Oxylipin Profiles as Functional Characteristics of Acute Inflammatory Responses in Astrocytes Pre-Treated with IL-4, IL-10, or LPS
Abstract
1. Introduction
2. Results
2.1. Classical or Alternative Activation of Astrocytes in Culture
2.2. The Effect of Adaptations to Anti-Inflammatory Cytokines on an Acute Inflammatory Response
2.3. Oxylipin Profiles of Astrocytes with Different Adaptation States
3. Discussion
4. Materials and Methods
4.1. Reagents
4.2. Primary Cell Culture
4.3. Measurement of the Relative RNA Expression Level
4.4. UPLC-MS/MS Conditions and Sample Preparation
4.5. Determination of TNFα and IL-1β by Enzyme-Linked Immunoassay
4.6. Experimental Data Analysis and Statistics
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Abbreviations
AA | Arachidonic acid |
COX | Cyclooxygenase |
CYP450 | Cytochrome P450 monooxygenase |
DHA | Docosahexaenoic acid |
DiHOME | Dihydroxyoctadecamonoenoic acid |
HDoHE | Hydroxydocosahexaenoic acid |
HETE | Hydroxyeicosatetraenoic acid |
HODE | Hydroxyoctadecadienoic acid |
LA | Linoleic acid |
LOX | Lipoxygenase |
PG | Prostaglandin |
PUFAs | Polyunsaturated fatty acids |
UPLC-MS/MS | Ultra-performance liquid chromatography-tandem mass spectrometry |
References
- Mosser, D.M.; Edwards, J.P. Exploring the full spectrum of macrophage activation. Nat. Rev. Immunol. 2008, 8, 958–969. [Google Scholar] [CrossRef] [PubMed]
- Lawrence, T.; Natoli, G. Transcriptional regulation of macrophage polarization: Enabling diversity with identity. Nat. Rev. Immunol. 2011, 11, 750–761. [Google Scholar] [CrossRef] [PubMed]
- Serhan, C.N. Pro-resolving lipid mediators are leads for resolution physiology. Nature 2014, 510, 92–101. [Google Scholar] [CrossRef] [PubMed]
- Funk, C.D. Prostaglandins and leukotrienes: Advances in eicosanoid biology. Science 2001, 294, 1871–1875. [Google Scholar] [CrossRef] [PubMed]
- Gabbs, M.; Leng, S.; Devassy, J.G.; Monirujjaman, M.; Aukema, H.M. Advances in Our Understanding of Oxylipins Derived from Dietary PUFAs. Adv. Nutr. 2015, 6, 513–540. [Google Scholar] [CrossRef]
- Chistyakov, D.V.; Astakhova, A.A.; Sergeeva, M.G. Resolution of inflammation and mood disorders. Exp. Mol. Pathol. 2018, 105, 190–201. [Google Scholar] [CrossRef]
- Colson, C.; Ghandour, R.A.; Dufies, O.; Rekima, S.; Loubat, A.; Munro, P.; Boyer, L.; Pisani, D.F. Diet supplementation in ω3 polyunsaturated fatty acid favors an anti-inflammatory basal environment in mouse adipose tissue. Nutrients 2019, 11, 438. [Google Scholar] [CrossRef]
- Song, M.Y.; Wang, J.; Lee, Y.; Lee, J.; Kwon, K.S.; Bae, E.J.; Park, B.H. Enhanced M2 macrophage polarization in high n-3 polyunsaturated fatty acid transgenic mice fed a high-fat diet. Mol. Nutr. Food Res. 2016, 60, 2481–2492. [Google Scholar] [CrossRef]
