Next Article in Journal
Extracellular Vesicles Function as Bioactive Molecular Transmitters in the Mammalian Oviduct: An Inspiration for Optimizing in Vitro Culture Systems and Improving Delivery of Exogenous Nucleic Acids during Preimplantation Embryonic Development
Previous Article in Journal
Therapeutic Potential of Volatile Terpenes and Terpenoids from Forests for Inflammatory Diseases
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
IJMS
Volume 21
Issue 6
10.3390/ijms21062188
ijms-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genome-Wide Identification and Analysis on YUCCA Gene Family in Isatis indigotica Fort. and IiYUCCA6-1 Functional Exploration

by
Miaomiao Qin
,
Jing Wang
,
Tianyi Zhang
,
Xiangyang Hu
,
Rui Liu
,
Tian’e Gao
,
Shuaijing Zhao
,
Yilin Yuan
,
Jinyu Zheng
,
Zirong Wang
,
Xiying Wei
and
Tao Li
*
National Engineering Laboratory for Resources Development of Endangered Crude Drugs in Northwest China, The Key Laboratory of Medicinal Resources and Natural Pharmaceutical Chemistry, The Ministry of Education, College of Life Sciences, Shaanxi Normal University, Xi’an 710119, China
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2020, 21(6), 2188; https://doi.org/10.3390/ijms21062188
Submission received: 14 February 2020 / Revised: 15 March 2020 / Accepted: 19 March 2020 / Published: 22 March 2020
(This article belongs to the Section Molecular Plant Sciences)
Browse Figures
Review Reports Versions Notes

Abstract

:
Auxin is one of the most critical hormones in plants. YUCCA (Tryptophan aminotransferase of Arabidopsis (TAA)/YUCCA) enzymes catalyze the key rate-limiting step of the tryptophan-dependent auxin biosynthesis pathway, from IPA (Indole-3-pyruvateacid) to IAA (Indole-3-acetic acid). Here, 13 YUCCA family genes were identified from Isatis indigotica, which were divided into four categories, distributing randomly on chromosomes (2n = 14). The typical and conservative motifs, including the flavin adenine dinucleotide (FAD)-binding motif and flavin-containing monooxygenases (FMO)-identifying sequence, existed in the gene structures. IiYUCCA genes were expressed differently in different organs (roots, stems, leaves, buds, flowers, and siliques) and developmental periods (7, 21, 60, and 150 days after germination). Taking IiYUCCA6-1 as an example, the YUCCA genes functions were discussed. The results showed that IiYUCCA6-1 was sensitive to PEG (polyethylene glycol), cold, wounding, and NaCl treatments. The over-expressed tobacco plants exhibited high auxin performances, and some early auxin response genes (NbIAA8, NbIAA16, NbGH3.1, and NbGH3.6) were upregulated with increased IAA content. In the dark, the contents of total chlorophyll and hydrogen peroxide in the transgenic lines were significantly lower than in the control group, with NbSAG12 downregulated and some delayed leaf senescence characteristics, which delayed the senescence process to a certain extent. The findings provide comprehensive insight into the phylogenetic relationships, chromosomal distributions, and expression patterns and functions of the YUCCA gene family in I. indigotica.

1. Introduction

IAA (Indole-3-acetic acid) is the main type of natural auxin in plants, which plays important roles in a series of growth and developmental processes, such as embryonic polarization, vascular bundle differentiation, apical dominance, shoot architecture, root formation, phototropic response, gravity response, and senescence [1,2,3,4,5,6]. A growing body of evidence indicates that auxin participates in a variety of stress responses in plant, including high salt, low temperature, wounding, drought, and the like. Indeed, auxin can induce the rapid and transient high expression of auxin response genes ARF, Aux/IAA, GH3, SAUR, and LBD, which are involved in plant response to stress [7,8]. For example, OsIAA24 and OsIAA20 were up-regulated by high salt stress in Oryza sativa [9], and the expression level of GH3.13 increased under drought treatment, which resulted in IAA content decreasing, with enhanced resistance to drought [10]. Furthermore, the sorting and intracellular cycling of PIN2 were affected at a low temperature in Arabidopsis thaliana, which inhibited auxin transport in roots [11].
IAA is generally synthesized using tryptophan as a substrate through the IPA (indole-3-pyruvate synthesis pathway), IAM (indole-3-acetamide), IAOx (indole-3-acetaldoxime), and tryptamine pathways, of which the IPA synthesis pathway is the most important one [12]. The IPA pathway is divided into two steps; tryptophan is transformed into IPA by tryptophan aminotransferase (TAA), and then flavin monooxygenase (YUCCA), as the rate-limiting enzyme, catalyzes IPA to IAA [13,14,15]. Therefore, YUCCA genes play an important role in IAA biosynthesis process.
There were several research works reported on IAA accumulation and the regulation process. So far, 11 YUCCA genes were identified from A. thaliana, providing some evidence for the significant roles of AtYUCCA1, AtYUCCA2, AtYUCCA4, AtYUCCA5, AtYUCCA6, and AtYUCCA7 in the biosynthesis of auxin [13,16,17,18,19]. Nevertheless, the function of YUCCA family genes is redundant. Over-expression of any one of YUCCA1, YUCCA2, YUCCA5, and YUCCA6 in A. thaliana could result in a high-auxin phenotype; on the contrary, interference of single genes did not produce an auxin-deficient phenotype [13]. The YUCCA6 activation mutant, yuc6-1D, presented an elevated IAA level and typical high-auxin phenotype with epinastic cotyledons, long hypocotyls, long narrow leaves, elongated petioles, and strong apical dominance [20]. It was not hard to find that the loss of function of multiple YUCCA genes caused developmental defects, while the over-expression of any one of YUCCA genes could promote auxin biosynthesis. When YUCCA6 was over-expressed in A. thaliana, dark-induced senescence was dramatically delayed. Consequently, it was confirmed that auxin delayed senescence by directly or indirectly regulating the expression of senescence-associated genes (SAG12, NAC1, and NAC6) [16]. Over-expression of AtYUCCA6 could increase the tolerance to 5 μM methyl viologen-mediated oxidative stress in Ipomoea batatas (L.) Lam [21], and the over-expressed auxin synthesis gene YUCCA1 apparently delayed the senescence of strawberry fruit (Fragaria × ananassa Duch.) [22]. As a result, YUCCA family genes played profound roles in resisting stress in plants, and more research on the YUCCA gene family in more species was performed. Twelve YUCCA genes from Populus trichocarpa [23], 22 from Glycine max L. [24], 10 from Citrullus lanatus [25], 14 from O. sativa [26], 14 from Zea mays [27], three from Triticum aestivum [28], 10 from Cucumis sativus [29], 18 from Brassica rapa [30], and eight from Fragaria vesca [31] were identified or isolated, and their differential expression patterns were also characterized. The previous studies showed that YUCCA gene members shared highly conserved motifs, namely, the FAD-binding motif (GxGPxGLA), the nicotinamide adenine dinucleotide phosphate (NADPH)-binding motif (GxGxxGME), GC motif (ERxxxxASL), and ATG-containing motif (DxxxxATG) [24], which might be the pivotal sites for the biological functions of YUCCA genes. Furthermore, some evidence suggested that the FAD- and NADPH-binding motif GxGxxG is central to YUCCA activity [32].
Isatis indigotica Fort. is a biennial herb, just like A. thaliana, belonging to Cruciferae. Its roots and leaves have great medicinal and economic value. Clinically, its secondary metabolites have significant effects on influenza, epidemic encephalitis, hepatitis, mumps, and other diseases [33]. However, the auxin functions in regulating growth and development processes for I. indigotica are not as clear as for A. thaliana and other plants [12,16,17,20,24,25,26,27,28]. Due to the species differences in YUCCA genes, the phylogenetic, gene expression, and functional characterization of IiYUCCA genes could be similar or different, which needs to be further explored. Furthermore, it is extremely necessary to understand the molecular mechanism of auxin synthesis and regulation in I. indigotica. Based on the previous references of YUCCA genes in other species and the whole I. indigotica genome data (our unpublished data, another I. indigotica genome [34]), we collected the basic information of YUCCA gene family members and explored their expression patterns in different organs, different developmental periods, and different stress treatments. Moreover, the functions of YUCCA genes were discussed, taking IiYUCCA6-1 as an example. The results provide comprehensive analyses on IiYUCCA gene family, with a firm foundation for further researches on their functions, adding to the data on YUCCA genes of Cruciferae.

