Effect of Acute and Prolonged Inflammation on the Gene Expression of Proinflammatory Cytokines and Their Receptors in the Anterior Pituitary Gland of Ewes
Abstract
1. Introduction
2. Results
2.1. Influence of Acute and Prolonged Inflammation on IL1B, IL1R1 and IL1R2 Gene Expression
2.2. Influence of Acute and Prolonged Inflammation on IL-6, IL-6R and IL-6ST Gene Expression
2.3. Influence of Acute and Prolonged Inflammation on TNF, TNFRSF1A and TNFRSF1A Gene Expression
2.4. Influence of Acute and Prolonged Inflammation on LHβ, FSHβ and GnRHR Gene Expression
2.5. Influence of Acute and Prolonged Inflammation on LH and FSH Concentration in Blood
3. Discussion
4. Materials and Methods
4.1. Animals and Experimental Design
4.2. Determination of the Relative Gene Expression
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
Abbreviations
| ACTH | Adrenocorticotropic hormone |
| AP | Anterior pituitary |
| FS | Folliculo-stellate cells |
| FSH | Follicle-stimulating hormone |
| GH | Growth hormone |
| GnRH | Gonadotropin-releasing hormone |
| IL | Interleukin |
| LH | Luteinizing hormone |
| LPS | Lipopolisaccaride S |
| TNF | Tumor necrosis factor |
| TSH | Thyroid-stimulating hormone |
| PT | Pars Tuberalis |
References
- Daniel, J.A.; Abrams, M.S.; de Souza, L.; Wagner, C.G.; Whitlock, B.K.; Sartin, J.L. Endotoxin inhibition of luteinizing hormone in sheep. Domest. Anim. Endocrinol. 2003, 25, 13–19. [Google Scholar] [CrossRef] [Scilit]
- Danek, J.; Żurek, U. Changes in Domestic Animals after Endotoxin Administration a Review. Ann. Anim. Sci. 2014, 14, 479–489. [Google Scholar] [CrossRef] [Scilit]
- Igaz, P.; Salvi, R.; Rey, J.-P.; Glauser, M.; Pralong, F.P.; Gaillard, R.C. Effects of Cytokines on Gonadotropin-Releasing Hormone (GnRH) Gene Expression in Primary Hypothalamic Neurons and in GnRH Neurons Immortalized Conditionally. Endocrinology 2006, 147, 1037–1043. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yoo, M.-J.; Nishihara, M.; Takahashi, M. Involvement of Prostaglandins in Suppression of Gonadotropin-Releasing Hormone Pulse Generator Activity by Tumor Necrosis Factor-α. J. Reprod. Dev. 1997, 43, 181–187. [Google Scholar] [CrossRef] [Scilit]
- Herman, A.P.; Krawczyńska, A.; Bochenek, J.; Dobek, E.; Herman, A.; Tomaszewska-Zaremba, D. LPS-Induced Inflammation Potentiates the IL-1-Mediated Reduction of LH Secretion from the Anterior Pituitary Explants. Clin. Dev. Immunol. 2013, 2013, 926937. [Google Scholar] [CrossRef] [Scilit]
- Herman, A.; Romanowicz, K.; Tomaszewska-Zaremba, D. Effect of LPS on Reproductive System at the Level of the Pituitary of Anestrous Ewes: Effect of LPS on Reproductive System at the Pituitary Level. Reprod. Domest. Anim. 2010, 45, e351–e359. [Google Scholar] [CrossRef] [Scilit]
- Tsagarakis, S. The role of cytokines in the normal and neoplastic pituitary. Crit. Rev. Oncol. Hematol. 1998, 28, 73–90. [Google Scholar] [CrossRef] [Scilit]
- Refojo, D.; Arias, P.; Moguilevsky, J.A.; Feleder, C. Effect of Bacterial Endotoxin on in vivo Pulsatile Gonadotropin Secretion in Adult Male Rats. Neuroendocrinology 1998, 67, 275–281. [Google Scholar] [CrossRef] [Scilit]
- Williams, C.Y.; Harris, T.G.; Battaglia, D.F.; Viguie, C.; Karsch, F.J. Endotoxin Inhibits Pituitary Responsiveness to Gonadotropin-Releasing Hormone. Endocrinology 2001, 142, 8. [Google Scholar] [CrossRef]
- Herman, A.; Kopycińska, K.; Krawczyńska, A.; Romanowicz, K.; Tomaszewska-Zaremba, D. The effect of repeated endotoxin injections on gonadotropin secretion in ewes. J. Anim. Feed Sci. 2014, 23, 217–221. [Google Scholar] [CrossRef] [Scilit]
