Impact of Endotoxins in Gelatine Hydrogels on Chondrogenic Differentiation and Inflammatory Cytokine Secretion In Vitro
Abstract
1. Introduction
2. Results
2.1. Characterisation of Gelatines and GelMAs
2.2. MSC Cartilaginous Matrix Production
2.3. mRNA Expression
2.4. PBMC Cytokine Production
3. Discussion
3.1. Effect of Endotoxins
3.2. Effect of Gelatine Characteristics
3.3. Synthesis of Low-Endotoxin GelMA
3.4. Limitations
4. Materials and Methods
4.1. GelMA Synthesis
4.2. Determination of Degree of Methacrylation
4.3. Endotoxin Levels of the Gelatines and Synthesised GelMAs
4.4. Hydrogel Preparation—Cell Free
4.5. Mechanical Testing
4.6. Isolation and Expansion of Equine Mesenchymal Stromal Cells
4.7. MSC Encapsulation and Culture
4.8. Biochemical Analysis of Cultured GelMA-MSC Constructs
4.9. Histology and Immunohistochemistry
4.10. Equine PBMC Isolation and Culture
4.11. Biochemical Analysis of PBMC Culture
4.12. qRT-PCR
4.13. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Abbreviations
| ACPC | Articular cartilage progenitor cells |
| CCL2 | Chemokine (C-C motif) ligand 2 (also referred to as MCP1) |
| DM | Degree of methacrylation |
| ELISA | Enzyme-linked immunosorbent assay |
| FDA | The United States Food and Drug Administration |
| GAG | Glycosaminoglycan |
| GelMA | Gelatine methacryloyl |
| LPS | Lipopolysaccharide |
| MA | Methacrylic anhydride |
| MCP1 | Monocyte chemoattractant protein 1 (also referred to as CCL2) |
| MMP | Matrix metalloproteinase |
| MSC | Mesenchymal stem cell |
| Mw | Molecular weight |
| OA | Osteoarthritis |
| PAMP | Pathogen-associated molecular pattern |
| PBMC | Peripheral blood mononuclear cell |
| TLR | Toll-like receptor |
| TNF-α | Tumour necrosis factor alpha |
| UV | Ultraviolet |
Appendix A
| Primer | Forward | Reverse |
|---|---|---|
| HPRT1 | CAAGCTTGCTGGTGAAAAG | GGCATATCCTACGACAAACT |
| COL2A1 | GGCAATAGCAGGTTCACGTACA | CGATAACAGTCTTGCCCCACTT |
| COL1A1 | CGTGACCTCAAGATGTGC | AGAAGACCTTGATGGCGT |
| TLR4 | GGCACAGAAAATGCCAGGATG | GATGTGGGGATGTTCTCAGGG |
| MMP3 | AAATAGCAGAAGACTTTCCAGG | TCAAACTGTGAAGATCCACTG |
| MMP13 | CAAGGGATCCAGTCTCTCTATGGT | GGATAAGGAAGGGTCACATTTGTC |


References
- Felson, D.T. Osteoarthritis of the Knee. N. Engl. J. Med. 2006, 354, 841–848. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Levato, R.; Webb, W.R.; Otto, I.A.; Mensinga, A.; Zhang, Y.; Van Rijen, M.; Van Weeren, R.; Khan, I.M.; Malda, J. The bio in the ink: Cartilage regeneration with bioprintable hydrogels and articular cartilage-derived progenitor cells. Acta Biomater. 2017, 61, 41–53. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Klein, T.J.; Schumacher, B.L.; Schmidt, T.A.; Li, K.W.; Voegtline, M.S.; Masuda, K.; Thonar, E.-M.; Sah, R.L. Tissue engineering of stratified articular cartilage from chondrocyte subpopulations. Osteoarthr. Cartil. 2003, 11, 595–602. [Google Scholar] [CrossRef] [Scilit]
- Guo, X.; Park, H.; Young, S.; Kretlow, J.D.; Beucken, J.J.J.P.V.D.; Baggett, L.S.; Tabata, Y.; Kasper, F.K.; Mikos, A.G.; Jansen, J.A. Repair of osteochondral defects with biodegradable hydrogel composites encapsulating marrow mesenchymal stem cells in a rabbit model. Acta Biomater. 2010, 6, 39–47. [Google Scholar] [CrossRef] [Scilit]
- Daly, A.C.; Critchley, S.E.; Rencsok, E.M.; Kelly, D.J. A comparison of different bioinks for 3D bioprinting of fibrocartilage and hyaline cartilage. Biofabrication 2016, 8, 045002. [Google Scholar] [CrossRef] [Scilit]
- Mouser, V.H.M.; Levato, R.; Mensinga, A.; Dhert, W.J.A.; Gawlitta, D.; Malda, J. Bio-ink development for three-dimensional bioprinting of hetero-cellular cartilage constructs. Connect. Tissue Res. 2018, 61, 137–151. [Google Scholar] [CrossRef] [Scilit]