2. Results

2.1. IiYUCCA Gene Family Analysis in I. indigotica

13 YUCCA genes in total were identified in I. indigotica (Table 1) and the YUCCA genes were named from IiYUCCA1 to IiYUCCA11 (IiYUCCA1, IiYUCCA2, IiYUCCA3, IiYUCCA4, IiYUCCA5-1, IiYUCCA5-2, IiYUCCA6-1, IiYUCCA6-2, IiYUCCA7, IiYUCCA8, IiYUCCA9, IiYUCCA10, IiYUCCA11), referring to the homologous YUCCA sequences in A. thaliana. Among them, IiYUCCA6-2 was identified as a pseudogene, because there was a 2-bp deletion at the 450-bp position, which caused its translation to be terminated prematurely at the position of the 456-bp site when compared to IiYUCCA6-1. The CDS (Coding sequence) lengths of IiYUCCAs ranged from 1044 bp (IiYUCCA10) to 1335 bp (IiYUCCA6-1). Most IiYUCCA genes included three exons, while three genes (IiYUCCA2, IiYUCCA3, and IiYUCCA6-1) had four exons, and two genes (IiYUCCA1 and IiYUCCA4) had five exons. The theoretical isoelectric point (pI) and molecular weight (Mw) ranged from 8.36 to 9.58 (average pI = 9.03) and from 38.64 kDa to 49.77 kDa (average Mw = 46.28 kDa), respectively. The detailed information of each IiYUCCA gene is listed in Table 1, including the gene identifier (ID) in the genome database, the length of the amino-acid sequence, chromosomal location, and some basic physical and chemical properties.
Based on the genome data, the genetic mapping of IiYUCCA genes on the chromosomes (2n = 14) was investigated (Figure 1). Except for IiYUCCA6-1 and IiYUCCA6-2 (which were not mapped to any chromosomes), the other 11 IiYUCCA genes were randomly distributed on five chromosomes: Chr01, Chr02, Chr03, Chr06, and Chr07. The distributions of IiYUCCA genes on the different chromosomes were not uniform. Chr06 had four IiYUCCA genes, the highest number, while Chr02 and Chr07 both had only one. Furthermore, there were three IiYUCCA genes on Chr03. It should be noted that IiYUCCA5-1 and IiYUCCA5-2 (located on Chr01) and IiYUCCA3 and IiYUCCA9 (located on Chr06) were very close to each other, and whether they might have similar biologic functions or not still needs to be confirmed.

2.2. Classification and Structural Analysis of IiYUCCA Genes

To clarify the structural diversities of IiYUCCA genes, an exon–intron composition map was drawn as shown in in Figure 2A. As expected, the gene family members in one branch exhibited similar intron–exon compositions, numbers, and lengths. For example, both IiYUCCA10 and IiYUCCA11 had three exons and similar coding sequence lengths, which indicated that they might have a close evolutionary relationship. Otherwise, 12 IiYUCCA genes (except for IiYUCCA6-2) were subjected to analysis with the MEME program to identify the conserved protein motifs. A total of 11 distinct motifs were found; among them, six motifs were identified. These were the FAD-binding motif, GC motif, ATG-containing motif 1, ATG-containing motif 2, FMO-identifying sequence, and NADPH-binding motif. It was evident that the closely related proteins shared the same motif profiles, which suggested that the IiYUCCA proteins within one branch might share conservative functions. Moreover, it was not difficult to find that the conserved motifs were nearly the same, both in terms of number and type. However, there were some differences between IiYUCCA10 and IiYUCCA11. IiYUCCA10 lacked ATG-containing motif 2 and motif 8 (Figure 2B). To some extent, the specific motifs might contribute to the functional divergences.

2.3. Phylogenetic Analysis of YUCCA Gene Family

In order to uncover the evolutionary relationships of YUCCA proteins among different species, we constructed the phylogenetic tree implemented in MEGA7.0, including A. thaliana, Brassica rapa, Brassica oleracea, Raphanus sativus, O. sativa, and I. indigotica (Figure 3). It was demonstrated that 96 YUCCA proteins from six species were grouped into four categories. Among them, Group I included five members, namely, YUCCA3, YUCCA5, YUCCA7, YUCCA8, and YUCCA9. The other groups contained two different members, such as YUCCA1 and YUCCA4 (Group II), YUCCA2 and YUCCA6 (Group III), and YUCCA10 and YUCCA 11 (Group IV). The phylogenetic analysis results apparently confirmed that YUCCAs of Cruciferae (dicotyledons) tended to be clustered into one branch, while O. sativa was separated from Cruciferae as monocotyledons. Therefore, it can be seen that the YUCCA proteins of I. indigotica were highly conserved evolutionarily. When the selection pressure was considered, the Ka/Ks ratio of the YUCCA gene family was 0.1126, far less than 1 (neutral selection) [33], which indicated a strong purifying selection on the YUCCA gene family for I. indigotica.