- Xiao, E.; Xia-Zhang, L.; Barth, A.; Zhu, J.; Ferin, M. Stress and the Menstrual Cycle: Relevance of Cycle Quality in the Short- and Long-Term Response to a 5-Day Endotoxin Challenge during the Follicular Phase in the Rhesus Monkey. J. Clin. Endocrinol. Metab. 1998, 83, 7. [Google Scholar] [CrossRef] [Scilit]
- Herman, A.; Misztal, T.; Romanowicz, K.; Tomaszewska-Zaremba, D. Central Injection of Exogenous IL-1β in the Control Activities of Hypothalamic-Pituitary-Gonadal Axis in Anestrous Ewes: IL-1β Modulates the HPG Axis in Ewes. Reprod. Domest. Anim. 2012, 47, 44–52. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Spangelo, B.L.; Judd, A.M.; Isakson, P.C.; Macleod, R.M. Interleukin-6 stimulates anterior pituitary hormone release in vitro. Endocrinology 1989, 125, 575–577. [Google Scholar] [CrossRef] [Scilit]
- Król, K.; Tomaszewska-Zaremba, D.; Herman, A. Photoperiod-dependent effect of inflammation on nocturnal gene expression of proinflammatory cytokines and their receptors in pars tuberalis of ewe. J. Anim. Feed Sci. 2016, 25, 3–11. [Google Scholar] [CrossRef] [Scilit]
- Takao, T.; Culp, S.G.; De Souza, E.B. Reciprocal modulation of interleukin-1 beta (IL-1 beta) and IL-1 receptors by lipopolysaccharide (endotoxin) treatment in the mouse brain-endocrine-immune axis. Endocrinology 1993, 132, 1497–1504. [Google Scholar] [CrossRef] [Scilit]
- Scheerlinck, J.-P.Y.; Snibson, K.J.; Bowles, V.M.; Sutton, P. Biomedical applications of sheep models: From asthma to vaccines. Trends Biotechnol. 2008, 26, 259–266. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Entrican, G.; Wattegedera, S.R.; Griffiths, D.J. Exploiting ovine immunology to improve the relevance of biomedical models. Mol. Immunol. 2015, 66, 68–77. [Google Scholar] [CrossRef] [Scilit]
- Pitossi, F.; del Rey, A.; Kabiersch, A.; Besedovsky, H. Induction of cytokine transcripts in the central nervous system and pituitary following peripheral administration of endotoxin to mice. J. Neurosci. Res. 1997, 48, 287–298. [Google Scholar] [CrossRef] [Scilit]
- Whiteside, M.; Quan, N.; Herkenharn, M. Induction of Pituitary Cytokine Transcripts by Peripheral Lipopolysaccharide. J. Neuroendocrinol. 1999, 11, 115–120. [Google Scholar] [CrossRef] [Scilit]
- Jovanović, I.; Ugrenović, S.; Ljubomirović, M.; Vasović, L.; Čukuranović, R.; Stefanović, V. Folliculo-stellate cells—Potential mediators of the inflammaging-induced hyperactivity of the hypothalamic–pituitary–adrenal axis in healthy elderly individuals. Med. Hypotheses 2014, 83, 501–505. [Google Scholar] [CrossRef] [Scilit]
- Vankelecom, H.; Carmeliet, P.; Van Damme, J.; Billiau, A.; Denef, C. Production of Interleukin-6 by Folliculo-Stellate Cells of the Anterior Pituitary Gland in a Histiotypic Cell Aggregate Culture System. Neuroendocrinology 1989, 49, 102–106. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Koenig, J.I.; Snow, K.; Clark, B.D.; Toni, R.; Cannon, J.G.; Shaw, A.R.; Dinarello, C.A.; Reichlin, S.; Lee, S.L.; Lecha, R.M. Intrinsic Pituitary Interleukin-1β Is Induced by Bacterial Lipopolysaccharide. Endocrinology 1990, 126, 3053–3058. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gabay, C.; Kushner, I. Acute-phase proteins and other systemic responses to inflammation. N. Engl. J. Med. 1999, 340, 448–454. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Skelly, D.T.; Hennessy, E.; Dansereau, M.-A.; Cunningham, C. A Systematic Analysis of the Peripheral and CNS Effects of Systemic LPS, IL-1Β, TNF-α and IL-6 Challenges in C57BL/6 Mice. PLoS ONE 2013, 8, e69123. [Google Scholar] [CrossRef] [Scilit]
