Guilinger, J.P.; Ma, E.; Doudna, J.A.; Liu, D.R. High-throughput profiling of off-target DNA cleavage reveals RNA-programmed Cas9 nuclease specificity. Nat. Biotechnol. 2013, 31, 839–843. [Google Scholar] [CrossRef]
- Huber, R.; Deboer, T.; Tobler, I. Effects of sleep deprivation on sleep and sleep EEG in three mouse strains: Empirical data and simulations. Brain Res. 2000, 857, 8–19. [Google Scholar] [CrossRef]
- Qu, Y.; Misaghi, S.; Newton, K.; Gilmour, L.L.; Louie, S.; Cupp, J.E.; Dubyak, G.R.; Hackos, D.; Dixit, V.M. Pannexin-1 Is Required for ATP Release during Apoptosis but Not for Inflammasome Activation. J. Immunol. 2011, 186, 6553–6561. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Santiago, M.F.; Veliskova, J.; Patel, N.K.; Lutz, S.E.; Caille, D.; Charollais, A.; Meda, P.; Scemes, E. Targeting pannexin1 improves seizure outcome. PLoS ONE 2011, 6, e25178. [Google Scholar] [CrossRef] [Green Version]
- Vandenbeuch, A.; Anderson, C.B.; Kinnamon, S.C. Mice lacking pannexin 1 release ATP and respond normally to all taste qualities. Chem. Senses 2015, 40, 461–467. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Anselmi, F.; Hernandez, V.H.; Crispino, G.; Seydel, A.; Ortolanoa, S.; Roper, S.D.; Kessaris, N.; Richardson, W.; Rickheit, G.; Filippov, M.A.; et al. ATP release through connexin hemichannels and gap junction transfer of second messengers propagate Ca2+ signals across the inner ear. Proc. Natl. Acad. Sci. USA 2008, 105, 18770–18775. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Purohit, R.; Bera, A.K. Mutational effects of Pannexin 1 R217H depend on the carboxyl-terminus. Biochem. Biophys. Res. Commun. 2021, 548, 143–147. [Google Scholar] [CrossRef]
- Bargiotas, P.; Krenz, A.; Hormuzdi, S.G.; Ridder, D.A.; Herb, A.; Barakat, W.; Penuela, S.; von Engelhardt, J.; Monyer, H.; Schwaninger, M. Pannexins in ischemia-induced neurodegeneration. Proc. Natl. Acad. Sci. USA 2011, 108, 20772–20777. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sandilos, J.K.; Chiu, Y.H.; Chekeni, F.B.; Armstrong, A.J.; Walk, S.F.; Ravichandran, K.S.; Bayliss, D.A. Pannexin 1, an ATP release channel, is activated by caspase cleavage of its pore-associated C-terminal autoinhibitory region. J. Biol. Chem. 2012, 287, 11303–11311. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chekeni, F.B.; Elliott, M.R.; Sandilos, J.K.; Walk, S.F.; Kinchen, J.M.; Lazarowski, E.R.; Armstrong, A.J.; Penuela, S.; Laird, D.W.; Salvesen, G.S.; et al. Pannexin 1 channels mediate “find-me” signal release and membrane permeability during apoptosis. Nature 2010, 467, 863–867. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Simpson, E.M.; Linder, C.C.; Sargent, E.E.; Davisson, M.T.; Mobraaten, L.E.; Sharp, J.J. Genetic variation among 129 substrains and its importance for targeted mutagenesis in mice. Nat. Genet. 1997, 16, 19–27. [Google Scholar] [CrossRef] [PubMed]
- Makarenkova, H.P.; Shah, S.B.; Shestopalov, V.I. The two faces of pannexins: New roles in inflammation and repair. J. Inflamm. Res. 2018, 11, 273–288. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Toth, L.A.; Opp, M.R. Cytokine- and microbially induced sleep responses of interleukin-10 deficient mice. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2001, 280. [Google Scholar] [CrossRef]