2.4. Expression Pattern Analysis on IiYUCCA Genes

The expression patterns of IiYUCCAs in different organs and different developmental periods (except IiYUCCA5-2 and IiYUCCA6-2) were carried out. Here, YUCCA5-2 and YUCCA6-2 were more likely to be regarded as pseudogenes; thus, we did not determine their expression levels, but this does not mean that they have no biological function. As shown in Figure 4, all IiYUCCA gene expressions varied significantly in nine organs. It was notable that IiYUCCA7 was specifically expressed in buds, which could play a key role in the bud development process. Interestingly, IiYUCCA6-1 was expressed at relatively high levels in most organs, indicating its importance in I. indigotica. IiYUCCA1, IiYUCCA9, and IiYUCCA11 were found to be predominantly expressed in the main roots, implying their specific functions in the root developmental process. IiYUCCA4 and IiYUCCA5-1 were mainly expressed in young leaves. IiYUCCA2 and IiYUCCA8 were expressed more highly in flowers than in other organs. Moreover, IiYUCCA3 and IiYUCCA10 were preferentially expressed in green siliques, reveling that they might participate in the reproductive development process. In summary, IiYUCCA members had various expression patterns in different organs, and they could play different roles in the accumulation and regulations of auxin in different organs of I. indigotica.
In addition to differences for different organs, the expression patterns in different developmental periods were also observed, and the four developmental periods (seven, 21, 60, and 150 days after germination) were detected. As shown in Figure 5, the expression levels of IiYUCCA2, IiYUCCA4, and IiYUCCA10 increased gradually, whereas the levels of IiYUCCA3, IiYUCCA5-1, IiYUCCA8, and IiYUCCA9 decreased with the developmental process. Moreover, IiYUCCA11 showed a trend of decreasing firstly and then rising. IiYUCCA1 expressions were detected only 21 days and 60 days after germination, whereas IiYUCCA6-1 was expressed highly compared to other developmental periods. Therefore, these YUCCA genes had distinct spatiotemporal expression patterns in I. indigotica, laying a foundation for further function research on IiYUCCA genes.
Plants usually implement various signal regulatory networks to respond and adapt to different natural environments. Thus, it was important to understand what kinds of factors controlled the specific expressions of YUCCA genes and how they were regulated by different environmental signals. Due to the higher expression level in different organs, IiYUCCA6-1 was taken as an example to examine expression patterns in response to various stress treatments. As shown in Figure 6, IiYUCCA6-1 showed a strong response toward PEG treatment, and the expression changes firstly showed a sharp increase and then a rapid decrease. After 1 h of PEG treatment, the transcript level of IiYUCCA6-1 was 1.13-fold higher than the control group. Additionally, the expression levels stimulated by NaCl showed no obvious changes, with a slight increase (0.21-fold) after 6 h of treatment. Furthermore, IiYUCCA6-1 showed a completely opposite expression pattern when exposed to the wounding stimulation, and the expression level was 41% of the control group level after 1 h of treatment, before rising to 142%, demonstrating its sensibility to wounding stress. In addition, IiYUCCA6-1 exhibited time-dependent and inconspicuous responses to the low-temperature treatment, but only demonstrated a 0.58-fold change after 12 h of treatment. In summary, IiYUCCA6-1 exhibited the most obvious response to PEG treatment, but showed tiny variations when induced by low temperature. Therefore, the functions of the IiYUCCA6-1 gene were correlated with the kinds of stress resistance to some extent.

2.5. Heterologous Expression of IiYUCCA6-1 in Nicotiana benthamiana

In this section, we further discuss YUCCA gene functions, taking IiYUCCA6-1 as an example. IiYUCCA6-1 was identified and cloned from I. indigotica (GenBank Accession Number: KY318462), encoding a protein highly homologous to AtYUCCA6 (91%). The genome DNA of IiYUCCA6-1 was 2835 bp, containing four exons and three introns. Its ORF (Open Reading Frame) length was 1335 bp, encoding 444 amino-acid residues. Detailed sequences and protein structure predictions are shown in the Supplementary Materials (Figures S1–S3). To determine the potential functions of IiYUCCA6-1, the gene was transformed into N. benthamiana. After screening with Hygromycin B, 10 transgenic lines (OE1–OE10) were tested at DNA and RNA levels. The detection results at the transcriptional levels demonstrated that IiYUCCA6-1 was significantly expressed in 10 transgenic lines, and the expression levels of OE3 and OE9 were 200 times higher than in the control groups (Figure 7A). Free IAA content was also investigated in all over-expressed lines, and the contents increased significantly, except for OE1 and OE4 (Figure 7B), ranging from 5 to 6.5 μg/g. These results were not completely consistent with the expression changes of IiYUCCA6-1, indicating that IiYUCCA6-1 may not be the only gene involved in the accumulation process of IAA.
Moreover, as one-month-old control groups, OE3 and OE9 plants were selected to observe the phenotypic differences. Obviously, the heights of OE3 and OE9 increased, and the whole plants were thin and weak with prominent apical dominance (Figure 7C), suggesting the typical hyperauxin phenotype. Meanwhile, the expression levels of four early auxin response genes, NbIAA8, NbIAA16, NbGH3.1, and NbGH3.6, were also observed, whose expressions were significantly higher than in the control groups (Figure 7D). These results illustrated that the early auxin response genes were upregulated, responding to the increased IAA content, which was upregulated by the over-expressed IiYUCCA6-1 gene.

2.6. IiYUCCA6-1 Could Delay the Senescence Process

The fresh leaves of control and transgenic lines (OE3 and OE9) were isolated and treated with dark stress. The contents of chlorophyll and hydrogen peroxide and the expression of NbSAG12 were detected. In Figure 8A, it is shown that the percentage of total chlorophyll content decreased significantly in the transgenic lines and reduced the leaf yellowing process after seven days of darkness treatment, which suggests that the senescence process of transgenic plants was apparently delayed. Moreover, the content changes of hydrogen peroxide were further detected. As displayed in Figure 8B, the increment in hydrogen peroxide content in transgenic lines was significantly lower than in the control group, which might have also contributed to the delay in the senescence process of transgenic plants. In addition, the expression level of NbSAG12, a senescence-related gene, was significantly lower than in the control group under darkness treatment (Figure 8C). These findings indicate that the senescence process was obviously reduced when IiYUCCA6-1 was over-expressed in transgenic tobacco.

3. Discussion

3.1. YUCCA Numbers, Structures, and Phylogenetic Analysis in I. indigotica

As far as we know, most YUCCA genes in plants are gene families with multiple members, except for Petunia, which only has one YUCCA gene [35]. The YUCCA gene family was systematically described in A. thaliana, rice, maize, tomato, and so on [26,36,37,38,39,40]. Our study established some descriptions for the comprehensive features of the YUCCA gene family in I. indigotica for the first time. There are 13 YUCCA genes in I. indigotica, which are distributed on five chromosomes, but IiYUCCA6-1 and IiYUCCA6-2 were not located. Although IiYUCCA6-1 and IiYUCCA6-2 are very similar, the latter is a pseudogene. Therefore, it was speculated that IiYUCCA6-1 might have vital functions because of the functional reduction of IiYUCCA6-2. Moreover, due to the similarities in both gene structures and conservative motifs, the IiYUCCA genes were deservedly clustered in one branch, showing the differences between I. indigotica and other plants (A. thaliana, B. rapa, B. oleracea, R. sativus, and O. sativa) based on the phylogenetic tree analysis. Furthermore, the IiYUCCA genes were divided into four subfamilies according to the conservative motifs. Meanwhile, the results showed that the YUCCA family members of several dicotyledons of Cruciferae were closely related and highly conserved in evolution, far from monocotyledon rice, consistent with the clustering analysis results of OsYUCCA gene family members in rice [41].