- Joffre, C.; Rey, C.; Layé, S. N-3 polyunsaturated fatty acids and the resolution of neuroinflammation. Front. Pharmacol. 2019, 10, 1022. [Google Scholar] [CrossRef]
- Brown, G.C. The endotoxin hypothesis of neurodegeneration. J. Neuroinflammation 2019, 16, 180. [Google Scholar] [CrossRef]
- Farina, C.; Aloisi, F.; Meinl, E. Astrocytes are active players in cerebral innate immunity. Trends Immunol. 2007, 28, 138–145. [Google Scholar] [CrossRef] [PubMed]
- Sofroniew, M.V. Astrocyte barriers to neurotoxic inflammation. Nat. Rev. Neurosci. 2015, 16, 249–263. [Google Scholar] [CrossRef] [PubMed]
- Kim, S.U.; de Vellis, J. Microglia in health and disease. J. Neurosci. Res. 2005, 81, 302–313. [Google Scholar] [CrossRef] [PubMed]
- Jang, E.; Lee, S.; Kim, J.H.; Kim, J.H.; Seo, J.W.; Lee, W.H.; Mori, K.; Nakao, K.; Suk, K. Secreted protein lipocalin-2 promotes microglial M1 polarization. FASEB J. 2013, 27, 1176–1190. [Google Scholar] [CrossRef]
- Liddelow, S.A.; Barres, B.A. Reactive Astrocytes: Production, Function, and Therapeutic Potential. Immunity 2017, 46, 957–967. [Google Scholar] [CrossRef]
- Astakhova, A.; Chistyakov, D.; Thomas, D.; Geisslinger, G.; Brüne, B.; Sergeeva, M.; Namgaladze, D. Inhibitors of Oxidative Phosphorylation Modulate Astrocyte Inflammatory Responses through AMPK-Dependent Ptgs2 mRNA Stabilization. Cells 2019, 8, 1185. [Google Scholar] [CrossRef]
- Astakhova, A.A.; Chistyakov, D.V.; Sergeeva, M.G.; Reiser, G. Regulation of the ARE-binding proteins, TTP (tristetraprolin) and HuR (human antigen R), in inflammatory response in astrocytes. Neurochem. Int. 2018, 118, 82–90. [Google Scholar] [CrossRef]
- Chistyakov, D.V.; Azbukina, N.V.; Astakhova, A.A.; Polozhintsev, A.I.; Sergeeva, M.G.; Reiser, G. Toll-like receptors control p38 and JNK MAPK signaling pathways in rat astrocytes differently, when cultured in normal or high glucose concentrations. Neurochem. Int. 2019, 131, 104513. [Google Scholar] [CrossRef]
- Cunningham, C.; Dunne, A.; Lopez-Rodriguez, A.B. Astrocytes: Heterogeneous and Dynamic Phenotypes in Neurodegeneration and Innate Immunity. Neuroscientist 2019, 25, 455–474. [Google Scholar] [CrossRef]
- Chistyakov, D.V.; Azbukina, N.V.; Astakhova, A.A.; Goriainov, S.V.; Chistyakov, V.V.; Sergeeva, M.G. Sex-mediated differences in lps induced alterations of TNFα, IL-10 expression, and prostaglandin synthesis in primary astrocytes. Int. J. Mol. Sci. 2018, 19, 2793. [Google Scholar] [CrossRef]
- Font-Nieves, M.; Sans-Fons, M.G.; Gorina, R.; Bonfill-Teixidor, E.; Salas-Perdomo, A.; Marquez-Kisinousky, L.; Santalucia, T.; Planas, A.M.; Salas-Pérdomo, A.; Márquez-Kisinousky, L.; et al. Induction of COX-2 enzyme and down-regulation of COX-1 expression by lipopolysaccharide (LPS) control prostaglandin E2 production in astrocytes. J Biol. Chem. 2012, 287, 6454–6468. [Google Scholar] [CrossRef] [PubMed]
