HSP Transcript and Protein Accumulation in Brassinosteroid Barley Mutants Acclimated to Low and High Temperatures
Abstract
:1. Introduction
2. Results and Discussion
2.1. Presence of Heat-Shock Proteins in Barley Membrane and Cytosolic Fractions
2.2. Changes in the Accumulation of the HSP90 Transcript and Protein in the Barley BR Mutants and Wild-Type Plants Growing at 20 °C and Acclimated at 5 °C and 27 °C
2.3. Changes in the Accumulation of the HSP70 Transcript and Protein in the Barley BR Mutants and Wild-Type Plants Growing at 20 °C and Acclimated at 5 °C and 27 °C
2.4. Changes in the Accumulation of the HSP18 and HSP17 Transcripts in the Barley BR Mutants and Wild-Type Plants Growing at 20 °C and Acclimated at 5 °C and 27 °C
2.5. General Comments
3. Materials and Methods
3.1. Plant Material
3.2. Plant Culture and Experimental Design
3.3. Isolation of the Membrane and Cytosolic Fractions
3.4. Accumulation of the Transcripts of HSP90, HSP70, HSP18, and HSP17: RNA Isolation, Complementary DNA (cDNA) Synthesis, and Real-Time PCR Reaction
3.5. Analysis of the Protein Content in the Cell Membrane and the Cytosolic Fractions
3.6. Analysis of the Accumulation of HSP90, HSP70, HSP18.5, and HSP17.7 Using Immunoblotting
3.7. Statistical Analysis
4. Conclusions
- (1)
- In the tested Delisa and Bowman cultivars, the temperature of the growth/acclimation affected the expression of the HSPs. Acclimation at 5 °C increased the HSP90 transcript only in the Bowman (compared to 20 °C). Acclimation at 27 °C decreased the HSP90 transcript and drastically increased the sHSP transcripts in both cultivars. Acclimation at 5 °C and 27 °C increased the HSP70 transcript in both cultivars. As for the respective protein accumulation, the results were more cultivar-dependent, but for both cultivars, identical directions of changes were observed for the accumulation of HSP90 (lower in the membrane fraction at 5 °C) and HSP70 accumulation (lower at 27 °C in the membrane fraction but increased in the cytosolic fraction).
- (2)
- The role of brassinosteroids as positive regulators of the expression of HSPs seems to be proven by the results that were obtained for the BR-signaling mutant. In most cases, the mutant with a defective BR receptor had a lower accumulation of the HSP transcripts and HSP proteins compared to the wild type, regardless of the plant growth/acclimation temperature. The results that were obtained for the BR-deficient mutants (BW084 and 522DK) may additionally confirm that BRs are among the players that regulate the expression of HSPs. The results, however, also show that lowering the level of BRs (BRs were drastically lower in BW084, but only relatively slightly lower in 522DK) does not always act negatively on the expression of HSPs. Moreover, the genetic background of cultivars from which the biosynthetic mutants were derived also seems to be important for HSP expression, because BRs may act in complicated network with other phytohormones.
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Awasthi, R.; Bhandari, K.; Nayyar, H. Temperature stress and redox homeostasis in agricultural crops. Front. Environ. Sci. 2015, 3, 11. [Google Scholar] [CrossRef] [Green Version]
- Hasanuzzaman, M.; Nahar, K.; Fujita, M. Extreme temperature responses, oxidative stress and antioxidant defense in plants. In Abiotic Stress Plant Responses Appllications in Agriculture; Vahdati, K., Leslie, C., Eds.; IntechOpen: London, UK, 2013; pp. 169–205. [Google Scholar]
- Altschuler, M.; Mascarenhas, J.P. Heat shock proteins and effects of heat shock in plants. Plant Mol. Biol. 1982, 1, 103–115. [Google Scholar] [CrossRef] [PubMed]
- Howarth, C.J. Molecular responses of plants to an increased incidence of heat shock. Plant Cell Environ. 1991, 14, 831–841. [Google Scholar] [CrossRef]
- Kotak, S.; Larkindale, J.; Lee, U.; von Koskull-Döring, P.; Vierling, E.; Scharf, K.D. Complexity of the heat stress response in plants. Curr. Opin. Plant Biol. 2007, 10, 310–316. [Google Scholar] [CrossRef]
- Al-Whaibi, M.H. Plant heat-shock proteins: A mini review. J. King Saud Univ. Sci. 2011, 23, 139–150. [Google Scholar] [CrossRef] [Green Version]
- Park, C.J.; Seo, Y.S. Heat shock proteins: A review of the molecular chaperones for plant immunity. Plant Pathol. J. 2015, 31, 323–333. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, W.; Vinocur, B.; Shoseyov, O.; Altman, A. Role of plant heat-shock proteins and molecular chaperones in the abiotic stress response. Trends Plant Sci. 2004, 5, 244–252. [Google Scholar] [CrossRef]
- Usman, M.G.; Rafii, M.Y.; Martini, M.Y.; Yusuff, O.A.; Ismail, M.R.; Miah, G. Molecular analysis of Hsp70 mechanisms in plants and their function in response to stress. Biotechnol. Genet. Eng. Rev. 2017, 33, 26–39. [Google Scholar] [CrossRef]
- Horváth, I.; Glatz, A.; Nakamoto, H.; Mishkind, M.L.; Munnik, T.; Saidi, Y.; Goloubinoff, P.; Harwood, J.L.; Vigh, L. Heat shock response in photosynthetic organisms: Membrane and lipid connections. Prog. Lipid Res. 2012, 51, 208–220. [Google Scholar] [CrossRef]
- Mitchell, J.W.; Mandava, N.; Worley, J.F.; Plimmer, J.R.; Smith, M.V. Brassins-a new family of plant hormones from rape pollen. Nature 1970, 225, 1065–1066. [Google Scholar] [CrossRef]
- Grove, M.D.; Spencer, G.F.; Rohwedder, W.K.; Mandava, N.; Worley, J.F.; Warthen, J.D.; Steffens, G.L.; Flippen-Anderson, J.L.; Cook, J.C. Brassinolide, a plant growth-promoting steroid isolated from Brassica napus pollen. Nature 1979, 281, 216–217. [Google Scholar] [CrossRef]
- Bajguz, A.; Hayat, S. Effects of brassinosteroids on the plant responses to environmental stresses. Plant Physiol. Biochem. 2009, 47, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Sadura, I.; Janeczko, A. Physiological and molecular mechanisms of brassinosteroid-induced tolerance to high and low temperature in plants. Biol. Plant. 2018, 64, 601–616. [Google Scholar] [CrossRef] [Green Version]
- Mazorra, L.M. Brassinosteroid action and its relation with heat stress mechanisms in plants. In Brassinosteroids: A Class of Plant Hormone; Hayat, S., Ahmad, A., Eds.; Springer: Dordrecht, The Netherlands, 2011; pp. 289–307. [Google Scholar]
- Eremina, M.; Unterholzner, S.J.; Rathnayake, A.I.; Castellanos, M.; Khan, M.; Kugler, K.G.; May, S.T.; Mayer, K.F.X.; Rozhon, W.; Poppenberger, B. Brassinosteroids participate in the control of basal and acquired freezing tolerance of plants. Proc. Natl. Acad. Sci. USA 2016, 113, 5982–5991. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sadura, I.; Pociecha, E.; Dziurka, M.; Oklestkova, J.; Novak, O.; Gruszka, D.; Janeczko, A. Mutations in the HvDWARF, HvCPD and HvBRI1 genes-involved in brassinosteroid biosynthesis/signalling: Altered photosynthetic efficiency, hormonal homeostasis and tolerance to high/low temperatures in barley. J. Plant Growth Regul. 2019, 38, 1062–1081. [Google Scholar] [CrossRef] [Green Version]
- Gruszka, D.; Szarejko, I.; Maluszynski, M. Identification of barley DWARF gene involved in brassinosteroid synthesis. Plant Growth Regul. 2011, 65, 343–358. [Google Scholar] [CrossRef] [Green Version]
- Dockter, C.; Gruszka, D.; Braumann, I.; Druka, A.; Druka, I.; Franckowiak, J.; Gough, S.P.; Janeczko, A.; Kurowska, M.; Lundqvist, J.; et al. Induced variations in brassinosteroid genes define barley height and sturdiness, and expand the green revolution genetic toolkit. Plant Physiol. 2014, 166, 1912–1927. [Google Scholar] [CrossRef] [Green Version]
- Gruszka, D.; Gorniak, M.; Glodowska, E.; Wierus, E.; Oklestkova, J.; Janeczko, A.; Maluszynski, M.; Szarejko, I. A reverse-genetics mutational analysis of the barley HvDWARF gene results in identification of a series of alleles and mutants with short stature of various degree and disturbance in BR biosynthesis allowing a new insight into the process. Int. J. Mol. Sci. 2016, 17, 600. [Google Scholar] [CrossRef] [Green Version]
- Xu, Z.S.; Li, Z.Y.; Chen, Y.; Chen, M.; Li, L.C.; Ma, Y.Z. Heat shock protein 90 in plants: Molecular mechanisms and roles in stress responses. Int. J. Mol. Sci. 2012, 13, 15706–15723. [Google Scholar] [CrossRef]
- Lauwers, E.; Wang, Y.C.; Gallardo, R.; Van der Kant, R.; Michiels, E.; Swerts, J.; Baatsen, P.; Zaiter, S.S.; McAlpine, S.R.; Gounko, N.V.; et al. Hsp90 mediates membrane deformation and exosome release. Mol. Cell 2018, 71, 689–702. [Google Scholar] [CrossRef] [Green Version]
- Kubienová, L.; Sedlářová, M.; Vítečková-Wünschová, A.; Piterková, J.; Luhová, L.; Mieslerová, B.; Lebeda, A.; Navrátil, M.; Petřivalský, M. Effect of extreme temperatures on powdery mildew development and Hsp70 induction in tomato and wild Solanum spp. Plant Prot. Sci. 2013, 49, 41–54. [Google Scholar] [CrossRef] [Green Version]
- Guy, C.L.; Li, Q.-B. The organization and evolution of the spinach stress 70 molecular chaperone gene family. Plant Cell 1998, 10, 539–556. [Google Scholar] [CrossRef]
- Armijo, G.; Okerblom, J.; Cauvi, D.M.; Lopez, V.; Schlamadinger, D.E.; Kim, J.; Arispe, N.; De Maio, A. Interaction of heat shock protein 70 with membranes depends on the lipid environment. Cell Stress Chaperones 2014, 19, 877–886. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Horváth, I.; Multhoff, G.; Sonnleitner, A.; Vígh, L. Membrane-associated stress proteins: More than simply chaperones. Biochim. Biophys. Acta Biomembr. 2008, 1778, 1653–1664. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Löw, D.; Brändle, K.; Nover, L.; Forreiter, C. Cytosolic heat-stress proteins Hsp17.7 class I and Hsp17.3 class II of tomato act as molecular chaperones in vivo. Planta 2000, 211, 575–582. [Google Scholar] [CrossRef]
- Simões-Araújo, J.L.; Gouvêa-Rumjanek, N.; Margis-Pinheiro, M. Small heat shock proteins genes are differentially expressed in distinct varieties of common bean. J. Plant Physiol. 2003, 15, 33–41. [Google Scholar] [CrossRef] [Green Version]
- Dhaubhadel, S.; Browning, K.S.; Gallie, D.R.; Krishna, P. Brassinosteroid functions to protect the translational machinery and heat-shock protein synthesis following thermal stress. Plant J. 2002, 29, 681–691. [Google Scholar] [CrossRef]
- Krishna, P.; Sacco, M.; Cherutti, J.F.; Hill, S. Cold-Induced Accumulation of hsp90 Transcripts in Brassica napus. Plant Physiol. 1995, 107, 915–923. [Google Scholar] [CrossRef]
- Kagale, S.; Divi, U.K.; Krochko, J.E.; Keller, W.A.; Krishna, P. Brassinosteroid confers tolerance in Arabidopsis thaliana and Brassica napus to a range of abiotic stresses. Planta 2007, 225, 353–364. [Google Scholar] [CrossRef]
- Vítámvás, P.; Prášil, I.T.; Kosová, K.; Planchon, S.; Renaut, J. Analysis of proteome and frost tolerance in chromosome 5A and 5B reciprocal substitution lines between two winter wheats during long-term cold acclimation. Proteomics 2012, 12, 68–85. [Google Scholar] [CrossRef]
- Wang, Z.Y.; Nakano, T.; Gendron, J.M.; He, J.; Chen, M.; Vafeados, D.; Yang, Y.; Fujioka, S.; Yoshida, S.; Asami, T.; et al. Nuclear-localized BZR1 mediates brassinosteroid-induced growth and feedback suppression of brassinosteroid biosynthesis. Dev. Cell 2002, 2, 505–513. [Google Scholar] [CrossRef] [Green Version]
- Yin, Y.H.; Wang, Z.Y.; Mora-Garcia, S.; Li, J.M.; Yoshida, S.; Asami, T.; Chory, J. BES1 accumulates in the nucleus in response to brassionsteroids to regulate gene expression and promote stem elongation. Cell 2002, 109, 181–191. [Google Scholar] [CrossRef] [Green Version]
- He, J.X.; Gendron, J.M.; Sun, Y.; Gampala, S.S.; Gendron, N.; Sun, C.Q.; Wang, Z.Y. BZR1 is a transcriptional repressor with dual roles in brassinosteroid homeostasis and growth responses. Science 2005, 307, 1634–1638. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Milioni, D.; Franz, G.; Sung, R.; Hatzopoulos, P. Gene expression during heat-shock in embryogenic carrot cell lines. Plant Cell Tissue Organ Cult. 2001, 65, 221–228. [Google Scholar] [CrossRef]
- Pavli, O.I.; Ghikas, D.V.; Katsiotis, A.; Skaracis, G.N. Differential expression of heat shock protein genes in sorghum (Sorghum bicolor L.) genotypes under heat stress. Aust. J. Crop Sci. 2011, 5, 511–515. [Google Scholar]
- Mazorra, L.M.; Holton, N.; Bishop, G.J.; Núñez, M. Heat shock response in tomato brassinosteroid mutants indicates that thermotolerance is independent of brassinosteroid homeostasis. Plant Physiol. Biochem. 2011, 49, 1420–1428. [Google Scholar] [CrossRef]
- Dhaubhadel, S.; Chaudhary, S.; Dobinson, K.F.; Krishna, P. Treatment with 24-epibrassinolide, a brassinosteroid, increases the basic thermotolerance of Brassica napus and tomato seedlings. Plant Mol. Biol. 1999, 40, 333–342. [Google Scholar] [CrossRef]
- Lee, D.-G.; Ahsan, N.; Lee, S.-H.; Lee, J.J.; Bahk, J.D.; Kang, K.Y.; Lee, B.H. Chilling stress-induced proteomic changes in rice roots. J. Plant Physiol. 2009, 166, 1–11. [Google Scholar] [CrossRef]
- Dumont, E.; Bahrman, N.; Goulas, E.; Valot, B.; Sellier, H.; Hilbert, J.L.; Vuylsteker, C.; Lejeune-Hénaut, I.; Delbreil, B. A proteomic approach to decipher chilling response from cold acclimation in pea (Pisum sativum L.). Plant Sci. 2011, 180, 86–98. [Google Scholar] [CrossRef]
- Degand, H.; Faber, A.M.; Dauchot, N.; Mingeot, D.; Watillon, B.; Van Cutsem, P.; Morsomme, P.; Boutry, M. Proteomic analysis of chicory root identifies proteins typically involved in cold acclimation. Proteomics 2009, 9, 2903–2907. [Google Scholar] [CrossRef]
- Li, Q.B.; Haskell, D.W.; Guy, C.L. Coordinate and non-coordinate expression of the stress 70 family and other molecular chaperones at high and low temperature in spinach and tomato. Plant Mol. Biol. 1999, 39, 21–34. [Google Scholar] [CrossRef] [PubMed]
- Ré, M.D.; Gonzalez, C.; Escobar, M.R.; Sossi, M.L.; Valle, E.M.; Boggio, S.B. Small heat shock proteins and the postharvest chilling tolerance of tomato fruit. Physiol. Plant. 2017, 159, 148–160. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Zhao, C.M.; Wang, Y.J.; Liu, J. Overexpression of chloroplast-localized small molecular heat-shock protein enhances chilling tolerance in tomato plant. Zhi Wu Sheng Li Yu Fen Zi Sheng Wu Xue Xue Bao (J. Plant Physiol. Mol. Biol.) 2005, 31, 167–174. [Google Scholar]
- Hopf, N.; Plesofsky-Vig, N.; Brambl, R. The heat shock response of pollen and other tissues of maize. Plant Mol. Biol. 1992, 19, 623–630. [Google Scholar] [CrossRef]
- Malik, M.K.; Slovin, J.P.; Hwang, C.H.; Zimmerman, J.L. Modified expression of a carrot small heat shock protein gene, Hsp17.7, results in increased or decreased thermotolerance. Plant J. 1999, 20, 89–99. [Google Scholar] [CrossRef]
- Siddique, M.; Gernhard, S.; Von Koskull-Döring, P.; Vierling, E.; Scharf, K.D. The plant sHSP superfamily: Five new members in Arabidopsis thaliana with unexpected properties. Cell Stress Chaperones 2008, 13, 183–197. [Google Scholar] [CrossRef] [Green Version]
- Singh, I.; Shono, M. Physiological and molecular effects of 24-epibrassinolide, a brassinosteroid on thermotolerance of tomato. Plant Growth Regul. 2005, 47, 111–119. [Google Scholar] [CrossRef]
- Sommarin, M.; Lundborg, T.; Kylin, A. Comparison of K, MgATPases in purified plasmalemma from wheat and oat. – Substrate specificities and effects of pH, temperature and inhibitors. Physiol. Plant. 1985, 65, 27–32. [Google Scholar] [CrossRef]
- Janeczko, A.; Budziszewska, B.; Skoczowski, A.; Dybała, M. Specific binding sites for progesterone and 17β-estradiol in cells of Triticum aestivum L. Acta Biochim. Pol. 2008, 55, 707–711. [Google Scholar] [CrossRef]
- Jurczyk, B.; Rapacz, M.; Budzisz, K.; Barcik, W.; Sasal, M. The effects of cold, light and time of day during low-temperature shift on the expression of CBF6, FpCor14b and LOS2 in Festuca pratensis. Plant Sci. 2012, 183, 143–148. [Google Scholar] [CrossRef]
- An, Y.Q.; McDowell, J.M.; Huang, S.; McKinney, E.C.; Chambliss, S.; Meagher, R.B. Strong, constitutive expression of the Arabidopsis ACT2/ACT8 actin subclass in vegetative tissues. Plant J. 1996, 10, 107–121. [Google Scholar] [CrossRef] [PubMed]
- Sedmak, J.J.; Grossberg, S.E. A rapid, sensitive, and versatile assay for protein using Coomassie brilliant blue G250. Anal. Biochem. 1977, 79, 544–552. [Google Scholar] [CrossRef]
- Laemmli, U.K. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 1970, 227, 680–685. [Google Scholar] [CrossRef] [PubMed]
Gene Name | GenBank ID | Forward Primer | Reverse Primer | TaqMan MGB Probe |
---|---|---|---|---|
HSP17 | Y07844.1 | CGACACCTTCCGCTCCAT | CGGCCGTCTCGCTGTT | FAM–TCCCGGCGTTCTCT–MGB |
HSP18 | X64561.1 | CGTATTCGAGTCGGAGCCATT | TCACAACTGTATTTAGGCTGCAGAA | FAM–CTCGCACACACATCAA–MGB |
HSP70 | L32165.1 | CCTCAATGTGGCTAGGATCATCAAT | CCACCCCTCTTGTCCAAACC | FAM–CTGCTGCTGCTATTGC–MGB |
HSP90 | AY325266.1 | GTTCAAGGCTGTCCTGTTTGTTC | GTTGTTGGCCTTCTTCTTGTTGTC | FAM–CCCCTTCGACCTCTTC–MGB |
Actin | AY145451.1 | GCAACTGGGATGACATGGAGAAAAT | GCCACACGGAGCTCATTGTA | FAM–CTGGCATCACACTTTC–MGB |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sadura, I.; Libik-Konieczny, M.; Jurczyk, B.; Gruszka, D.; Janeczko, A. HSP Transcript and Protein Accumulation in Brassinosteroid Barley Mutants Acclimated to Low and High Temperatures. Int. J. Mol. Sci. 2020, 21, 1889. https://doi.org/10.3390/ijms21051889
Sadura I, Libik-Konieczny M, Jurczyk B, Gruszka D, Janeczko A. HSP Transcript and Protein Accumulation in Brassinosteroid Barley Mutants Acclimated to Low and High Temperatures. International Journal of Molecular Sciences. 2020; 21(5):1889. https://doi.org/10.3390/ijms21051889
Chicago/Turabian StyleSadura, Iwona, Marta Libik-Konieczny, Barbara Jurczyk, Damian Gruszka, and Anna Janeczko. 2020. "HSP Transcript and Protein Accumulation in Brassinosteroid Barley Mutants Acclimated to Low and High Temperatures" International Journal of Molecular Sciences 21, no. 5: 1889. https://doi.org/10.3390/ijms21051889