3.2. YUCCA Expression Patterns in I. indigotica

Gene expression patterns are usually consistent with their functions. Here, qRT-PCR analysis was conducted to investigate IiYUCCA gene expressions in nine organs and four developmental periods, which was conducive to assessing their possible biological functions. However, IiYUCCA5-2 was not quantified by qRT-PCR, because its prediction exon sequence showed a base deletion at the 960-bp position, suggesting an early translation termination, hinting that IiYUCCA5-2 might be a pseudogene. In addition, our transcriptome dataset of I. indigotica under different stress conditions (unpublished) showed no information for IiYUCCA5-2 (Figure S4 shows its specific nucleotide sequence). Overall, there were distinct expression differences between the vegetative (IiYUCCA1, IiYUCCA4, IiYUCCA5-1) and the reproductive organs (IiYUCCA2, IiYUCCA7, IiYUCCA10). Furthermore, IiYUCCA9 and IiYUCCA11 showed similar expression patterns, implying that there could be a certain degree of functional redundancy, which also contributed to stabilizing the genetic networks [24]. It was reported that the expression profiles of YUCCA genes in P. trichocarpa [23], Lycopersicon esculentum [40], and Zea mays [27] displayed a wide scope of expression patterns in different kinds of tissues. However, the YUCCA genes of A. thaliana [13] and Fragaria vesca [42] were mainly expressed in the meristem, young primordium, vascular tissue, and reproductive organs. Thus, the different expression profiles reflected the species differences, and the differences in I. indigotica need to be discussed. Some IiYUCCA gene expressions were upregulated along with the developmental process, such as IiYUCCA2, IiYUCCA4, IiYUCCA10, and IiYUCCA11. In contrast, the expression levels of IiYUCCA2, IiYUCCA3, IiYUCCA5, IiYUCCA8, and IiYUCCA9 were downregulated. The results implied that these genes could play important roles in the developmental process. Therefore, the analyses of expression patterns in IiYUCCA genes provided some information to explore the functions of YUCCA genes in different organs and during different developmental processes, as well as contribute to speculating how spatio-temporal patterns of auxin biosynthesis are regulated in I. indigotica.
There was some evidence exhibiting that YUCCA genes performed potential regulatory functions under different kinds of stress conditions [17,43]. IiYUCCA6-1 was sensitive to NaCl, PEG, cold, and wounding treatments. Its changes in expression pattern reflected that this gene might be involved in complex regulatory processes, with a function in defense responses. Similar results were found in G. max, whereas C. sativus CsYUCCA8 and CsYUCCA9 responded significantly to high temperature, and CsYUCCA10b was sensitive to low temperature and salt stress [29]. GmYUCCA5 and GmYUCCA8 were proven to be sensitive to different stress stimuli, including drought, copper, zinc, low temperature, high temperature, and salinity [24]. These findings indicated the potential functions of YUCCA genes in improving the stress-resistance capacities in plants. It is necessary to confirm the expression patterns of YUCCA genes in I. indigotica, which contribute to enriching the YUCCA gene family characteristics and functional researches in plants.

3.3. Functional Analysis on IiYUCCA6-1 Ectopically Expressed in Tobacco

Auxin plays important roles in cell division, lateral root formation, flowering time, and leaf senescence in plants [43]. The functions of the YUCCA gene family in IAA biosynthesis, plant development, and leaf senescence are typically associated with IAA level changes [16]. In this study, the functions of IiYUCCA6-1 in the auxin biosynthesis process in I. indigotica were also discussed. Its functions in the IAA synthesis pathway were relatively consistent with those of AtYUCCA6 reported in A. thaliana [22] and strawberry [42]. It was found that over-expression of AtYUCCA6 increased not only IAA content, but also the expression levels of some auxin-responsive genes [22]. Here, similar results were obtained in transgenic tobacco, the expression levels of NbIAA8, NbIAA16, NbGH3.1, and NbGH3.6 were significantly higher than those in the control group. The results demonstrated that the over-expressed IiYUCCA6-1 gene might upregulate the auxin content, whereas the expression of early responsive genes was activated. Moreover, it was reported that YUCCA family genes could participate in plant resistance to stress [29], which was also proven in our experiment. Under dark stress, a visible change in total chlorophyll content in transgenic lines was observed, as well as H2O2 content. Furthermore, the expression level of NbSAG12 decreased in the transgenic lines, which could be explained by the senescence process being delayed to a certain extent. Hence, the over-expression of IiYUCCA6-1 in tobacco could promote IAA content, as well as upregulate the expression of auxin biosynthesis genes, which caused the typical hyperauxin phenotype. Furthermore, with a decrease in the contents of total chlorophyll and H2O2, as well as a downregulation of NbSAG12, the leaf senescence process was delayed, and stress resistance could also be improved. However, there are more stress conditions that still need further research.

4. Materials and Methods

4.1. Isolation and Sequence Analysis of YUCCA Gene Family in I. indigotica

To identify YUCCA family genes in I. indigotica, the nucleotide sequences of YUCCA genes from A. thaliana, B. rapa, B. oleracea, R. sativus, and O. sativa were downloaded from TAIR (https://www.arabidopsis.org/), brassicaDB (http://brassicadb.org), and RGAP (http://rice.plantbiology.msu.edu/). The BLASTn program (aligned a given nucleic acid sequence to the database) with a threshold of 1 × 10−20 was used to obtain the predicted sequences based on I. indigotica genome data. Then, Pfam (http://pfam.sanger.ac.uk/) and CDD (Conserved Domain Database) analyses were performed to confirm the encoded sequences of IiYUCCA proteins. GeneWise (Barcelona, Spain) was used to predict the pseudogenes. Furthermore, the physical and chemical properties (isoelectric point, molecular weight, GRAVY, and instability index) of IiYUCCA proteins were calculated using the ExPASy website (http://web.expasy.org/protparam/).
The chromosome locations of IiYUCCA members were investigated using MapChart software. The gene structures were analyzed using the Gene Structure Display Server (http://gsds.cbi.pku.edu.cn/, Peking University, Beijing, China). MEME software (http://meme-suite.org/, University of Nevada, Reno, USA) was used to find the common motifs, and the maximum number of motifs was set to 12 with the width of motifs set from six to 20. The multiple sequence alignments of YUCCA gene family proteins from six species were performed using the MUSCLE program (LynnonBiosoft Company, San Ramon, CA, USA) with default parameters. The full-length amino-acid sequences of 96 YUCCA proteins from six species were downloaded from their genome database, while the phylogenetic tree with aligned amino-acid sequences was constructed using MEGA 7.0 software with the maximum-likelihood method and verified with 1000 bootstraps. In addition, PAML 4.9d software was used to calculate the synonymous substitution rates (Ks) and non-synonymous substitution rates (Ka) of YUCCA genes in I. indigotica.