- Ulich, T.R.; Watson, L.R.; Guo, K.; Wang, P.; Thang, H. The Intratracheal Administration of Endotoxin and Cytokines. Am. J. Pathol. 1991, 138, 12. [Google Scholar] [CrossRef] [Scilit]
- Geisterfer, M.; Richards, C.; Baumann, M.; Fey, G.; Gywnne, D.; Gauldie, J. Regulation of IL-6 and the hepatic IL-6 receptor in acute inflammation in vivo. Cytokine 1993, 5, 1–7. [Google Scholar] [CrossRef] [Scilit]
- Li, L.; Duan, C.; Zhao, Y.; Zhang, X.; Yin, H.; Wang, T.; Huang, C.; Liu, S.; Yang, S.; Li, X. Preventive effects of interleukin-6 in lipopolysaccharide/ d -galactosamine induced acute liver injury via regulating inflammatory response in hepatic macrophages. Int. Immunopharmacol. 2017, 51, 99–106. [Google Scholar] [CrossRef] [Scilit]
- Wójcik, M.; Herman, A.P.; Zieba, D.A.; Krawczyńska, A. The Impact of Photoperiod on the Leptin Sensitivity and Course of Inflammation in the Anterior Pituitary. IJMS 2020, 21, 4153. [Google Scholar] [CrossRef] [Scilit]
- Herman, A.P.; Krawczyńska, A.; Bochenek, J.; Antushevich, H.; Herman, A.; Tomaszewska-Zaremba, D. Peripheral Injection of SB203580 Inhibits the Inflammatory-Dependent Synthesis of Proinflammatory Cytokines in the Hypothalamus. Biomed. Res. Int. 2014, 2014, 1–10. [Google Scholar] [CrossRef] [Scilit]
- Erickson, M.A.; Banks, W.A. Cytokine and chemokine responses in serum and brain after single and repeated injections of lipopolysaccharide: Multiplex quantification with path analysis. Brain Behav. Immun. 2011, 25, 1637–1648. [Google Scholar] [CrossRef] [Scilit]
- Kalliolias, G.D.; Ivashkiv, L.B. TNF biology, pathogenic mechanisms and emerging therapeutic strategies. Nat. Rev. Rheumatol. 2016, 12, 49–62. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kaplan, N.M.; Palmer, B.F.; Reimold, A.M. New Indications for Treatment of Chronic Inflammation by TNF-α Blockade. Am. J. Med. Sci. 2003, 325, 75–92. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kontoyiannis, D.; Pasparakis, M.; Pizarro, T.T.; Cominelli, F.; Kollias, G. Impaired On/Off Regulation of TNF Biosynthesis in Mice Lacking TNF AU-Rich Elements. Immunity 1999, 10, 387–398. [Google Scholar] [CrossRef] [Scilit]
- Wong, M.; Ziring, D.; Korin, Y.; Desai, S.; Kim, S.; Lin, J.; Gjertson, D.; Braun, J.; Reed, E.; Singh, R.R. TNFα blockade in human diseases: Mechanisms and future directions. Clin. Immunol. 2008, 126, 121–136. [Google Scholar] [CrossRef] [Scilit]
- Wong, M.-L.; Bongiorno, P.B.; Rettori, V.; McCann, S.M.; Licinio, J. Interleukin (IL) 1, IL-1 receptor antagonist, IL-10, and IL-13 gene expression in the central nervous system and anterior pituitary during systemic inflammation: Pathophysiological implications. Proc. Natl. Acad. Sci. USA 1997, 94, 227–232. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kuno, K.; Matsushima, K. The IL-1 receptor signaling pathway. J. Leukoc. Biol. 1994, 56, 542–547. [Google Scholar] [CrossRef] [Scilit]
- Scheller, J.; Garbers, C.; Rose-John, S. Interleukin-6: From basic biology to selective blockade of pro-inflammatory activities. Semin. Immunol. 2014, 26, 2–12. [Google Scholar] [CrossRef] [Scilit]
- Rose-John, S. Interleukin-6 biology is coordinated by membrane-bound and soluble receptors: Role in inflammation and cancer. J. Leukoc. Biol. 2006, 80, 227–236. [Google Scholar] [CrossRef] [Scilit]
- Probert, L. TNF and its receptors in the CNS: The essential, the desirable and the deleterious effects. Neuroscience 2015, 302, 2–22. [Google Scholar] [CrossRef] [Scilit]