- Malda, J.; Visser, J.; Melchels, F.P.; Jüngst, T.; Hennink, W.E.; Dhert, W.J.A.; Groll, J.; Hutmacher, D.W. 25th Anniversary Article: Engineering Hydrogels for Biofabrication. Adv. Mater. 2013, 25, 5011–5028. [Google Scholar] [CrossRef] [Scilit]
- Van Vlierberghe, S.; Graulus, G.-J.; Samal, S.K.; Van Nieuwenhove, I.; Dubruel, P. Porous hydrogel biomedical foam scaffolds for tissue repair. In Biomedical Foams for Tissue Engineering Applications; Woodhead Publishing: Sawston, Cambridge, UK, 2014; pp. 335–390. [Google Scholar]
- Lim, K.S.; Schon, B.S.; Mekhileri, N.V.; Brown, G.C.J.; Chia, C.M.; Prabakar, S.; Hooper, G.J.; Woodfield, T.B.F. New Visible-Light Photoinitiating System for Improved Print Fidelity in Gelatin-Based Bioinks. ACS Biomater. Sci. Eng. 2016, 2, 1752–1762. [Google Scholar] [CrossRef] [Scilit]
- Bulcke, A.I.V.D.; Bogdanov, B.; De Rooze, N.; Schacht, E.H.; Cornelissen, M.; Berghmans, H. Structural and Rheological Properties of Methacrylamide Modified Gelatin Hydrogels. Biomacromolecules 2000, 1, 31–38. [Google Scholar] [CrossRef] [Scilit]
- Schuurman, W.; Levett, P.A.; Pot, M.W.; Van Weeren, P.R.; Dhert, W.J.A.; Hutmacher, D.W.; Melchels, F.P.W.; Klein, T.J.; Malda, J. Gelatin-Methacrylamide Hydrogels as Potential Biomaterials for Fabrication of Tissue-Engineered Cartilage Constructs. Macromol. Biosci. 2013, 13, 551–561. [Google Scholar] [CrossRef] [Scilit]
- Visser, J.; Melchels, F.P.; Jeon, J.E.; Van Bussel, E.M.; Kimpton, L.S.; Byrne, H.M.; Dhert, W.J.; Dalton, P.D.; Hutmacher, D.W.; Malda, J. Reinforcement of hydrogels using three-dimensionally printed microfibres. Nat. Commun. 2015, 6, 6933. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- De Ruijter, M.; Ribeiro, A.; Dokter, I.; Castilho, M.; Malda, J. Simultaneous Micropatterning of Fibrous Meshes and Bioinks for the Fabrication of Living Tissue Constructs. Adv. Heal. Mater. 2019, 8, e1800418. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Croes, M.; Oner, F.C.; Kruyt, M.C.; Blokhuis, T.J.; Bastian, O.; Dhert, W.J.A.; Alblas, J. Proinflammatory Mediators Enhance the Osteogenesis of Human Mesenchymal Stem Cells after Lineage Commitment. PLoS ONE 2015, 10, e0132781. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nomura, Y.; Fukui, C.; Morishita, Y.; Haishima, Y. A biological study establishing the endotoxin limit for in vitro proliferation of human mesenchymal stem cells. Regen. Ther. 2017, 7, 45–51. [Google Scholar] [CrossRef] [Scilit]
- Wheeler, A. Comparing endotoxin detection methods. Pharm. Technol. 2017, 41, 58–62. [Google Scholar]
- Huang, Z.; Stabler, T.; Pei, F.; Kraus, V.B. Both systemic and local lipopolysaccharide (LPS) burden are associated with knee OA severity and inflammation. Osteoarthr. Cartil. 2016, 24, 1769–1775. [Google Scholar] [CrossRef] [Scilit]
- Mendez, M.E.; Sebastian, A.; Murugesh, D.K.; Hum, N.R.; McCool, J.L.; Hsia, A.W.; Christiansen, B.A.; Loots, G.G. LPS-Induced Inflammation Prior to Injury Exacerbates the Development of Post-Traumatic Osteoarthritis in Mice. J. Bone Miner. Res. 2020, 1–13. [Google Scholar] [CrossRef] [Scilit]
- Lorenz, W.; Sigrist, G.; Shakibaei, M.; Mobasheri, A.; Trautmann, C. A hypothesis for the origin and pathogenesis of rheumatoid diseases. Rheumatol. Int. 2005, 26, 641–654. [Google Scholar] [CrossRef] [Scilit]
- Magalhães, P.O.; Lopes, A.M.; Mazzola, P.G.; Rangel-Yagui, C.; Penna, T.C.V.; Pessoa, A.J. Methods of endotoxin removal from biological preparations: A review. J. Pharm. Pharmaceut. Sci. 2007, 10, 388–404. [Google Scholar]
- U.S. Food and Drug Administration Guidance for Industry Pyrogen and Endotoxins Testing: Questions and Answers. 2012. Available online: www.fda.gov/regulatory-information/search-fda-guidance-documents/guidance-industry-pyrogen-and-endotoxins-testing-questions-and-answers (accessed on 12 February 2020).