4.2. Plant Materials and Treatments

I. indigotica seeds were sown in pots (three plants each pot) in the greenhouse of the National Engineering Laboratory for Resources Development of Endangered Crude Drugs in Northwest China. The plants were cultivated at 23 ± 2 °C under a 16-h light/8-h dark photoperiod. Leaf materials at different developmental periods were taken from seedlings at seven days (cotyledon unfolding), 21 days (the second pair of euphylla unfolding), 60 days, and 150 days. Moreover, 60-day-old seedlings were treated with different abiotic stresses, namely, 5% PEG600, 100 mM NaCl, 4 °C, and 40% mechanical wounding, and the control group was irrigated with the same amount of deionized water. Then, all the leaf materials were collected after 0, 1, 3, 6, 12, and 24 h of treatment. The different organs, including roots, stems, leaves, buds, flowers, and siliques were taken from the plants in the field. All samples were quickly frozen in liquid nitrogen and stored at −80 °C for further research.

4.3. Gene Expression Analysis

Total RNA of each sample was extracted with TRIzol® reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol. The quality of RNA was determined using a Nanodrop instrument (Thermo Fisher Scientific, Waltham, MA, USA) and agarose gel electrophoresis. The first-strand complementary DNA (cDNA) was synthesized using the PrimeScript TM II First Strand cDNA Synthesis Kit (TaKaRa, Dalian, China), with 1.0 µg of total RNA in 20 µL of water, stored at −20 °C. The RT-PCR products were diluted (1:20) for qRT-PCR analysis, which was performed using the SYBR® Premix Ex Taq™ II (TaKaRa, Dalian, China) on a Roche LightCycler®96 System (Roche Diagnostics, Basel, Switzerland). All primer sequences for qRT-PCR are listed in the Supplementary Materials (Table S1). The endogenous reference genes from I. indigotica, IieIF2, IiPP2A-4, and IiRPL15, were used as the internal controls [44]. The relative gene expression levels were examined using the 2−∆∆CT method. In each experiment, three biological and technical repeats were conducted.

4.4. Generation of Transgenic N. benthamiana

IiYUCCA6-1 was cloned by the specific primers (forward (F): 5′–ATGGATTTCTGCT GGAGGA–3′, reverse (R): 5′–TCAACCGTCTAGTAATCTACTAT–3′), with the following PCR conditions: 94 °C, 3 min; 30 cycles of 94 °C, 30 s, 57 °C, 30 s, 72 °C, 2 min; 72 °C, 10 min. Subsequently, the product was cut with the restriction enzymes, Bgl II and Spe I, then inserted into the pCAMBIA1302 vector with the CaMV35S promoter. Furthermore, the vector was transformed into Agrobacterium tumefaciens strain GV3101, and the transformation of N. benthamiana was conducted using Agrobacterium-mediated leaf disc method. After screening by Hygromycin B, the over-expressed IiYUCCA6-1 plants were sampled separately. One part of the plants was used to extract the genomic DNA, and the other part was used to extract RNA and reverse-transcribe to cDNA. Then, the transgenic lines were detected at the DNA and RNA level.

4.5. Heterologous Transformation of IiYUCCA6-1 to N. benthamiana

The fresh leaves from control and transgenic lines were selected for the gene function analysis. The cDNA was used to detect the expressions of early responsive genes (NbIAA8, NbIAA16, NbGH3.1, NbGH3.6), and free IAA contents were measured with the help of a Plant Indole-3-acetic acid ELISA Kit (Enzyme-linked Biotechnology Co., Ltd., Shanghai, China), following the manufacturer’s instructions. Next, some leaves were soaked in 3 mM MES (2-(N-morpholine) ethanesulfonic acid) medium (pH 5.7), and then placed in the dark. The total contents of chlorophyll and H2O2 (Jiancheng, Nanjing, China), and the expression level of senescence related gene NbSAG12 (F: 5′–ATGAAGATGTGCCAGCG AAC–3′; R: 5′–AGCTACTCCCGTCTATTGCC–3′) were detected after dark treatments (zero and seven days), with NbActin (F: 5′–CGTTATGGTTGGAATGGGACAGAA–3′; R: 5′–AAGAACAGGGTGCTCCTC GTGG–3′) as the reference gene.

4.6. Statistical Analysis

Statistical analysis was performed with SPSS 22.0 software (IBM Company, Foster City, CA, USA). All experimental data were assessed using one-way analysis of variance (ANOVA), and results were presented as the means ± standard error (SE) at the levels of * p < 0.05, ** p < 0.01, and *** p < 0.001.

5. Conclusions

In brief, this study systematically analyzed the YUCCA gene family structures, phylogenetic characteristics, and expression patterns in I. indigotica. One of YUCCA gene family members, IiYUCCA6-1, could promote IAA accumulation and the upregulation of some auxin-responsive genes, which triggered a typical hyperauxin performance. Moreover, the contents of total chlorophyll and H2O2 decreased and the expression of NbSAG12 was downregulated, which could delay the senescence process while improving the stress resistance (Figure 9). This study provided a systematic and comprehensive analysis of the I. indigotica YUCCA gene family using phylogenetic analysis, gene expression analysis, and functional characterization by heterologous expression in tobacco. All the findings demonstrated the experimental basis for the identification of the YUCCA genes in I. indigotica, with an exploration of their function.

Supplementary Materials

Supplementary materials can be found at https://www.mdpi.com/1422-0067/21/6/2188/s1.

Author Contributions

Conceptualization, writing—original draft, and writing—review and editing, M.Q. and T.L.; methodology and investigation, J.W., M.Q. and X.H.; software and formal analysis, T.Z., M.Q., and J.Z.; data curation, X.W., R.L., and T.G.; resources, S.Z., Y.Y., and Z.W.; funding acquisition and supervision, T.L. All authors read and agreed to the published version of the manuscript.

Funding

The authors gratefully acknowledge the financial support from the Natural Science Foundation of Shaanxi Province (2019JM-352), the Social Development Science and Technology R&D program of Shaanxi Province (2016SF-390), and the National Students’ Innovation and entrepreneurship Training Program (S201910718186).