- Burda, J.E.; Sofroniew, M.V. Seducing astrocytes to the dark side. Cell Res. 2017, 27, 726–727. [Google Scholar] [CrossRef] [PubMed]
- Jang, E.; Kim, J.-H.; Lee, S.; Kim, J.-H.; Seo, J.-W.; Jin, M.; Lee, M.-G.; Jang, I.-S.; Lee, W.-H.; Suk, K. Phenotypic Polarization of Activated Astrocytes: The Critical Role of Lipocalin-2 in the Classical Inflammatory Activation of Astrocytes. J. Immunol. 2013, 191, 5204–5219. [Google Scholar] [CrossRef] [PubMed]
- Tarassishin, L.; Suh, H.S.; Lee, S.C. LPS and IL-1 differentially activate mouse and human astrocytes: Role of CD14. Glia 2014, 62, 999–1013. [Google Scholar] [CrossRef] [PubMed]
- Zamanian, J.L.; Xu, L.; Foo, L.C.; Nouri, N.; Zhou, L.; Giffard, R.G.; Barres, B.A. Genomic analysis of reactive astrogliosis. J. Neurosci. 2012, 32, 6391–6410. [Google Scholar] [CrossRef]
- Chistyakov, D.V.; Astakhova, A.A.; Azbukina, N.V.; Goriainov, S.V.; Chistyakov, V.V.; Sergeeva, M.G. Cellular Model of Endotoxin Tolerance in Astrocytes: Role of Interleukin 10 and Oxylipins. Cells 2019, 8, 1553. [Google Scholar] [CrossRef]
- Chistyakov, D.V.; Astakhova, A.A.; Azbukina, N.V.; Goriainov, S.V.; Chistyakov, V.V.; Sergeeva, M.G. High and Low Molecular Weight Hyaluronic Acid Differentially Influences Oxylipins Synthesis in Course of Neuroinflammation. Int. J. Mol. Sci. 2019, 20, 3894. [Google Scholar] [CrossRef]
- Hartmann, K.; Sepulveda-Falla, D.; Rose, I.V.L.; Madore, C.; Muth, C.; Matschke, J.; Butovsky, O.; Liddelow, S.; Glatzel, M.; Krasemann, S. Complement 3+-astrocytes are highly abundant in prion diseases, but their abolishment led to an accelerated disease course and early dysregulation of microglia. Acta Neuropathol. Commun. 2019, 7, 83. [Google Scholar] [CrossRef]
- López-Collazo, E.; del Fresno, C. Pathophysiology of endotoxin tolerance: Mechanisms and clinical consequences. Crit. Care 2013, 17, 242. [Google Scholar] [CrossRef]
- Rus, H.G.; Kim, L.M.; Niculescu, F.I.; Shin, M.L. Induction of C3 expression in astrocytes is regulated by cytokines and Newcastle disease virus. J. Immunol. 1992, 148, 928–933. [Google Scholar]
- Liddelow, S.A.; Guttenplan, K.A.; Clarke, L.E.; Bennett, F.C.; Bohlen, C.J.; Schirmer, L.; Bennett, M.L.; Münch, A.E.; Chung, W.S.; Peterson, T.C.; et al. Neurotoxic reactive astrocytes are induced by activated microglia. Nature 2017, 541, 481–487. [Google Scholar] [CrossRef] [PubMed]
- Puschmann, T.B.; Dixon, K.J.; Turnley, A.M. Species differences in reactivity of mouse and rat astrocytes in vitro. NeuroSignals 2011, 18, 152–163. [Google Scholar] [CrossRef] [PubMed]
- Ahlemeyer, B.; Kehr, K.; Richter, E.; Hirz, M.; Baumgart-Vogt, E.; Herden, C. Phenotype, differentiation, and function differ in rat and mouse neocortical astrocytes cultured under the same conditions. J. Neurosci. Methods 2013, 212, 156–164. [Google Scholar] [CrossRef] [PubMed]