- Malyala, P.; Singh, M. Endotoxin Limits in Formulations for Preclinical Research. J. Pharm. Sci. 2008, 97, 2041–2044. [Google Scholar] [CrossRef] [Scilit]
- He, X.; Wang, H.; Jin, T.; Xu, Y.; Mei, L.; Yang, J. TLR4 Activation Promotes Bone Marrow MSC Proliferation and Osteogenic Differentiation via Wnt3a and Wnt5a Signaling. PLoS ONE 2016, 11, e0149876. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Croes, M.; Öner, F.C.; Van Neerven, D.; Sabir, E.; Kruyt, M.C.; Blokhuis, T.J.; Dhert, W.J.A.; Alblas, J. Proinflammatory T cells and IL-17 stimulate osteoblast differentiation. Bone 2016, 84, 262–270. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nichol, J.W.; Koshy, S.T.; Bae, H.; Hwang, C.M.; Yamanlar, S.; Khademhosseini, A. Cell-laden microengineered gelatin methacrylate hydrogels. Biomaterials 2010, 31, 5536–5544. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Klotz, B.J.; Gawlitta, D.; Rosenberg, A.J.; Malda, J.; Melchels, F.P. Gelatin-Methacryloyl Hydrogels: Towards Biofabrication-Based Tissue Repair. Trends Biotechnol. 2016, 34, 394–407. [Google Scholar] [CrossRef] [Scilit]
- Zhu, M.; Wang, Y.; Ferracci, G.; Zheng, J.; Cho, N.-J.; Lee, B.H. Gelatin methacryloyl and its hydrogels with an exceptional degree of controllability and batch-to-batch consistency. Sci. Rep. 2019, 9, 1–13. [Google Scholar] [CrossRef] [Scilit]
- Noshadi, I.; Hong, S.; Sullivan, K.E.; Sani, E.S.; Portillo-Lara, R.; Tamayol, A.; Shin, S.R.; Gao, A.E.; Stoppel, W.L.; Iii, L.D.B.; et al. In vitro and in vivo analysis of visible light crosslinkable gelatin methacryloyl (GelMA) hydrogels. Biomater. Sci. 2017, 5, 2093–2105. [Google Scholar] [CrossRef] [Scilit]
- Spencer, A.R.; Sani, E.S.; Soucy, J.R.; Corbet, C.C.; Primbetova, A.; Koppes, R.A.; Annabi, N. Bioprinting of a Cell-Laden Conductive Hydrogel Composite. ACS Appl. Mater. Interfaces 2019, 11, 30518–30533. [Google Scholar] [CrossRef] [Scilit]
- De Paula, M.M.M.; Bassous, N.J.; Afewerki, S.; Harb, S.V.; Ghannadian, P.; Marciano, F.R.; Viana, B.C.; Tim, C.R.; Webster, T.J.; Lobo, A.O. Understanding the impact of crosslinked PCL/PEG/GelMA electrospun nanofibers on bactericidal activity. PLoS ONE 2018, 13, e0209386. [Google Scholar] [CrossRef] [Scilit]
- Lorenz, W.; Buhrmann, C.; Mobasheri, A.; Lueders, C.; Shakibaei, M. Bacterial lipopolysaccharides form procollagen-endotoxin complexes that trigger cartilage inflammation and degeneration: Implications for the development of rheumatoid arthritis. Arthritis Res. Ther. 2013, 15, R111. [Google Scholar] [CrossRef] [Scilit]
- Vassalli, P. The pathophysiology of tumor necrosis factors. Annu. Rev. Immunol. 1992, 411–452. [Google Scholar] [CrossRef]
- Varfolomeev, E.; Vucic, D. Intracellular regulation of TNF activity in health and disease. Cytokine 2018, 101, 26–32. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Murphy, J.M.; Dixon, K.; Beck, S.; Fabian, D.; Feldman, A.; Barry, F. Reduced chondrogenic and adipogenic activity of mesenchymal stem cells from patients with advanced osteoarthritis. Arthritis Rheum. 2002, 46, 704–713. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fernandes, J.C.; Martel-Pelletier, J.; Pelletier, J.-P. The role of cytokines in osteoarthritis pathophysiology. Biorheology 2002, 39, 237–246. [Google Scholar] [PubMed]
- Smith, M.D.; Triantafillou, S.; Parker, A.; Youssef, P.P.; Coleman, M. Synovial membrane inflammation and cytokine production in patients with early osteoarthritis. J. Rheumatol. 1997, 24, 365–371. [Google Scholar] [PubMed]
- Rantapää-Dahlqvist, S.; Boman, K.; Tarkowski, A.; Hallmans, G. Up regulation of monocyte chemoattractant protein-1 expression in anti-citrulline antibody and immunoglobulin M rheumatoid factor positive subjects precedes onset of inflammatory response and development of overt rheumatoid arthritis. Ann. Rheum. Dis. 2006, 66, 121–123. [Google Scholar] [CrossRef] [Scilit]
- Raghu, H.; Lepus, C.M.; Wang, Q.; Wong, H.H.; Lingampalli, N.; Oliviero, F.; Punzi, L.; Giori, N.J.; Goodman, S.B.; Chu, C.R.; et al. CCL2/CCR2, but not CCL5/CCR5, mediates monocyte recruitment, inflammation and cartilage destruction in osteoarthritis. Ann. Rheum. Dis. 2017, 76, 914–922. [Google Scholar] [CrossRef] [Scilit]
- Scotti, C.; Gobbi, A.; Karnatzikos, G.; Martin, I.; Shimomura, K.; Lane, J.G.; Peretti, G.M.; Nakamura, N. Cartilage Repair in the Inflamed Joint: Considerations for Biological Augmentation Toward Tissue Regeneration. Tissue Eng. Part B Rev. 2016, 22, 149–159. [Google Scholar] [CrossRef] [Scilit]
- Sitcheran, R.; Cogswell, P.C.; Baldwin, J.A.S. NF-κB mediates inhibition of mesenchymal cell differentiation through a posttranscriptional gene silencing mechanism. Genes Dev. 2003, 17, 2368–2373. [Google Scholar] [CrossRef] [Scilit]
- Saklatvala, J. Tumour necrosis factor α stimulates resorption and inhibits synthesis of proteoglycan in cartilage. Nat. Cell Biol. 1986, 322, 547–549. [Google Scholar] [CrossRef] [Scilit]
- Appleton, C.; Usmani, S.E.; Pest, M.; Pitelka, V.; Mort, J.S.; Beier, F. Reduction in Disease Progression by Inhibition of Transforming Growth Factor α-CCL2 Signaling in Experimental Posttraumatic Osteoarthritis. Arthritis Rheumatol. 2015, 67, 2691–2701. [Google Scholar] [CrossRef] [Scilit]
- Hoon, L.B.; Lum, N.; Seow, L.Y.; Lim, P.Q.; Tan, L.P. Synthesis and Characterization of Types A and B Gelatin Methacryloyl for Bioink Applications. Materials 2016, 9, 797. [Google Scholar] [CrossRef] [Scilit]
- Zhang, L.; Yu, M.; Deng, J.; Lv, X.; Liu, J.; Xiao, Y.; Yang, W.; Zhang, Y.; Li, C. Chemokine Signaling Pathway Involved in CCL2 Expression in Patients with Rheumatoid Arthritis. Yonsei Med. J. 2015, 56, 1134–1142. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Malda, J.; De Grauw, J.C.; Benders, K.E.M.; Kik, M.J.L.; Van De Lest, C.H.A.; Creemers, L.B.; Dhert, W.J.; Van Weeren, P.R. Of Mice, Men and Elephants: The Relation between Articular Cartilage Thickness and Body Mass. PLoS ONE 2013, 8, e57683. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Frisbie, D.D.; Cross, M.W.; McIlwraith, C. A comparative study of articular cartilage thickness in the stifle of animal species used in human pre-clinical studies compared to articular cartilage thickness in the human knee. Veter- Comp. Orthop. Traumatol. 2006, 19, 142–146. [Google Scholar] [CrossRef] [Scilit]
- Kojima, T.; Koide, T.; Nagata, H.; Paeng, N.; Sano, M.; Sasanabe, R.; Horikoshi, I.; Ito, N.; Hasegawa, M. In Vitro Effect of Gelatins on Murine Cell Proliferation. Cancer Biotherapy Radiopharm. 2001, 16, 431–437. [Google Scholar] [CrossRef] [Scilit]
- Koide, T.; Nagata, H.; Kojima, T.; Sano, M.; Sasanabe, R.; Horikoshi, I.; Ito, N.; Hasegawa, M. Comparison between Bovine Bone and Porcine Skin Gelatins in their Effects on Murine Cell Proliferation. Cancer Biotherapy Radiopharm. 2002, 17, 371–377. [Google Scholar] [CrossRef] [Scilit]
- Audette, R.V.; Lavoie-Lamoureux, A.; Lavoie, J.-P.; Laverty, S. Inflammatory stimuli differentially modulate the transcription of paracrine signaling molecules of equine bone marrow multipotent mesenchymal stromal cells. Osteoarthr. Cartil. 2013, 21, 1116–1124. [Google Scholar] [CrossRef] [Scilit]
- Shirjang, S.; Mansoori, B.; Solali, S.; Hagh, M.F.; Shamsasenjan, K. Toll-like receptors as a key regulator of mesenchymal stem cell function: An up-to-date review. Cell. Immunol. 2017, 315, 1–10. [Google Scholar] [CrossRef] [Scilit]
- Waterman, R.S.; Tomchuck, S.L.; Henkle, S.L.; Betancourt, A.M. A New Mesenchymal Stem Cell (MSC) Paradigm: Polarization into a Pro-Inflammatory MSC1 or an Immunosuppressive MSC2 Phenotype. PLoS ONE 2010, 5, e10088. [Google Scholar] [CrossRef] [Scilit]
- Ruhl, T.; Kim, B.-S.; Beier, J.P. Cannabidiol restores differentiation capacity of LPS exposed adipose tissue mesenchymal stromal cells. Exp. Cell Res. 2018, 370, 653–662. [Google Scholar] [CrossRef] [Scilit]
- Cortés-Araya, Y.; Amilon, K.; Rink, B.E.; Black, G.; Lisowski, Z.; Donadeu, F.X.; Esteves, C.L. Comparison of Antibacterial and Immunological Properties of Mesenchymal Stem/Stromal Cells from Equine Bone Marrow, Endometrium, and Adipose Tissue. Stem Cells Dev. 2018, 27, 1518–1525. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Russell, A.; Zubair, A. Effect of Co-Medications and Endotoxins on Mesenchymal Stem Cell Characteristics. Cytotherapy 2016, 18, S129. [Google Scholar] [CrossRef] [Scilit]
- Gelatin Manufacturers Institute of America, Gelatin Handbook. Available online: http://www.gelatin-gmia.com/uploads/1/1/8/4/118450438/gmia_gelatin_manual_2019.pdf (accessed on 1 March 2020).
- Sewald, L.; Claaßen, C.; Götz, T.; Claaßen, M.H.; Truffault, V.; Tovar, G.E.M.; Southan, A.; Borchers, K. Beyond the Modification Degree: Impact of Raw Material on Physicochemical Properties of Gelatin Type A and Type B Methacryloyls. Macromol. Biosci. 2018, 18, e1800168. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mousavi, S.J.; Doweidar, M.H. Role of Mechanical Cues in Cell Differentiation and Proliferation: A 3D Numerical Model. PLoS ONE 2015, 10, e0124529. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Olivares-Navarrete, R.; Lee, E.M.; Smith, K.; Hyzy, S.L.; Doroudi, M.; Williams, J.K.; Gall, K.; Boyan, B.D.; Schwartz, Z. Substrate Stiffness Controls Osteoblastic and Chondrocytic Differentiation of Mesenchymal Stem Cells without Exogenous Stimuli. PLoS ONE 2017, 12, e0170312. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Park, J.S.; Chu, J.S.; Tsou, A.D.; Diop, R.; Tang, Z.; Wang, A.; Li, S. The effect of matrix stiffness on the differentiation of mesenchymal stem cells in response to TGF-β. Biomaterials 2011, 32, 3921–3930. [Google Scholar] [CrossRef] [Scilit]
- Olijve, J.H.; Vergauwen, B.; Stevens, P. Gelatin Purification. WO Patent 2016-085345A1, 2 June 2016. [Google Scholar]
- Kanayama, Y.; Aoki, C.; Sakai, Y. Development of low endotoxin gelatin for regenerative medicine. Biol. Pharm. Bull. 2007, 30, 237–241. [Google Scholar] [CrossRef] [Scilit]
- Su, W.; Ding, X. Methods of Endotoxin Detection. J. Lab. Autom. 2015, 20, 354–364. [Google Scholar] [CrossRef] [Scilit]
- Donaldson, A.R.; Tanase, C.E.; Awuah, D.; Bathrinarayanan, P.V.; Hall, L.; Nikkhah, M.; Khademhosseini, A.; Rose, F.; Alexander, C.; Ghaemmaghami, A.M. Photocrosslinkable Gelatin Hydrogels Modulate the Production of the Major Pro-inflammatory Cytokine, TNF-α, by Human Mononuclear Cells. Front. Bioeng. Biotechnol. 2018, 6, 116. [Google Scholar] [CrossRef] [Scilit]
- Melchels, F.P.; Dhert, W.J.A.; Hutmacher, D.W.; Malda, J. Development and characterisation of a new bioink for additive tissue manufacturing. J. Mater. Chem. B 2014, 2, 2282–2289. [Google Scholar] [CrossRef] [Scilit]
- Hoch, E.; Hirth, T.; Tovar, G.E.M.; Borchers, K. Chemical tailoring of gelatin to adjust its chemical and physical properties for functional bioprinting. J. Mater. Chem. B 2013, 1, 5675–5685. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Farndale, R.W.; Buttle, D.J.; Barrett, A.J. Improved quantitation and discrimination of sulphated glycosaminoglycans by use of dimethylmethylene blue. Biochim. Biophys. Acta BBA Gen. Subj. 1986, 883, 173–177. [Google Scholar] [CrossRef] [Scilit]
- Chen, Y.; Sonnaert, M.; Roberts, S.J.; Luyten, F.P.; Schrooten, J. Validation of a PicoGreen-Based DNA Quantification Integrated in an RNA Extraction Method for Two-Dimensional and Three-Dimensional Cell Cultures. Tissue Eng. Part C Methods 2012, 18, 444–452. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhao, S.; Fernald, R.D. Comprehensive Algorithm for Quantitative Real-Time Polymerase Chain Reaction. J. Comput. Biol. 2005, 12, 1047–1064. [Google Scholar] [CrossRef] [Scilit]



Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Groen, W.M.G.A.C.; Utomo, L.; Castilho, M.; Gawlitta, D.; Malda, J.; Weeren, P.R.v.; Levato, R.; Korthagen, N.M. Impact of Endotoxins in Gelatine Hydrogels on Chondrogenic Differentiation and Inflammatory Cytokine Secretion In Vitro. Int. J. Mol. Sci. 2020, 21, 8571. https://doi.org/10.3390/ijms21228571
Groen WMGAC, Utomo L, Castilho M, Gawlitta D, Malda J, Weeren PRv, Levato R, Korthagen NM. Impact of Endotoxins in Gelatine Hydrogels on Chondrogenic Differentiation and Inflammatory Cytokine Secretion In Vitro. International Journal of Molecular Sciences. 2020; 21(22):8571. https://doi.org/10.3390/ijms21228571
Chicago/Turabian StyleGroen, Wilhelmina M. G. A. C., Lizette Utomo, Miguel Castilho, Debby Gawlitta, Jos Malda, P. René van Weeren, Riccardo Levato, and Nicoline M. Korthagen. 2020. "Impact of Endotoxins in Gelatine Hydrogels on Chondrogenic Differentiation and Inflammatory Cytokine Secretion In Vitro" International Journal of Molecular Sciences 21, no. 22: 8571. https://doi.org/10.3390/ijms21228571
APA StyleGroen, W. M. G. A. C., Utomo, L., Castilho, M., Gawlitta, D., Malda, J., Weeren, P. R. v., Levato, R., & Korthagen, N. M. (2020). Impact of Endotoxins in Gelatine Hydrogels on Chondrogenic Differentiation and Inflammatory Cytokine Secretion In Vitro. International Journal of Molecular Sciences, 21(22), 8571. https://doi.org/10.3390/ijms21228571