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Feng, H.Q.; Li, C. Research advances of auxin signal transduction. Biotechnol. Bull. 2018, 34, 24–30. [Google Scholar]
  2. Ellis, C.M.; Nagpal, P.; Young, J.C.; Hagen, G.; Guilfoyle, T.J.; Reed, J.W. Auxin response factor1 and auxin response factor2 regulate senescence and floral organ abscission in Arabidopsis thaliana. Development 2005, 132, 4563–4574. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  3. Péret, B.; De Rybel, B.; Casimiro, I.; Benková, E.; Swarup, R.; Laplaze, L.; Beeckman, T.; Bennett, M.J. Arabidopsis lateral root development: An emerging story. Trends Plant Sci. 2009, 14, 399–408. [Google Scholar] [CrossRef] [PubMed]
  4. Woodward, A.W. Auxin: Regulation, action, and interaction. Ann. Bot. 2005, 95, 707–735. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  5. Andrea, G. The role of auxin in shaping shoot architecture. J. Exp. Bot. 2013, 64, 2593–2608. [Google Scholar]
  6. Robert, H.S.; Park, C.; Gutièrrez, C.L.; Wójcikowska, B.; Pěnčík, A.; Novák, O.; Chen, J.; Grunewald, W.; Dresselhaus, T.; Friml, J.; et al. Maternal auxin supply contributes to early embryo patterning in Arabidopsis. Nat. Plants 2018, 4, 548–553. [Google Scholar] [CrossRef]
  7. Yuan, H.Z.; Zhao, M.Z.; Wu, W.M.; Yu, H.M.; Qian, Y.M.; Wang, Z.W.; Wang, X.C. Genome-wide identification and expression analysis of auxin-related gene families in grape. Yi Chuan 2015, 37, 720–730. [Google Scholar]
  8. Wang, S.; Bai, Y.; Shen, C.; Wu, Y.; Zhang, S.; Jiang, D.; Guilfoyle, T.J.; Chen, M.; Qi, Y. Auxin-related gene families in abiotic stress response in Sorghum bicolor. Funct. Integr. Genomics 2010, 10, 533–546. [Google Scholar] [CrossRef]
  9. Jain, M.; Khurana, J.P. Transcript profiling reveals diverse roles of auxin-responsive genes during reproductive development and abiotic stress in rice. FEBS J. 2009, 276, 3148–3162. [Google Scholar] [CrossRef]
  10. Zhang, S.W.; Li, C.H.; Cao, J.; Zhang, Y.C.; Zhang, S.Q.; Xia, Y.F.; Sun, D.Y.; Sun, Y. Altered architecture and enhanced drought tolerance in rice via the down-regulation of indole-3-acetic acid by TLD1/OsGH3.13 activation. Plant Physiol. 2009, 151, 1889–1901. [Google Scholar] [CrossRef] [Green Version]
  11. Shibasaki, K.; Uemura, M.; Tsurumi, S.; Rahman, A. Auxin response in Arabidopsis under cold stress: Underlying molecular mechanisms. Plant Cell 2009, 21, 3823–3838. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  12. Mashiguchi, K.; Tanaka, K.; Sakai, T.; Sugawara, S.; Kawaide, H.; Natsume, M.; Hanada, A.; Yaeno, T.; Shirasu, K.; Yao, H.; et al. The main auxin biosynthesis pathway in Arabidopsis. Proc. Natl. Acad. Sci. USA 2011, 108, 18512–18517. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  13. Cheng, Y.; Dai, X.; Zhao, Y. Auxin biosynthesis by the YUCCA flavin monooxygenases controls the formation of floral organs and vascular tissues in Arabidopsis. Genes Dev. 2006, 20, 1790–1799. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  14. Stepanova, A.N.; Robertson-Hoyt, J.; Yun, J.; Benavente, L.M.; Xie, D.Y.; Doležal, K.; Schlereth, A.; Jürgens, G.; Alonso, J.M. TAA1-mediated auxin biosynthesis is essential for hormone crosstalk and plant development. Cell 2008, 133, 177–191. [Google Scholar] [CrossRef] [Green Version]
  15. Won, C.; Shen, X.; Mashiguchi, K.; Zheng, Z.; Dai, X.; Cheng, Y.; Kasahara, H.; Kamiya, Y.; Chory, J.; Zhao, Y. Conversion of tryptophan to indole-3-acetic acid by tryptophan aminotransferases of Arabidopsis and YUCCAs in Arabidopsis. Proc. Natl. Acad. Sci. USA 2011, 108, 18518–18523. [Google Scholar] [CrossRef] [Green Version]
  16. Kim, J.I.; Murphy, A.S.; Baek, D.; Lee, S.W.; Yun, D.; Bressan, R.A.; Narasimhan, M.L. YUCCA6 over-expression demonstrates auxin function in delaying leaf senescence in Arabidopsis thaliana. J. Exp. Bot. 2011, 62, 3981–3992. [Google Scholar] [CrossRef]
  17. Lee, M.; Jung, J.H.; Han, D.Y.; Seo, P.J.; Park, W.J.; Park, C.M. Activation of a flavin monooxygenase gene YUCCA7 enhances drought resistance in Arabidopsis. Planta 2012, 235, 923–938. [Google Scholar] [CrossRef]
  18. Li, L.; Ljung, K.; Breton, G.; Schmitz, R.J.; Pruneda-Paz, J.; Cowing-Zitron, C.; Cole, B.J.; Ivans, L.J.; Pedmale, U.V.; Jung, H.S.; et al. Linking photoreceptor excitation to changes in plant architecture. Genes Dev. 2012, 26, 785–790. [Google Scholar] [CrossRef] [Green Version]
  19. Woodward, C.; Bemis, S.M.; Hill, E.J.; Sawa, S.; Koshiba, T.; Torii, K.U. Interaction of auxin and erecta in elaborating Arabidopsis inflorescence architecture revealed by the activation tagging of a new member of the YUCCA family putative flavin monooxygenases. Plant Physiol. 2005, 139, 192–203. [Google Scholar] [CrossRef] [Green Version]
  20. Kim, J.I.; Sharkhuu, A.; Jin, J.B.; Li, P.; Jeong, J.C.; Baek, D.; Lee, S.Y.; Blakeslee, J.J.; Murphy, A.S.; Bohnert, H.J.; et al. yucca6, a dominant mutation in Arabidopsis, affects auxin accumulation and auxin-related phenotypes. Plant Physiol. 2007, 145, 722–735. [Google Scholar] [CrossRef] [Green Version]
  21. Park, S.C.; Kim, H.S.; Lee, H.U.; Kim, Y.H.; Kwak, S.S. Overexpression of Arabidopsis YUCCA6 enhances environment stress tolerance and inhibits storage root formation in sweet potato. Plant Biotechnol. Rep. 2019, 13, 345–352. [Google Scholar] [CrossRef]
  22. Nana, L. Effect of overexpression of IAA synthetic gene YUCCA1 on the ripening process of strawberry fruit. J. Xinjiang Agric. Univ. 2018, 41, 267–275. [Google Scholar]
  23. Ye, X.; Kang, B.G.; Osburn, L.D.; Li, Y.; Max, C.Z.M. Identification of the flavin-dependent monooxygenase-encoding YUCCA gene family in Populus trichocarpa and their expression in vegetative tissues and in response to hormone and environmental stresses. Plant Cell Tiss. Organ Cult. 2009, 97, 271–283. [Google Scholar] [CrossRef]
  24. Wang, Y.; Liu, H.; Wang, S.; Li, H. Genome-wide identification and expression analysis of the YUCCA gene family in soybean (Glycine max L.). Plant Growth Regul. 2016, 81, 265–275. [Google Scholar] [CrossRef]
  25. Qian, Z.Q.; Wei, T.S.; Jie, Z.; Ping, W.Y.; He, S.H.; Yi, R.; Gui, G.S.; Yi, G.G.; Yong, X.; Ying, Z.H. Identification of YUCCA gene family and expression analysis during watermelon fruit ripening process. China Veg. 2019, 3, 21–29. [Google Scholar]
  26. Yamamoto, Y.; Kamiya, N.; Morinaka, Y.; Matsuoka, M.; Sazuka, T. Auxin biosynthesis by the YUCCA genes in rice. Plant Physiol. 2007, 143, 1362–1371. [Google Scholar] [CrossRef] [Green Version]
  27. Li, W.; Zhao, X.; Zhang, X. Genome-wide analysis and expression patterns of the YUCCA genes in Maize. J. Genet. Genom. 2015, 42, 707–710. [Google Scholar] [CrossRef]
  28. Li, N.; Yin, N.; Niu, Z.; Hui, W.; Song, J.; Huang, C.; Wang, H.; Kong, L.; Feng, D. Isolation and characterization of three TaYUC10 genes from wheat. Gene 2014, 546, 187–194. [Google Scholar] [CrossRef]
  29. Yan, S.; Che, G.; Ding, L.; Chen, Z.; Liu, X.; Wang, H.; Zhao, W.; Ning, K.; Zhao, J.; Tesfamichael, K.; et al. Different cucumber CsYUC genes regulate response to abiotic stresses and flower development. Sci. Rep. 2016, 6, 20760. [Google Scholar] [CrossRef]
  30. Poulet, A.; Kriechbaumer, V. Bioinformatics analysis of phylogeny and transcription of TAA/YUC auxin biosynthetic genes. Int. J. Mol. Sci. 2017, 18, 1791. [Google Scholar] [CrossRef] [Green Version]
  31. Liu, H.; Xie, W.F.; Zhang, L.; Victoriano, V.; Ye, Z.W.; Gao, Q.H.; Duan, K. Auxin biosynthesis by the YUCCA6 flavin monooxygenase gene in woodland strawberry. J. Integr. Plant Biol. 2014, 56, 350–363. [Google Scholar]
  32. Cao, X.; Yang, H.L.; Shang, C.Q.; Ma, S.; Liu, L.; Cheng, J.L. The roles of auxin biosynthesis YUCCA gene family in plants. Int. J. Mol. Sci. 2019, 20, 6343. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  33. Xiao, S.S.; Jin, Y.; Sun, Y.Q. Recent progress in the studies of chemical con-stituents, pharmacological effects and quality control methods on the roots of Isatis indigotica. J. Shenyang Pharm. Univ. 2003, 20, 455–459. [Google Scholar]
  34. Kang, M.; Wu, H.; Yang, Q.; Huang, L.; Hu, Q.; Ma, T.; Li, Z.; Liu, J. A chromosome-scale genome assembly of Isatis indigotica, an important medicinal plant used in traditional Chinese medicine: An Isatis genome. Hortic. Res. 2020, 7, 18. [Google Scholar] [CrossRef] [Green Version]
  35. Hurst, L.D. The Ka/Ks ratio: Diagnosing the form of sequence evolution. Trends Genet. 2002, 18, 486. [Google Scholar] [CrossRef]
  36. Tobena-Santamaria, R. FLOOZY of petunia is a flavin mono-oxygenase-like protein required for the specification of leaf and flower architecture. Genes Dev. 2002, 16, 753–763. [Google Scholar] [CrossRef] [Green Version]