- Haedo, M.R.; Gerez, J.; Fuertes, M.; Giacomini, D.; Páez-Pereda, M.; Labeur, M.; Renner, U.; Stalla, G.K.; Arzt, E. Regulation of pituitary function by cytokines. Horm. Res. 2009, 72, 266–274. [Google Scholar] [CrossRef] [Scilit]
- Rogoveanu, O.; Calina, D.; Cucu, M.; Burada, F.; Docea, A.; Sosoi, S.; Stefan, E.; Ioana, M.; Burada, E. Association of cytokine gene polymorphisms with osteoarthritis susceptibility. Exp. Med. 2018. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lyson, K.; McCann, S.M. The Effect of Interleukin-6 on Pituitary Hormone Release in vivo and in vitro. Neuroendocrinology 1991, 54, 262–266. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Spangelo, B.L.; Gorospe, W.C. Role of the cytokines in the neuroendocrine-immune system axis. Front. Neuroendocrinol. 1995, 16, 1–22. [Google Scholar] [CrossRef] [Scilit]
- Arzt, E.; Pereda, M.P.; Castro, C.P.; Pagotto, U.; Renner, U.; Stalla, G.K. Pathophysiological Role of the Cytokine Network in the Anterior Pituitary Gland. Front. Neuroendocrinol. 1999, 20, 71–95. [Google Scholar] [CrossRef] [Scilit]
- Herman, A.P.; Tomaszewska-Zaremba, D. Effect of endotoxin on the expression of GnRH and GnRHR genes in the hypothalamus and anterior pituitary gland of anestrous ewes. Anim. Reprod. Sci. 2010, 120, 105–111. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Herman, A.P.; Krawczyńska, A.; Bochenek, J.; Haziak, K.; Romanowicz, K.; Misztal, T.; Antushevich, H.; Herman, A.; Tomaszewska-Zaremba, D. The effect of rivastigmine on the LPS-induced suppression of GnRH/LH secretion during the follicular phase of the estrous cycle in ewes. Anim. Reprod. Sci. 2013, 138, 203–212. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Herman, A.P.; Krawczyńska, A.; Bochenek, J.; Antushevich, H.; Herman, A.; Tomaszewska-Zaremba, D. Involvement of prolactin in the meloxicam-dependent inflammatory response of the gonadotropic axis to prolonged lipopolysaccharide treatment in anoestrous ewes. Reprod. Fertil. Dev. 2016, 28, 914. [Google Scholar] [CrossRef] [Scilit]
- Turzillo, A.M.; Nolan, T.E.; Nett, T.M. Regulation of Gonadotropin-Releasing Hormone (GnRH) Receptor Gene Expression in Sheep. Endocrinology 1998, 139, 4890–4894. [Google Scholar] [CrossRef]
- Wojtulewicz, K.; Tomaszewska-Zaremba, D.; Herman, A. Endotoxin-Induced Inflammation Suppresses the Effect of Melatonin on the Release of LH from the Ovine Pars Tuberalis Explants—Ex Vivo Study. Molecules 2017, 22, 1933. [Google Scholar] [CrossRef] [Scilit]
- Wojtulewicz, K.; Tomaszewska-Zaremba, D.; Krawczyńska, A.; Tomczyk, M.; Przemysław Herman, A. The effect of inflammation on the synthesis of luteinizing hormone and gonadotropin-releasing hormone receptor expression in the pars tuberalis of ewe during different photoperiodic conditions. Can. J. Anim. Sci. 2018, 98, 675–687. [Google Scholar] [CrossRef] [Scilit]
- Battaglia, D.F.; Krasa, H.B.; Padmanabhan, V.; Viguié, C.; Karsch, F.J. Endocrine Alterations That Underlie Endotoxin-Induced Disruption of the Follicular Phase in Ewes1. Biol. Reprod. 2000, 62, 45–53. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Russel, A. Body condition scoring of sheep. Practice 1984, 6, 91–93. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Strzetelski, J. Standards for Ruminant Feeding; Instytut Zootechniki PIB: Kraków, Pland, 2009; ISBN 978-83-7607-072-8. [Google Scholar]








| GenBank Acc. No. | Gene | Amplicon Size [bp] | Forward/ Reverse | Sequence 5′→3′ | References |
|---|---|---|---|---|---|
| NM_001034034 | GAPDH glyceraldehyde-3-phosphate dehydrogenase | 134 | forward | AGAAGGCTGGGGCTCACT | [46] |
| reverse | GGCATTGCTGACAATCTTGA | ||||
| U39357 | ACTB beta actin | 168 | forward | CTTCCTTCCTGGGCATGG | [46] |
| reverse | GGGCAGTGATCTCTTTCTGC | ||||
| NM_001076910 | PPIC Cyclophilin C | 145 | forward | TGGCACTGGTGGTATAAGCA | [46] |
| reverse | GGGCTTGGTCAAGGTGATAA | ||||
| X54796.1 | IL1B interleukin 1 beta | 137 | forward | CAGCCGTGCAGTCAGTAAAA | [46] |
| reverse | GAAGCTCATGCAGAACACCA | ||||
| NM_001206735.1 | IL1R1 Interleukin 1 receptor, type I | 124 | forward | GGGAAGGGTCCACCTGTAAC | [46] |
| reverse | ACAATGCTTTCCCCAACGTA | ||||
| NM_001046210.1 | IL1R2 interleukin 1 receptor, type II | 161 | forward | CGCCAGGCATACTCAGAAA | [46] |
| reverse | GAGAACGTGGCAGCTTCTTT | ||||
| NM_001009392.1 | IL6 Interleukin 6 | 165 | forward | GTTCAATCAGGCGATTTGCT | [46] |
| reverse | CCTGCGATCTTTTCCTTCAG | ||||
| NM_001110785 | IL6R Interleukin 6 receptor | 149 | forward | TCAGCGACTCCGGAAACTAT | [46] |
| reverse | CCGAGGACTCCACTCACAAT | ||||
| XM_004016974 | IL6ST glycoprotein 130 | 139 | forward | GGCTTGCCTCCTGAAAAACC | [14] |
| reverse | ACTTCTCTGTTGCCCACTCAG | ||||
| NM_001024860 | TNF Tumor necrosis factor | 153 | forward | CAAATAACAAGCCGGTAGCC | [46] |
| reverse | AGATGAGGTAAAGCCCGTCA | ||||
| NM_174674 | TNFRSF1A Tumor necrosis factor receptor, type 1 | 137 | forward | AGGTGCCGGGATGAAATGTT | [46] |
| reverse | CAGAGGCTGCAGTTCAGACA | ||||
| NM_001040490 | TNFRSF1B Tumor necrosis factor receptor, type 2 | 122 | forward | ACCTTCTTCCTCCTCCCAAA | [46] |
| reverse | AGAAGCAGACCCAATGCTGT | ||||
| NM_001009397 | GnRHR Gonadotropin releasing hormone receptor | 150 | forward | TCTTTGCTGGACCACAGTTAT | [47] |
| reverse | GGCAGCTGAAGGTGAAAAAG | ||||
| X52488 | LHβ Luteinizing hormone | 184 | forward | AGATGCTCCAGGGACTGCT | [47] |
| reverse | TGCTTCATGCTGAGGCAGTA | ||||
| X15493 | FSHβ Follicle-stimulating hormone | 131 | forward | TATTGCTACACCCGGGACTT | [47] |
| reverse | TACAGGGAGTCTGCATGGTG |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wojtulewicz, K.; Krawczyńska, A.; Tomaszewska-Zaremba, D.; Wójcik, M.; Herman, A.P. Effect of Acute and Prolonged Inflammation on the Gene Expression of Proinflammatory Cytokines and Their Receptors in the Anterior Pituitary Gland of Ewes. Int. J. Mol. Sci. 2020, 21, 6939. https://doi.org/10.3390/ijms21186939
Wojtulewicz K, Krawczyńska A, Tomaszewska-Zaremba D, Wójcik M, Herman AP. Effect of Acute and Prolonged Inflammation on the Gene Expression of Proinflammatory Cytokines and Their Receptors in the Anterior Pituitary Gland of Ewes. International Journal of Molecular Sciences. 2020; 21(18):6939. https://doi.org/10.3390/ijms21186939
Chicago/Turabian StyleWojtulewicz, Karolina, Agata Krawczyńska, Dorota Tomaszewska-Zaremba, Maciej Wójcik, and Andrzej P. Herman. 2020. "Effect of Acute and Prolonged Inflammation on the Gene Expression of Proinflammatory Cytokines and Their Receptors in the Anterior Pituitary Gland of Ewes" International Journal of Molecular Sciences 21, no. 18: 6939. https://doi.org/10.3390/ijms21186939
APA StyleWojtulewicz, K., Krawczyńska, A., Tomaszewska-Zaremba, D., Wójcik, M., & Herman, A. P. (2020). Effect of Acute and Prolonged Inflammation on the Gene Expression of Proinflammatory Cytokines and Their Receptors in the Anterior Pituitary Gland of Ewes. International Journal of Molecular Sciences, 21(18), 6939. https://doi.org/10.3390/ijms21186939