- Olivadoti, M.D.; Opp, M.R. Effects of i.c.v. administration of interleukin-1 on sleep and body temperature of interleukin-6-deficient mice. Neuroscience 2008, 153, 338–348. [Google Scholar] [CrossRef] [Green Version]
- Zielinski, M.R.; Krueger, J.M. Sleep and innate immunity. Front. Biosci. Sch. Ed. 2011, 3, 632–642. [Google Scholar] [CrossRef] [Green Version]
- Zielinski, M.R.; Gerashchenko, D.; Karpova, S.A.; Konanki, V.; McCarley, R.W.; Sutterwala, F.S.; Strecker, R.E.; Basheer, R. The NLRP3 inflammasome modulates sleep and NREM sleep delta power induced by spontaneous wakefulness, sleep deprivation and lipopolysaccharide. Brain Behav. Immun. 2017, 62, 137–150. [Google Scholar] [CrossRef] [Green Version]
- Korablev, A.; Lukyanchikova, V.; Serova, I.; Battulin, N. On-target CRISPR/CAS9 activity can cause undesigned large deletion in mouse zygotes. Int. J. Mol. Sci. 2020, 21, 3604. [Google Scholar] [CrossRef] [PubMed]
- Manolov, A.I.; Koval’zon, V.M.; Ukraintseva, Y.V.; Moiseenko, L.S.; Dorokhov, V.B. Dependence of the Accuracy of Automatic Identification of Sleep and Waking States in Mice on the Spectral Characteristics of the Electroencephalogram. Neurosci. Behav. Physiol. 2017, 47, 97–101. [Google Scholar] [CrossRef]
- Kovalzon, V.M.; Latyshkova, A.A.; Komarova, A.D.; Panchin, Y.V. The Sleep–Waking Cycle and Experimental Models of Mutations in the Panx1 Gene. Neurosci. Behav. Physiol. 2019, 49, 1195–1198. [Google Scholar] [CrossRef]
Parameters | WT2020 | KO2020 | ST2020 |
---|---|---|---|
Number of pups per litter | 6.3 ± 2.1 | 5.8 ± 2.5 | 5.8 ± 2.2 |
Percentage of males | 54 ± 13 | 52 ± 23 | 42 ± 30 |
Male body weight at 8-week age, g | 26.8 ± 1.9 | 25.1 ± 2.4 * | 22.0 ± 2.5 *,# |
Female body weight at 8-week age, g | 19.8 ± 1.1 | 18.2 ± 1.5 | 17.5 ± 0.6 * |
Male body weight at 20-week age, g | 30.1 ± 2.7 | 27.5 ± 2.7 * | 25.7 ± 2.0 *,# |
Name | Sequence |
---|---|
gRNA-1 | GGGACGCTGGCTGATCATGT (TGG) |
gRNA-2 | GCGAGTTCGTCCCTGAAATG (AGG) |
gRNA-3 | GAAATACATTAGCTGCCGGC (TGG) |
ssODN-1 | GACATGGCCTGGATCATGGACTTGCTACAGCTCAGCTACACAAGATGAAGAGAGCCAACAAGCTTCAGGGACGAACTCGCATCCCCACGTCACTGACAGACACCTGCCTGCTGCCTGTTGATT |
ssODN-2 | GAGGCTGAAGTAATAGCTCAAGTAGATACATGCCAACAGTATAACCACAAATGTCACCAGGTGGCAGCTAATGTATTTCATGATTAAATGACTAGAGTTCTTTTTTGTCTTCAAGTACTGCTC |
FWD1 | TAGCCCACTGTGAAGGGACT |
REV1 | CGGTTTCTAGCACCCCACAT |
FWD2 | ACACCCTACCTACCCCCTTC |
REV2 | CTGACATCCCTCTGGTCTGC |
FWD3 | ATGCCCAGGTTTGTCAGGAG |
REV3 | CAGTGTTGACAATGCCCGTG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Battulin, N.; Kovalzon, V.M.; Korablev, A.; Serova, I.; Kiryukhina, O.O.; Pechkova, M.G.; Bogotskoy, K.A.; Tarasova, O.S.; Panchin, Y. Pannexin 1 Transgenic Mice: Human Diseases and Sleep-Wake Function Revision. Int. J. Mol. Sci. 2021, 22, 5269. https://doi.org/10.3390/ijms22105269
Battulin N, Kovalzon VM, Korablev A, Serova I, Kiryukhina OO, Pechkova MG, Bogotskoy KA, Tarasova OS, Panchin Y. Pannexin 1 Transgenic Mice: Human Diseases and Sleep-Wake Function Revision. International Journal of Molecular Sciences. 2021; 22(10):5269. https://doi.org/10.3390/ijms22105269
Chicago/Turabian StyleBattulin, Nariman, Vladimir M. Kovalzon, Alexey Korablev, Irina Serova, Oxana O. Kiryukhina, Marta G. Pechkova, Kirill A. Bogotskoy, Olga S. Tarasova, and Yuri Panchin. 2021. "Pannexin 1 Transgenic Mice: Human Diseases and Sleep-Wake Function Revision" International Journal of Molecular Sciences 22, no. 10: 5269. https://doi.org/10.3390/ijms22105269