  37. Zhao, Y.; Christensen, S.K.; Fankhauser, C.; Cashman, J.R.; Cohen, J.D.; Weigel, D.; Chory, J. A role for flavin monooxygenase-like enzymes in auxin biosynthesis. Science 2001, 291, 306–309. [Google Scholar] [CrossRef]
  38. Gallavotti, A.; Barazesh, S.; Malcomber, S.; Hall, D.; Jackson, D.; Schmidt, R.J.; McSteen, P. Sparse inflorescence1 encodes a monocot-specific YUCCA-like gene required for vegetative and reproductive development in maize. Proc. Natl. Acad. Sci. USA 2008, 105, 15196–15201. [Google Scholar] [CrossRef] [Green Version]
  39. Exposito-Rodriguez, M.; Borges, A.A.; Borges-Perez, A.; Hernandez, M.; Perez, J.A. Cloning and biochemical characterization of ToFZY, a tomato gene encoding a flavin monooxygenase involved in a tryptophan-dependent auxin biosynthesis pathway. J. Plant Growth Regul. 2007, 26, 329–340. [Google Scholar] [CrossRef]
  40. Exposito-Rodriguez, M.; Borges, A.A.; Borges-Perez, A.; Perez, J.A. Gene structure and spatiotemporal expression profile of tomato genes encoding YUCCA-like flavin monooxygenases: The ToFZY gene family. Plant Physiol. Biochem. 2011, 49, 782–791. [Google Scholar] [CrossRef]
  41. Woo, Y.M.; Park, H.J.; Su’udi, M.; Yang, J.I.; Park, J.J.; Back, K.; Park, Y.M.; An, G. Constitutively wilted 1, a member of the rice YUCCA gene family, is required for maintaining water homeostasis and an appropriate root to shoot ratio. Plant Mol. Biol. 2007, 65, 125–136. [Google Scholar] [CrossRef] [PubMed]
  42. Liu, H.; Ying, Y.Y.; Zhang, L.; Gao, Q.H.; Li, J.; Zhang, Z.; Fang, J.G.; Duan, K. Isolation and characterization of two YUCCA flavin monooxygenase genes from cultivated strawberry (Fragaria × ananassa Duch.). Plant Cell Rep. 2012, 31, 1425–1435. [Google Scholar] [CrossRef] [PubMed]
  43. Kim, J.I.; Baek, D.; Park, H.C.; Chun, H.J.; Oh, D.H.; Lee, M.K.; Cha, J.Y.; Kim, W.Y.; Kim, M.C.; Chung, W.S.; et al. Overexpression of Arabidopsis YUCCA6 in potato results in high-auxin developmental phenotypes and enhanced resistance to water deficit. Mol. Plant 2013, 6, 337–349. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  44. Li, T.; Wang, J.; Lu, M.; Zhang, T.; Qu, X.; Wang, Z. Selection and validation of appropriate reference genes for qRT-PCR analysis in Isatis indigotica Fort. Front. Plant Sci. 2017, 8, 1139. [Google Scholar] [CrossRef] [Green Version]
Ijms 21 02188 g001 550
Figure 1. The chromosomal locations of YUCCA genes from I. indigotica. The scale represents a 35-Mb chromosomal distance. The numbers above represent the location of each gene.
Figure 1. The chromosomal locations of YUCCA genes from I. indigotica. The scale represents a 35-Mb chromosomal distance. The numbers above represent the location of each gene.
Ijms 21 02188 g001
Ijms 21 02188 g002 550
Figure 2. The phylogenetic tree, gene structure, multiple motifs (A), and multiple sequence alignment (B) of YUCCA gene family in I. indigotica. The gene structures of exons and introns are represented by yellow boxes and lines, respectively. The multiple conserved motifs were identified by MEME software, and they are labeled with colored boxes.
Figure 2. The phylogenetic tree, gene structure, multiple motifs (A), and multiple sequence alignment (B) of YUCCA gene family in I. indigotica. The gene structures of exons and introns are represented by yellow boxes and lines, respectively. The multiple conserved motifs were identified by MEME software, and they are labeled with colored boxes.
Ijms 21 02188 g002
Ijms 21 02188 g003 550
Figure 3. Phylogenetic relationships of YUCCA genes among Arabisopsis thaliana (green), Brassica rapa (dark blue), B. oleracea (light blue), Raphanus sativus (purple), Oryza sativa (yellow), and I. indigotica (red). The unrooted phylogenetic tree was constructed by MEGA 7.0.
Figure 3. Phylogenetic relationships of YUCCA genes among Arabisopsis thaliana (green), Brassica rapa (dark blue), B. oleracea (light blue), Raphanus sativus (purple), Oryza sativa (yellow), and I. indigotica (red). The unrooted phylogenetic tree was constructed by MEGA 7.0.
Ijms 21 02188 g003
Ijms 21 02188 g004 550
Figure 4. The expression patterns of YUCCA genes in different organs from I. indigotica. 1–9: mature root, lateral root, mature stem, young stem, mature leaf, young leaf, fruit, bud, and flower, respectively. Different lowercase letters indicate the significant differences for the relative expression levels at p < 0.05 level.
Figure 4. The expression patterns of YUCCA genes in different organs from I. indigotica. 1–9: mature root, lateral root, mature stem, young stem, mature leaf, young leaf, fruit, bud, and flower, respectively. Different lowercase letters indicate the significant differences for the relative expression levels at p < 0.05 level.
Ijms 21 02188 g004
Ijms 21 02188 g005 550
Figure 5. The expression patterns of YUCCA genes in different developmental periods from I. indigotica. Different lowercase letters indicate the significant differences for the relative expression at p < 0.05 level.
Figure 5. The expression patterns of YUCCA genes in different developmental periods from I. indigotica. Different lowercase letters indicate the significant differences for the relative expression at p < 0.05 level.
Ijms 21 02188 g005
Ijms 21 02188 g006 550
Figure 6. The expression patterns of IiYUCCA6-1 under different stress treatments. Different lowercase letters indicate significant differences for the relative expression at the p < 0.05 level.
Figure 6. The expression patterns of IiYUCCA6-1 under different stress treatments. Different lowercase letters indicate significant differences for the relative expression at the p < 0.05 level.
Ijms 21 02188 g006
Ijms 21 02188 g007 550
Figure 7. Identification and determination of the over-expressed IiYUCCA6-1 in N. benthamiana (OE1–OE10). (A) DNA and RNA detections of transgenic N. benthamiana; (B) IAA content determinations in N. benthamiana; (C) the morphologic changes of transgenic N. benthamiana; (D) the expressions on IAA early responsive genes in transgenic lines. Significant differences are described as * p < 0.05, ** p < 0.01 and *** p < 0.001.
Figure 7. Identification and determination of the over-expressed IiYUCCA6-1 in N. benthamiana (OE1–OE10). (A) DNA and RNA detections of transgenic N. benthamiana; (B) IAA content determinations in N. benthamiana; (C) the morphologic changes of transgenic N. benthamiana; (D) the expressions on IAA early responsive genes in transgenic lines. Significant differences are described as * p < 0.05, ** p < 0.01 and *** p < 0.001.
Ijms 21 02188 g007
Ijms 21 02188 g008 550
Figure 8. Determination of total chlorophyll and H2O2 contents and the expression of NbSAG12. (A) The decreased percentage of total chlorophyll content; (B) the increased values of H2O2 content; (C) the expression levels of NbSAG12 in the transgenic lines.
Figure 8. Determination of total chlorophyll and H2O2 contents and the expression of NbSAG12. (A) The decreased percentage of total chlorophyll content; (B) the increased values of H2O2 content; (C) the expression levels of NbSAG12 in the transgenic lines.
Ijms 21 02188 g008
Ijms 21 02188 g009 550
Figure 9. A model of IiYUCCA6-1-regulated IAA accumulation and leaf senescence.
Figure 9. A model of IiYUCCA6-1-regulated IAA accumulation and leaf senescence.
Ijms 21 02188 g009
Table
Table 1. YUCCA family genes in I. indigotica.
Table 1. YUCCA family genes in I. indigotica.
Gene NameGene IDChromosome LocationCDS Length (bp)ExonsProtein Length (aa)MW (Da)pIGRAVYInstability Index
IiYUCCA1EVM0033712Chr06: 30576212–305787481317543848,658.389.58−0.21840.24
IiYUCCA2EVM0000868Chr03: 15976139–159778491248441546,528.128.36−0.11645.62
IiYUCCA3EVM0030530Chr06: 30914630–309163621269442247,162.389.15−0.24335.7
IiYUCCA4EVM0029692Chr02: 3979445–39834641236541145,732.069.39−0.12333.44
IiYUCCA5-1EVM0003921Chr01: 14186499–141879761287342847,701.119−0.1851.45
IiYUCCA5-2EVM0010459Chr01: 14011394–140128521203340044,461.148.91−0.25550.61
IiYUCCA6-1EVM0022538contig1043: 115626–1184491335444449,773.538.71−0.20139.95
IiYUCCA6-2Pseudogene492contig1042: 131146–133992456------
IiYUCCA7EVM0024488Chr07: 21875662–218773241311343648,814.389.07−0.20742.26
IiYUCCA8EVM0005748Chr03: 28640430–286419281287342848,092.618.95−0.22548.86
IiYUCCA9EVM0000072Chr06: 31112478–311139661245341446,277.419.32−0.24347.12
IiYUCCA10EVM0002314Chr06: 3442231–34447771044334738,643.588.53−0.12226.13
IiYUCCA11EVM0031632Chr06: 23649486–236508521176339143,467.149.44−0.15442.9
Note: ID-identifier; aa-amino acid; MW-molecular weight; pI-isoelectric point. GRAVY-the grand average of hydropathy.