- Clarke, L.E.; Liddelow, S.A.; Chakraborty, C.; Münch, A.E.; Heiman, M.; Barres, B.A. Normal aging induces A1-like astrocyte reactivity. Proc. Natl. Acad. Sci. USA 2018, 115, E1896–E1905. [Google Scholar] [CrossRef] [PubMed]
- Tarassishin, L.; Loudig, O.; Bauman, A.; Shafit-Zagardo, B.; Suh, H.S.; Lee, S.C. Interferon regulatory factor 3 inhibits astrocyte inflammatory gene expression through suppression of the proinflammatory miR-155 and miR-155. Glia 2011, 59, 1911–1922. [Google Scholar] [CrossRef]
- Von Boyen, G.B.T.; Steinkamp, M.; Reinshagen, M.; Schäfer, K.H.; Adler, G.; Kirsch, J. Proinflammatory cytokines increase glial fibrillary acidic protein expression in enteric glia. Gut 2004, 53, 222–228. [Google Scholar] [CrossRef]
- Derecki, N.C.; Cardani, A.N.; Yang, C.H.; Quinnies, K.M.; Crihfield, A.; Lynch, K.R.; Kipnis, J. Regulation of learning and memory by meningeal immunity: A key role for IL-4. J. Exp. Med. 2010, 207, 1067–1080. [Google Scholar] [CrossRef]
- Bélanger, M.; Allaman, I.; Magistretti, P.J. Differential effects of pro- and anti-inflammatory cytokines alone or in combinations on the metabolic profile of astrocytes. J. Neurochem. 2011, 116, 564–576. [Google Scholar] [CrossRef]
- Serhan, C.N.; Brain, S.D.; Buckley, C.D.; Gilroy, D.W.; Haslett, C.; O’Neill, L.A.J.; Perretti, M.; Rossi, A.G.; Wallace, J.L. Resolution of inflammation: State of the art, definitions and terms. FASEB J. 2007, 21, 325–332. [Google Scholar] [CrossRef]
- López-Vicario, C.; Rius, B.; Alcaraz-Quiles, J.; García-Alonso, V.; Lopategi, A.; Titos, E.; Clària, J. Pro-resolving mediators produced from EPA and DHA: Overview of the pathways involved and their mechanisms in metabolic syndrome and related liver diseases. Eur. J. Pharmacol. 2016, 785, 133–143. [Google Scholar] [CrossRef]
- Chistyakov, D.V.; Grabeklis, S.; Goriainov, S.V.; Chistyakov, V.V.; Sergeeva, M.G.; Reiser, G. Astrocytes synthesize primary and cyclopentenone prostaglandins that are negative regulators of their proliferation. Biochem. Biophys. Res. Commun. 2018, 500, 204–210. [Google Scholar] [CrossRef] [PubMed]
- Derogis, P.B.M.C.; Freitas, F.P.; Marques, A.S.F.; Cunha, D.; Appolinário, P.P.; de Paula, F.; Lourenço, T.C.; Murgu, M.; Di Mascio, P.; Medeiros, M.H.G.; et al. The Development of a Specific and Sensitive LC-MS-Based Method for the Detection and Quantification of Hydroperoxy- and Hydroxydocosahexaenoic Acids as a Tool for Lipidomic Analysis. PLoS ONE 2013, 8, e77561. [Google Scholar] [CrossRef] [PubMed]
- Yang, T.; Peng, R.; Guo, Y.; Shen, L.; Zhao, S.; Xu, D. The role of 14,15-dihydroxyeicosatrienoic acid levels in inflammation and its relationship to lipoproteins. Lipids Health Dis. 2013, 12, 151. [Google Scholar] [CrossRef] [PubMed]
- Terashvili, M.; Sarkar, P.; Nostrand, M.V.; Falck, J.R.; Harder, D.R. The protective effect of astrocyte-derived 14,15-epoxyeicosatrienoic acid on hydrogen peroxide-induced cell injury in astrocyte-dopaminergic neuronal cell line co-culture. Neuroscience 2012, 223, 68–76. [Google Scholar] [CrossRef] [PubMed]
- Vangaveti, V.; Baune, B.T.; Kennedy, R.L. Hydroxyoctadecadienoic acids: Novel regulators of macrophage differentiation and atherogenesis. Ther. Adv. Endocrinol. Metab. 2010, 1, 51–60. [Google Scholar] [CrossRef]
- Chung, S.W.; Kang, B.Y.; Kim, S.H.; Pak, Y.K.; Cho, D.; Trinchieri, G.; Kim, T.S. Oxidized low density lipoprotein inhibits interleukin-12 production in lipopolysaccharide-activated mouse macrophages via direct interactions between peroxisome proliferator-activated receptor-γ and nuclear factor-κB. J. Biol. Chem. 2000, 275, 32681–32687. [Google Scholar] [CrossRef]
Gene | Forward | Reverse |
---|---|---|
IL-1β | CACCTCTCAAGCAGAGCACAG | GGGTTCCATGGTGAAGTCAAC |
C3 | AAGCCCAACACCAGCTACATC | ACTTCTGATCCTGGCATTCTTCT |
GBP2 | CTCGACTGTGCATCAGGAAA | TAGGTCTGCACCAGGCTCT |
Cxcl10 | TGCAAGTCTATCCTGTCCGC | ACGGAGCTCTTTTTGACCTTC |
Mrc1 | CAACCAAAGCTGACCAAAGGAAG | TTGCCCATGAGATCTTTCGTGT |
Fizz1 | CAACAGGATGAAGACTGCAACCT | GGGACCATCAGCTAAAGAAG |
Ym1 | TTGCTGGGATGCGGAATAA | AGCTCAGTGTTCCTGTCTTTC |
iNOS | CCACAATAGTACAATACTACTTGG | ACGAGGTGTTCAGCGTGCTCCACG |
TNFα | CAAGGAGGAGAAGTTCCCAA | TGATCTGAGTGTGAGGGTCTG |
β-actin | AGATGACCCAGATCATGTTTGAG | GGCATACAGGGACAACACAG |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chistyakov, D.V.; Gavrish, G.E.; Goriainov, S.V.; Chistyakov, V.V.; Astakhova, A.A.; Azbukina, N.V.; Sergeeva, M.G. Oxylipin Profiles as Functional Characteristics of Acute Inflammatory Responses in Astrocytes Pre-Treated with IL-4, IL-10, or LPS. Int. J. Mol. Sci. 2020, 21, 1780. https://doi.org/10.3390/ijms21051780
Chistyakov DV, Gavrish GE, Goriainov SV, Chistyakov VV, Astakhova AA, Azbukina NV, Sergeeva MG. Oxylipin Profiles as Functional Characteristics of Acute Inflammatory Responses in Astrocytes Pre-Treated with IL-4, IL-10, or LPS. International Journal of Molecular Sciences. 2020; 21(5):1780. https://doi.org/10.3390/ijms21051780
Chicago/Turabian StyleChistyakov, Dmitry V., Gleb E. Gavrish, Sergei V. Goriainov, Viktor V. Chistyakov, Alina A. Astakhova, Nadezda V. Azbukina, and Marina G. Sergeeva. 2020. "Oxylipin Profiles as Functional Characteristics of Acute Inflammatory Responses in Astrocytes Pre-Treated with IL-4, IL-10, or LPS" International Journal of Molecular Sciences 21, no. 5: 1780. https://doi.org/10.3390/ijms21051780
APA StyleChistyakov, D. V., Gavrish, G. E., Goriainov, S. V., Chistyakov, V. V., Astakhova, A. A., Azbukina, N. V., & Sergeeva, M. G. (2020). Oxylipin Profiles as Functional Characteristics of Acute Inflammatory Responses in Astrocytes Pre-Treated with IL-4, IL-10, or LPS. International Journal of Molecular Sciences, 21(5), 1780. https://doi.org/10.3390/ijms21051780