Share and Cite

MDPI and ACS Style

Qin, M.; Wang, J.; Zhang, T.; Hu, X.; Liu, R.; Gao, T.; Zhao, S.; Yuan, Y.; Zheng, J.; Wang, Z.; et al. Genome-Wide Identification and Analysis on YUCCA Gene Family in Isatis indigotica Fort. and IiYUCCA6-1 Functional Exploration. Int. J. Mol. Sci. 2020, 21, 2188. https://doi.org/10.3390/ijms21062188

AMA Style

Qin M, Wang J, Zhang T, Hu X, Liu R, Gao T, Zhao S, Yuan Y, Zheng J, Wang Z, et al. Genome-Wide Identification and Analysis on YUCCA Gene Family in Isatis indigotica Fort. and IiYUCCA6-1 Functional Exploration. International Journal of Molecular Sciences. 2020; 21(6):2188. https://doi.org/10.3390/ijms21062188

Chicago/Turabian Style

Qin, Miaomiao, Jing Wang, Tianyi Zhang, Xiangyang Hu, Rui Liu, Tian’e Gao, Shuaijing Zhao, Yilin Yuan, Jinyu Zheng, Zirong Wang, and et al. 2020. "Genome-Wide Identification and Analysis on YUCCA Gene Family in Isatis indigotica Fort. and IiYUCCA6-1 Functional Exploration" International Journal of Molecular Sciences 21, no. 6: 2188. https://doi.org/10.3390/ijms21062188

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop