Hub Proteins Involved in RAW 264.7 Macrophages Exposed to Direct Current Electric Field
Abstract
1. Introduction
2. Results
2.1. Cell Morphology
2.2. Identification of DEGs
2.3. Functional and Pathway Enrichment Analysis of Identified Modules Associated with DEGs
2.4. Module Screening from the PPI Network
2.5. Gene Expression Verification of DEGs
2.6. Protein Modeling
2.7. Molecular Dynamics and Simulation
3. Discussion
3.1. Overview of the Biological Effects of Electric Fields
3.2. Hub Genes
3.3. Sensitive lncRNAs
3.4. Electrotaxis and Gene Expression
3.5. Oxidative Stress and Cell Migration
3.6. Macrophages Electroporation Activation
3.7. Electric Field Strength
3.7.1. Experimental Study
3.7.2. Molecular Dynamics Study
3.8. Electric Field-Induced Changes in Protein Structure
3.9. Voltage-Gated Channels
3.10. Resting Potential
4. Materials and Methods
4.1. The Outline of This Work
4.2. Materials
4.3. Cell Culture
4.4. Electric Field Stimulation
4.4.1. Construction of Electrotaxis Chambers
4.4.2. Preparation of the Chamber
4.4.3. Preparation of Cells
4.4.4. Application of Electric Field
4.5. Gene Expression Analysis
4.6. RNA-Seq Sample Collection and Preparation
4.6.1. RNA Quantification and Qualification
4.6.2. Library Preparation for Transcriptome Sequencing
4.6.3. Clustering and Sequencing
4.7. RNA-Seq Data Analysis
4.7.1. Quality Control
4.7.2. Reads Mapping to the Reference Genome
4.7.3. Quantification of Gene Expression Level
4.7.4. Differential Expression Analysis
4.7.5. GO and KEGG Enrichment Analysis of Differentially Expressed Genes
4.7.6. Integration of Protein–Protein Interaction (PPI) Network and Module Analysis
4.8. Protein Modeling
4.9. De Novo Modeling of Proteins
4.10. Molecular Dynamics Simulations
4.10.1. Molecular Dynamic Simulation: Protein in Water
4.10.2. Molecular Dynamic Simulation: Protein Under dcEF
4.10.3. Molecular Dynamic Simulation Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Abbreviations
BP | biological process |
cBioPortal | cBio Cancer Genomics Portal |
CC | cell component |
DEGs | differentially expressed genes |
FC | fold control |
GO | Gene Ontology |
KEGG | Kyoto Encyclopedia of Genes and Genomes pathway |
MCODE | Molecular Complex Detection |
MF | molecular function |
PPI | protein–protein interaction |
RMSD | root mean square deviation |
RMSF | root mean square fluctuation |
DMEM | Dulbecco’s Modified Eagle’s medium |
FBS | fetal bovine serum |
DOPE | discrete optimized protein energy |
dcEF | direct current electric field |
References
- Martin-Granados, C.; McCaig, C.D. Harnessing the electric spark of life to cure skin wounds. Adv. Wound Care 2014, 3, 127–138. [Google Scholar] [CrossRef]
- Cortese, B.; Palama, I.E.; D’Amone, S.; Gigli, G. Influence of electrotaxis on cell behaviour. Integr. Biol. 2014, 6, 817–830. [Google Scholar] [CrossRef]
- Funk, R.H. Endogenous electric fields as guiding cue for cell migration. Front. Physiol. 2015, 6, 143. [Google Scholar] [CrossRef]
- Ericsson, A.C.; Davis, D.J.; Franklin, C.L.; Hagan, C.E. Exoelectrogenic capacity of host microbiota predicts lymphocyte recruitment to the gut. Physiol. Genom. 2015, 47, 243–252. [Google Scholar] [CrossRef]
- Manière, X.; Krisko, A.; Pellay, F.; Di Meglio, J.-M.; Hersen, P.; Matic, I. High transcript levels of heat-shock genes are associated with shorter lifespan of Caenorhabditis elegans. Exp. Gerontol. 2014, 60, 12–17. [Google Scholar] [CrossRef]
- Zhu, K.; Takada, Y.; Nakajima, K.; Sun, Y.; Jiang, J.; Zhang, Y.; Zeng, Q.; Takada, Y.; Zhao, M. Expression of integrins to control migration direction of electrotaxis. FASEB J. 2019, 33, 9131–9141. [Google Scholar] [CrossRef] [PubMed]
- Huang, Y.-J.; Schiapparelli, P.; Kozielski, K.; Green, J.; Lavell, E.; Guerrero-Cazares, H.; Quinones-Hinojosa, A.; Searson, P. Electrophoresis of cell membrane heparan sulfate regulates galvanotaxis in glial cells. J. Cell Sci. 2017, 130, 2459–2467. [Google Scholar] [CrossRef] [PubMed]
- Sun, Y.-S. Studying electrotaxis in microfluidic devices. Sensors 2017, 17, 2048. [Google Scholar] [CrossRef]
- Hoare, J.I.; Barker, R.N.; McCaig, C.C.; Rajnicek, A.; Wilson, H.M. Electric fields: A novel non-chemical regulator of human macrophage function. Immunology 2014, 143, 96. [Google Scholar]
- Hoare, J.I.; Rajnicek, A.M.; McCaig, C.D.; Barker, R.N.; Wilson, H.M. Electric fields are novel determinants of human macrophage functions. J. Leukoc. Biol. 2016, 99, 1141–1151. [Google Scholar] [CrossRef] [PubMed]
- Zimolag, E.; Borowczyk-Michalowska, J.; Kedracka-Krok, S.; Skupien-Rabian, B.; Karnas, E.; Lasota, S.; Sroka, J.; Drukala, J.; Madeja, Z. Electric field as a potential directional cue in homing of bone marrow-derived mesenchymal stem cells to cutaneous wounds. Biochim. Biophys. Acta Mol. Cell Res. 2017, 1864, 267–279. [Google Scholar] [CrossRef] [PubMed]
- Sun, Y.; Reid, B.; Ferreira, F.; Luxardi, G.; Ma, L.; Lokken, K.L.; Zhu, K.; Xu, G.; Sun, Y.; Ryzhuk, V.; et al. Infection-generated electric field in gut epithelium drives bidirectional migration of macrophages. PLoS Biol. 2019, 17, e3000044. [Google Scholar] [CrossRef] [PubMed]
- Stuyver, T.; Danovich, D.; Joy, J.; Shaik, S. External electric field effects on chemical structure and reactivity. WIREs Comput. Mol. Sci. 2019. [Google Scholar] [CrossRef]
- Barker, A.; Jaffe, L.; Vanable, J., Jr. The glabrous epidermis of cavies contains a powerful battery. Am. J. Physiol. 1982, 242, R358–R366. [Google Scholar] [CrossRef] [PubMed]
- McGinnis, M.; Vanable, J., Jr. Voltage gradients in newt limb stumps. Prog. Clin. Biol. Res. 1986, 210, 231. [Google Scholar]
- Chiang, M.; Robinson, K.R.; Vanable, J.W., Jr. Electrical fields in the vicinity of epithelial wounds in the isolated bovine eye. Exp. Eye Res. 1992, 54, 999–1003. [Google Scholar] [CrossRef]
- Sta Iglesia, D.D.; Cragoe, E.J., Jr.; Vanable, J.W., Jr. Electric field strength and epithelization in the newt (Notophthalmus viridescens). J. Exp. Zool. 1996, 274, 56–62. [Google Scholar] [CrossRef]
- Sta Iglesia, D.D.; Vanable, J.W., Jr. Endogenous lateral electric fields around bovine corneal lesions are necessary for and can enhance normal rates of wound healing. Wound Repair Regen. 1998, 6, 531–542. [Google Scholar] [CrossRef]
- Yin, S.; Chen, X.; Hu, C.; Zhang, X.; Hu, Z.; Yu, J.; Feng, X.; Jiang, K.; Ye, S.; Shen, K. Nanosecond pulsed electric field (nsPEF) treatment for hepatocellular carcinoma: A novel locoregional ablation decreasing lung metastasis. Cancer Lett. 2014, 346, 285–291. [Google Scholar] [CrossRef]
- Wang, L.; Jiang, X.; Zheng, Q.; Jeon, S.M.; Chen, T.; Liu, Y.; Kulaga, H.; Reed, R.; Dong, X.; Caterina, M.J.; et al. Neuronal FcγRI mediates acute and chronic joint pain. J. Clin. Investig. 2019, 129, 3754–3769. [Google Scholar] [CrossRef]
- Bersellini Farinotti, A.; Wigerblad, G.; Nascimento, D.; Bas, D.B.; Morado Urbina, C.; Nandakumar, K.S.; Sandor, K.; Xu, B.; Abdelmoaty, S.; Hunt, M.A.; et al. Cartilage-binding antibodies induce pain through immune complex-mediated activation of neurons. J. Exp. Med. 2019, 216, 1904–1924. [Google Scholar] [CrossRef] [PubMed]
- Baker, S.J. Small unstable apoptotic protein, an apoptosis-associated protein, suppresses proliferation of myeloid cells. Cancer Res. 2003, 63, 705–712. [Google Scholar] [PubMed]
- Berberich, S.J.; Todd, A.; Tuttle, R. Why YPEL3 represents a novel tumor suppressor. Front. Biosci. 2011, 16, 1746–1751. [Google Scholar] [CrossRef] [PubMed]
- Zandi-Nejad, K.; Takakura, A.; Jurewicz, M.; Chandraker, A.K.; Offermanns, S.; Mount, D.; Abdi, R. The role of HCA2 (GPR109A) in regulating macrophage function. FASEB J. 2013, 27, 4366–4374. [Google Scholar] [CrossRef] [PubMed]
- Chen, H.; Assmann, J.C.; Krenz, A.; Rahman, M.; Grimm, M.; Karsten, C.M.; Kohl, J.; Offermanns, S.; Wettschureck, N.; Schwaninger, M. Hydroxycarboxylic acid receptor 2 mediates dimethyl fumarate’s protective effect in EAE. J. Clin. Investig. 2014, 124, 2188–2192. [Google Scholar] [CrossRef]
- Shi, Y.; Lai, X.; Ye, L.; Chen, K.; Cao, Z.; Gong, W.; Jin, L.; Wang, C.; Liu, M.; Liao, Y.; et al. Activated niacin receptor HCA2 inhibits chemoattractant-mediated macrophage migration via Gbetagamma/PKC/ERK1/2 pathway and heterologous receptor desensitization. Sci. Rep. 2017, 7, 42279. [Google Scholar] [CrossRef]
- Paiva, K.B.; Granjeiro, J.M. Bone tissue remodeling and development: Focus on matrix metalloproteinase functions. Arch. Biochem. Biophys. 2014, 561, 74–87. [Google Scholar] [CrossRef]
- Hannocks, M.J.; Zhang, X.; Gerwien, H.; Chashchina, A.; Burmeister, M.; Korpos, E.; Song, J.; Sorokin, L. The gelatinases, MMP-2 and MMP-9, as fine tuners of neuroinflammatory processes. Matrix Biol. 2019, 75–76, 102–113. [Google Scholar] [CrossRef]
- Brezillon, S.; Pietraszek, K.; Maquart, F.X.; Wegrowski, Y. Lumican effects in the control of tumour progression and their links with metalloproteinases and integrins. FEBS J. 2013, 280, 2369–2381. [Google Scholar] [CrossRef]
- Bavner, A.; Matthews, J.; Sanyal, S.; Gustafsson, J.A.; Treuter, E. EID3 is a novel EID family member and an inhibitor of CBP-dependent co-activation. Nucleic Acids Res. 2005, 33, 3561–3569. [Google Scholar] [CrossRef]
- Lara-Castillo, N.; Johnson, M.L. LRP receptor family member associated bone disease. Rev. Endocr. Metab. Disord. 2015, 16, 141–148. [Google Scholar] [CrossRef] [PubMed]
- Tavazoie, M.F.; Pollack, I.; Tanqueco, R.; Ostendorf, B.N.; Reis, B.S.; Gonsalves, F.C.; Kurth, I.; Andreu-Agullo, C.; Derbyshire, M.L.; Posada, J.; et al. LXR/ApoE Activation Restricts Innate Immune Suppression in Cancer. Cell 2018, 172, 825–840. [Google Scholar] [CrossRef] [PubMed]
- Roslan, Z.; Muhamad, M.; Selvaratnam, L.; Ab-Rahim, S. The Roles of Low-Density Lipoprotein Receptor-Related Proteins 5, 6, and 8 in Cancer: A Review. J. Oncol. 2019, 2019, 4536302. [Google Scholar] [CrossRef] [PubMed]
- Van de Sluis, B.; Wijers, M.; Herz, J. News on the molecular regulation and function of hepatic low-density lipoprotein receptor and LDLR-related protein 1. Curr. Opin. Lipidol. 2017, 28, 241–247. [Google Scholar] [CrossRef] [PubMed]
- McFarlane, M.R.; Liang, G.; Engelking, L.J. Insig proteins mediate feedback inhibition of cholesterol synthesis in the intestine. J. Biol. Chem. 2014, 289, 2148–2156. [Google Scholar] [CrossRef]
- Wang, Q.; Liu, X.; Cui, Y.; Tang, Y.; Chen, W.; Li, S.; Yu, H.; Pan, Y.; Wang, C. The E3 ubiquitin ligase AMFR and INSIG1 bridge the activation of TBK1 kinase by modifying the adaptor STING. Immunity 2014, 41, 919–933. [Google Scholar] [CrossRef]
- Bult, C.J.; Blake, J.A.; Smith, C.L.; Kadin, J.A.; Richardson, J.E. Mouse Genome Database (MGD) 2019. Nucleic Acids Res. 2019, 47, D801–D806. [Google Scholar] [CrossRef]
- Smith, C.M.; Hayamizu, T.F.; Finger, J.H.; Bello, S.M.; McCright, I.J.; Xu, J.; Baldarelli, R.M.; Beal, J.S.; Campbell, J.; Corbani, L.E.; et al. The mouse Gene Expression Database (GXD): 2019 update. Nucleic Acids Res. 2019, 47, D774–D779. [Google Scholar] [CrossRef]
- Carninci, P.; Kasukawa, T.; Katayama, S.; Gough, J.; Frith, M.C.; Maeda, N.; Oyama, R.; Ravasi, T.; Lenhard, B.; Wells, C.; et al. The transcriptional landscape of the mammalian genome. Science 2005, 309, 1559–1563. [Google Scholar]
- Alvarez-Dominguez, J.R.; Zhang, X.; Hu, W. Widespread and dynamic translational control of red blood cell development. Blood 2017, 129, 619–629. [Google Scholar] [CrossRef]
- Alvarez-Dominguez, J.R.; Hu, W.; Yuan, B.; Shi, J.; Park, S.S.; Gromatzky, A.A.; van Oudenaarden, A.; Lodish, H.F. Global discovery of erythroid long noncoding RNAs reveals novel regulators of red cell maturation. Blood 2014, 123, 570–581. [Google Scholar] [CrossRef] [PubMed]
- Clark, A.G.; Eisen, M.B.; Smith, D.R.; Bergman, C.M.; Oliver, B.; Markow, T.A.; Kaufman, T.C.; Kellis, M.; Gelbart, W.; Iyer, V.N.; et al. Evolution of genes and genomes on the Drosophila phylogeny. Nature 2007, 450, 203–218. [Google Scholar] [PubMed]
- Diermeier, S.D.; Chang, K.C.; Freier, S.M.; Song, J.; El Demerdash, O.; Krasnitz, A.; Rigo, F.; Bennett, C.F.; Spector, D.L. Mammary Tumor-Associated RNAs Impact Tumor Cell Proliferation, Invasion, and Migration. Cell Rep. 2016, 17, 261–274. [Google Scholar] [CrossRef] [PubMed]
- Zhao, W.; Ma, X.; Liu, L.; Chen, Q.; Liu, Z.; Zhang, Z.; Ma, S.; Wang, Z.; Li, H.; Wang, Z.; et al. SNHG20: A vital lncRNA in multiple human cancers. J. Cell. Physiol. 2019. [Google Scholar] [CrossRef]
- Cui, N.; Liu, J.; Xia, H.; Xu, D. LncRNA SNHG20 contributes to cell proliferation and invasion by upregulating ZFX expression sponging miR-495-3p in gastric cancer. J. Cell. Biochem. 2019, 120, 3114–3123. [Google Scholar] [CrossRef]
- Tweedie, S.; Ashburner, M.; Falls, K.; Leyland, P.; McQuilton, P.; Marygold, S.; Millburn, G.; Osumi-Sutherland, D.; Schroeder, A.; Seal, R.; et al. FlyBase: Enhancing Drosophila Gene Ontology annotations. Nucleic Acids Res. 2009, 37, D555–D559. [Google Scholar] [CrossRef]
- Jennings, J.; Chen, D.; Feldman, D. Transcriptional response of dermal fibroblasts in direct current electric fields. Bioelectromagnetics 2008, 29, 394–405. [Google Scholar] [CrossRef]
- Jennings, J.A.; Chen, D.; Feldman, D.S. Upregulation of chemokine (C–C motif) ligand 20 in adult epidermal keratinocytes in direct current electric fields. Arch. Dermatol. Res. 2010, 302, 211–220. [Google Scholar] [CrossRef]
- Huang, C.-W.; Chen, H.-Y.; Yen, M.-H.; Chen, J.J.; Young, T.-H.; Cheng, J.-Y. Gene expression of human lung cancer cell line CL1–5 in response to a direct current electric field. PLoS ONE 2011, 6, e25928. [Google Scholar] [CrossRef]
- Lyon, J.G.; Carroll, S.L.; Mokarram, N.; Bellamkonda, R.V. Electrotaxis of Glioblastoma and Medulloblastoma spheroidal Aggregates. Sci. Rep. 2019, 9, 1–19. [Google Scholar] [CrossRef]
- Li, F.; Chen, T.; Hu, S.; Lin, J.; Hu, R.; Feng, H. Superoxide mediates direct current electric field-induced directional migration of glioma cells through the activation of AKT and ERK. PLoS ONE 2013, 8, e61195. [Google Scholar] [CrossRef] [PubMed]
- Wu, S.-Y.; Hou, H.-S.; Sun, Y.-S.; Cheng, J.-Y.; Lo, K.-Y. Correlation between cell migration and reactive oxygen species under electric field stimulation. Biomicrofluidics 2015, 9, 054120. [Google Scholar] [CrossRef] [PubMed]
- Keller, A.-A.; Maeß, M.B.; Schnoor, M.; Scheiding, B.; Lorkowski, S. Transfecting Macrophages. In Macrophages; Springer: Berlin/Heidelberg, Germany, 2018; pp. 187–195. [Google Scholar]
- Barthel, R.; Feng, J.; Piedrahita, J.A.; McMurray, D.N.; Templeton, J.W.; Adams, L.G. Stable transfection of the bovine NRAMP1 gene into murine RAW264.7 cells: Effect on Brucella abortus survival. Infect. Immun. 2001, 69, 3110–3119. [Google Scholar] [CrossRef] [PubMed]
- Budi, A.; Legge, F.S.; Treutlein, H.; Yarovsky, I. Electric field effects on insulin chain-B conformation. J. Phys. Chem. B 2005, 109, 22641–22648. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Li, Y.; He, X.; Chen, S.; Zhang, J.Z. Effect of strong electric field on the conformational integrity of insulin. J. Phys. Chem. A 2014, 118, 8942–8952. [Google Scholar] [CrossRef]
- Marracino, P.; Apollonio, F.; Liberti, M.; d’Inzeo, G.; Amadei, A. Effect of high exogenous electric pulses on protein conformation: Myoglobin as a case study. J. Phys. Chem. B 2013, 117, 2273–2279. [Google Scholar] [CrossRef]
- English, N.J.; Mooney, D.A. Denaturation of hen egg white lysozyme in electromagnetic fields: A molecular dynamics study. J. Chem. Phys. 2007, 126, 091105. [Google Scholar] [CrossRef]
- Timmons, J.J.; Preto, J.; Tuszynski, J.A.; Wong, E.T. Tubulin’s response to external electric fields by molecular dynamics simulations. PLoS ONE 2018, 13, e0202141. [Google Scholar] [CrossRef]
- Singh, A.; Orsat, V.; Raghavan, V. Soybean hydrophobic protein response to external electric field: A molecular modeling approach. Biomolecules 2013, 3, 168–179. [Google Scholar] [CrossRef]
- Pashandi, Z.; Molakarimi, M.; Mohseni, A.; Sajedi, R.H.; Taghdir, M.; Naderi-Manesh, H. Photoinactivation related dynamics of ctenophore photoproteins: Insights from molecular dynamics simulation under electric-field. Biochem. Biophys. Res. Commun. 2017, 490, 265–270. [Google Scholar] [CrossRef]
- Burke, R. Investigating the Role of Voltage-Gated Ion Channels in Pulsed Electric Field Effects in Excitable and Non-Excitable Cell Lines. Ph.D. Thesis, Université de Limoges, Limoges, France, 2017. [Google Scholar]
- Pall, M.L. Electromagnetic fields act via activation of voltage-gated calcium channels to produce beneficial or adverse effects. J. Cell. Mol. Med. 2013, 17, 958–965. [Google Scholar] [CrossRef] [PubMed]
- Feng, T.; Kalyaanamoorthy, S.; Ganesan, A.; Barakat, K. Atomistic modeling and molecular dynamics analysis of human CaV1. 2 channel using external electric field and ion pulling simulations. Biochim. Biophys. Acta Gen. Subj. 2019, 1863, 1116–1126. [Google Scholar] [CrossRef] [PubMed]
- Mosser, D.M.; Edwards, J.P. Exploring the full spectrum of macrophage activation. Nat. Rev. Immunol. 2008, 8, 958–969. [Google Scholar] [CrossRef] [PubMed]
- Levin, M.; Stevenson, C.G. Regulation of cell behavior and tissue patterning by bioelectrical signals: Challenges and opportunities for biomedical engineering. Annu. Rev. Biomed. Eng. 2012, 14, 295–323. [Google Scholar] [CrossRef]
- Li, C.; Levin, M.; Kaplan, D.L. Bioelectric modulation of macrophage polarization. Sci. Rep. 2016, 6, 1–12. [Google Scholar] [CrossRef]
- Wang, C.-L.; Tsai, M.-L.; Wu, S.-N. Evidence for mitoxantrone-induced block of inwardly rectifying K+ channels expressed in the osteoclast precursor RAW 264.7 cells differentiated with lipopolysaccharide. Cell. Physiol. Biochem. 2012, 30, 687–701. [Google Scholar] [CrossRef]
- Hassel, A.W.; Fushimi, K.; Seo, M. An agar-based silver| silver chloride reference electrode for use in micro-electrochemistry. Electrochem. Commun. 1999, 1, 180–183. [Google Scholar] [CrossRef]
- Yan, T.; Jiang, X.; Guo, X.; Chen, W.; Tang, D.; Zhang, J.; Zhang, X.; Zhang, D.; Zhang, Q.; Jia, J.; et al. Electric field-induced suppression of PTEN drives epithelial-to-mesenchymal transition via mTORC1 activation. J. Dermatol. Sci. 2017, 85, 96–105. [Google Scholar] [CrossRef]
- Sun, Y.L.; Chen, Z.H.; Chen, X.H.; Yin, C.; Li, D.J.; Ma, X.L.; Zhao, F.; Zhang, G.; Shang, P.; Qian, A.R. Diamagnetic Levitation Promotes Osteoclast Differentiation from RAW264.7 Cells. IEEE Trans. Biomed. Eng. 2015, 62, 900–908. [Google Scholar] [CrossRef]
- Yu, G.; Wang, L.G.; Han, Y.; He, Q.Y. clusterProfiler: An R package for comparing biological themes among gene clusters. OMICS 2012, 16, 284–287. [Google Scholar] [CrossRef]
- Matteucci, C.; Argaw-Denboba, A.; Balestrieri, E.; Giovinazzo, A.; Miele, M.; D’Agostini, C.; Pica, F.; Grelli, S.; Paci, M.; Mastino, A.; et al. Deciphering cellular biological processes to clinical application: A new perspective for Talpha1 treatment targeting multiple diseases. Expert Opin. Biol. Ther. 2018, 18, 23–31. [Google Scholar] [CrossRef] [PubMed]
- Ahn, J.H.; Hwang, S.H.; Cho, H.S.; Lee, M. Differential Gene Expression Common to Acquired and Intrinsic Resistance to BRAF Inhibitor Revealed by RNA-Seq Analysis. Biomol. Ther. 2019, 27, 302–310. [Google Scholar] [CrossRef] [PubMed]
- Szklarczyk, D.; Franceschini, A.; Wyder, S.; Forslund, K.; Heller, D.; Huerta-Cepas, J.; Simonovic, M.; Roth, A.; Santos, A.; Tsafou, K.P. STRING v10: Protein–protein interaction networks, integrated over the tree of life. Nucleic Acids Res. 2014, 43, D447–D452. [Google Scholar] [CrossRef] [PubMed]
- Bindea, G.; Mlecnik, B.; Hackl, H.; Charoentong, P.; Tosolini, M.; Kirilovsky, A.; Fridman, W.-H.; Pagès, F.; Trajanoski, Z.; Galon, J. ClueGO: A Cytoscape plug-in to decipher functionally grouped gene ontology and pathway annotation networks. Bioinformatics 2009, 25, 1091–1093. [Google Scholar] [CrossRef]
- Bindea, G.; Galon, J.; Mlecnik, B. CluePedia Cytoscape plugin: Pathway insights using integrated experimental and in silico data. Bioinformatics 2013, 29, 661–663. [Google Scholar] [CrossRef]
- Chin, C.H.; Chen, S.H.; Wu, H.H.; Ho, C.W.; Ko, M.T.; Lin, C.Y. cytoHubba: Identifying hub objects and sub-networks from complex interactome. BMC Syst. Biol. 2014, 8 (Suppl. 4), S11. [Google Scholar] [CrossRef]
- Li, P.; Wu, M.; Lin, Q.; Wang, S.; Chen, T.; Jiang, H. Key genes and integrated modules in hematopoietic differentiation of human embryonic stem cells: A comprehensive bioinformatic analysis. Stem Cell Res. Ther. 2018, 9, 301. [Google Scholar] [CrossRef]
- Berman, H.M.; Westbrook, J.; Feng, Z.; Gilliland, G.; Bhat, T.N.; Weissig, H.; Shindyalov, I.N.; Bourne, P.E. The Protein Data Bank. Nucleic Acids Res. 2000, 28, 235–242. [Google Scholar] [CrossRef]
- Sali, A.; Blundell, T.L. Comparative protein modelling by satisfaction of spatial restraints. J. Mol. Biol. 1993, 234, 779–815. [Google Scholar] [CrossRef]
- Leaver-Fay, A.; Tyka, M.; Lewis, S.M.; Lange, O.F.; Thompson, J.; Jacak, R.; Kaufman, K.; Renfrew, P.D.; Smith, C.A.; Sheffler, W.; et al. ROSETTA3: An object-oriented software suite for the simulation and design of macromolecules. Methods Enzymol. 2011, 487, 545–574. [Google Scholar]
- Abraham, M.J.; Murtola, T.; Schulz, R.; Páll, S.; Smith, J.C.; Hess, B.; Lindahl, E.J.S. GROMACS: High performance molecular simulations through multi-level parallelism from laptops to supercomputers. SotfwareX 2015, 1–2, 19–25. [Google Scholar] [CrossRef]
- Huang, J.; MacKerell, A.D., Jr. CHARMM36 all-atom additive protein force field: Validation based on comparison to NMR data. J. Comput. Chem. 2013, 34, 2135–2145. [Google Scholar] [CrossRef] [PubMed]
- Laskowski, R.A.; MacArthur, M.W.; Moss, D.S.; Thornton, J.M.J. PROCHECK: A program to check the stereochemical quality of protein structures. J. Appl. Crystallogr. 1993, 26, 283–291. [Google Scholar] [CrossRef]
Gene_Biotype | Gene_Name | log2FoldChange | p-Value | Padj |
---|---|---|---|---|
lncRNA | Gm26532 | −2.470287104 | 1.61 × 10−13 | 4.04 × 10−10 |
Gm28187 | −2.088392064 | 9.78 × 10−12 | 1.85 × 10−8 | |
AI480526 | −3.034810761 | 1.58 × 10−9 | 1.71 × 10−6 | |
Gm26520 | −3.026474908 | 5.02 × 10−9 | 4.46 × 10−6 | |
Snhg20 | −1.323550221 | 1.30 × 10−8 | 7.69 × 10−6 | |
miR17hg | −2.836327803 | 1.36 × 10−7 | 4.89 × 10−5 | |
Gm46224 | −1.74087554 | 1.06 × 10−6 | 0.000208401 | |
Gm12708 | 2.480747891 | 4.30 × 10−6 | 0.000612157 | |
Gm40723 | 1.061737181 | 1.69 × 10−5 | 0.001775738 | |
CT030636.2 | −2.393353924 | 2.72 × 10−5 | 0.002486353 | |
Gm47015 | −1.934651075 | 3.57 × 10−5 | 0.003014666 | |
Gm16755 | −2.461324991 | 5.86 × 10−5 | 0.004243817 | |
miR142hg | −1.680214964 | 7.70 × 10−5 | 0.005032238 | |
Gm26890 | −2.201929478 | 0.000168331 | 0.008675651 | |
Gm7292 | −1.230352255 | 0.000211049 | 0.010247751 | |
Lsmem2 | −2.439159554 | 0.000218217 | 0.010395258 | |
Gm38399 | −1.345909825 | 0.000265851 | 0.011965918 | |
Gm26792 | −1.806478371 | 0.00035872 | 0.014640637 | |
Gm17300 | −2.092545053 | 0.000750651 | 0.023785141 | |
Gm36738 | 1.207513949 | 0.001022396 | 0.029021064 | |
Gm47343 | 1.203380022 | 0.001192886 | 0.031492603 | |
Gm17745 | 1.042574015 | 0.001198205 | 0.031522819 | |
Pldi | −2.920635148 | 0.001270895 | 0.032583666 | |
Gm38102 | −2.486096408 | 0.001308696 | 0.033258798 | |
Gm26711 | −2.19928712 | 0.001578787 | 0.036963198 | |
Gm21781 | −1.366279119 | 0.001838241 | 0.040183135 | |
Gm26869 | −2.327597738 | 0.001839189 | 0.040183135 | |
Gm35037 | −1.260055171 | 0.001948831 | 0.041708195 | |
Gdap10 | −1.315142974 | 0.002101718 | 0.043726474 | |
Gm21817 | −2.842246271 | 0.002255472 | 0.046214222 | |
miRNA | Gm23935 | 9.74 × 10−7 | 0.000196164 | Gm23935 |
Gm24270 | 2.73 × 10−6 | 0.000453662 | Gm24270 | |
miR142b | 3.27 × 10−6 | 0.000523127 | miR 142b | |
miR 23a | 4.69 × 10−5 | 0.003747572 | miR 23a | |
miR 365-2 | 5.96 × 10−5 | 0.004258302 | miR 365-2 | |
miR 23b | 0.000355791 | 0.014599983 | miR 23b | |
miR 27a | 0.000605588 | 0.021022951 | miR 27a | |
miR 221 | 0.000608768 | 0.021077429 | miR 221 | |
miR 7-1 | 0.000680236 | 0.022379617 | miR 7-1 |
Expression | Pathway ID | Name | Gene Count | % | Genes |
---|---|---|---|---|---|
Down-regulated | mmu01100 | Metabolic pathways | 32 | 15.69 | Gldc, Cbr3, Fdps, Pgd, Acat2, Cox17, Cyp51, Dpm1, Fasn, Fpgs, Gclc, Gclm, Gsr, Hmgcr, Hsd17b7, Lss, Nqo1, Pfkfb1, Pfkfb2, Piga, Sqle, Hmgcs1, Pank3, Mars2, Mgat2, Mat2a, Pfas, Impad1, Idi1, Vkorc1l1, Gbe1, Dhcr24 |
mmu05200 | Pathways in cancer | 7 | 3.43 | Fzd5, Igf1, Jag1, Nqo1, Skp2, Lpar5, Txnrd1 | |
mmu04152 | AMP-activated protein kinase (AMPK) signaling pathway | 6 | 2.94 | Prkab2, Fasn, Hmgcr, Igf1, Pfkfb1, Pfkfb2 | |
mmu00100 | Steroid biosynthesis | 6 | 2.94 | Cyp51, Hsd17b7, Lss, Sqle, Soat2, Dhcr24 | |
mmu00900 | Terpenoid backbone biosynthesis | 6 | 2.94 | Fdps, Acat2, Hmgcr, Hmgcs1, Idi1, Pdss1 | |
Up-regulated | mmu01100 | Metabolic pathways | 49 | 24.02 | Gstt3, Tecr, Cth, Gpt2, Acy1, Acadm, Acaa1a, Prdx6, Ass1, Akr1b7, Car6, Comt, Cox6a2, Dgka, Galc, Hagh, Gpx1, Mthfd2, Nos2, Pla2g4a, Dhrs3, St6gal1, St3gal3, Cox7a2l, Pycr1, Mars, Uros, Smox, Gatb, Pigv, Mpst, Tpk1, Pigl, St3gal6, Extl1, Aldh18a1, Dhodh, Sqor, Txndc12, Ntpcr, G6pc3, Coasy, Amdhd1, Pcbd2, Pck2, Grhpr, Rdh12, Acsbg1, C1galt1 |
mmu05200 | Pathways in cancer | 17 | 8.33 | Gstt3, Bad, Gadd45a, Gnb5, Gng5, Gngt2, Il15, Il2rg, Jak2, Bbc3, Mmp9, Nfkb2, Nos2, Ralgds, Traf1, Mapk3 | |
mmu04151 | PI3K-Akt (Phosphatidylinositol 3-kinase (PI3K)/protein kinase B (AKT)) signaling pathway | 12 | 5.88 | Bad, Gnb5, Gng5, Gngt2, Magi1, Il2rg, Itgb5, Jak2, Tlr2, Mapk3, G6pc3, Pck2 | |
mmu05202 | Transcriptional misregulation in cancer | 10 | 4.9 | Gadd45a, Ddit3, Fcgr1, Lmo2, Mmp9, Traf1, Nupr1, Mllt3, Nfkbiz, Hist2h3c2 | |
mmu05170 | Human immunodeficiency virus 1 infection | 9 | 4.41 | Bad, Gnb5, Gng5, Gngt2, Itpr2, Tap2, Tlr2, Mapk3, Tmem173 |
Proteins | Species | Protein Length (aa) | Model Templates (Query Cover, Identify) |
---|---|---|---|
LRP8 | Mus musculus | 498 | 5B4X_B (66%, 93.05%) 1IJQ_A (62%, 61.09%) 3V64_C (62%, 38.26%) |
LDLR | Mus musculus | 862 | 1IJQ_A (36%, 85.80%) 3V64_C (44%, 39.08%) 3SOQ_A (36%, 36.16%) |
FCGR1 | Mus musculus | 404 | 4ZNE_A (65%, 73.31%) 4W4O_C (67%, 71.43%) 3RJD_A (64%, 73.66%) |
HCAR2 | Mus musculus | 360 | 5XJM_A (31%, 38.94%) 5NJ6_A (64%, 34.44%) 5NDD_A (65%, 34.44%) |
MMP9 | Mus musculus | 730 | 1L6J_A (58%, 82.16%) 1CK7_A (92%, 45.26%) 1EAK_A (57%, 58.47%) |
EID3 | Mus musculus | 375 | de novo |
INSIG1 | Mus musculus | 259 | de novo |
YPEL3 | Mus musculus | 119 | de novo |
Proteins | Number of Residues in Favored Region | Number of Residues in Allowed Region | Number of Residues in Disallowed Region |
---|---|---|---|
LRP8 | 354 (80.3%) | 82 (18.6%) | 5 (1.1%) |
LDLR | 466 (81.3%) | 97 (16.9%) | 10 (1.7%) |
FCGR1 | 302 (86.5%) | 42 (12.0%) | 5 (1.4%) |
HCAR2 | 271 (83.4%) | 50 (15.3%) | 4 (1.2%) |
MMP9 | 531 (89.5%) | 59 (10.0%) | 3 (0.5%) |
EID3 | 322 (93.6%) | 22 (6.4%) | 0 (0.0%) |
INSIG1 | 201 (93.5%) | 14 (6.5%) | 0 (0.0%) |
YPEL3 | 96 (89.7%) | 11 (10.3%) | 0 (0.0%) |
Name Ensembl ID | Species Gene Type | Location Length | Expression Changes (dcEF vs. Control) | Protein Families | Function | Refs |
---|---|---|---|---|---|---|
Fcgr1 (Fc receptor, IgG, high affinity I) (ENSMUSG00000015947.10) | Mus musculus Protein coding | Chr3 (2589 bp) | Up-regulated | PTHR11481 (14 genes) | Anticipated in the signal transduction of pain such as arthritis and joint inflammation. | [20,21] |
Ypel3 (yippee like 3) (ENSMUSG00000042675.15) | Mus musculus Protein coding | Chr7 (1057 bp) | Up-regulated | PTHR13847_SF179 (1 gene) | A novel tumor suppressor. | [22,23] |
Hcar2 (hydroxycarboxylic acid receptor 2) (ENSMUSG00000045502.6) | Mus musculus Protein coding | Chr5 (1930 bp) | Up-regulated | PTHR24231 (14 genes) | A novel negative regulator of macrophage activation. | [24,25,26] |
Mmp9 (matrix metallopeptidase 9) (ENSMUSG00000017737.2) | Mus musculus Protein coding | Chr2 (3175 bp) | Up-regulated | PTHR10201_SF30 (1 gene) | Involved in a wide range of biological functions including macrophage differentiation, inflammation, bone metabolism, and tumor invasion. | [27,28,29] |
Eid3 (EP300-interacting inhibitor of differentiation 3) (ENSMUSG00000109864.1) | Mus musculus Protein coding | Chr10 (1305 bp) | Down-regulated | PTHR16140_SF1 (1 gene) | A potent suppressor of nuclear receptor transcriptional activity. | [30] |
Lrp8 (low density lipoprotein receptor-related protein 8) (ENSMUSG00000028613.15) | Mus musculus Protein coding | Chr3 (3291 bp) | Down-regulated | PTHR10529_SF99 (1 gene) | A modulator of cell development and migration. | [31,32,33] |
Ldlr (low density lipoprotein receptor) (ENSMUSG00000032193.9) | Mus musculus Protein coding | Chr9 (4549 bp) | Down-regulated | PTHR10529_SF195 (1 gene) | Deeply regulates the metabolism of lipids. | [34] |
Insig1 (insulin induced gene 1) (ENSMUSG00000045294.11) | Mus musculus Protein coding | Chr5 (2667 bp) | Down-regulated | PTHR15301 (2 genes) | Modulates innate immunity and cholesterol metabolism. | [35,36] |
Genes | GO Analysis [37,38] |
---|---|
Fcgr1 | MF: signaling receptor activity; signaling receptor binding. |
BP: cellular component organization; establishment of localization; immune system process; protein metabolic process; response to stimulus; signaling. | |
CC: plasma membrane. | |
Ypel3 | MF: none. |
BP: cell death; response to stimulus. | |
CC: nucleus. | |
Hcar2 | MF: carbohydrate derivative binding; signaling receptor activity. |
BP: cell death; establishment of localization; homeostatic process; immune system process; lipid metabolic process; response to stimulus; signaling. | |
CC: plasma membrane. | |
Mmp9 | MF: hydrolase. |
BP: cell death; cell differentiation; cell population proliferation; cellular component organization; establishment of localization; immune system process; protein metabolic process; response to stimulus; signaling; system development. | |
CC: extracellular region. | |
Eid3 | MF: none. |
BP: response to stimulus. | |
CC: non-membrane-bounded organelle; nucleus; organelle lumen. | |
Lrp8 | MF: cytoskeletal protein binding; signaling receptor activity. |
BP: cell death; cell differentiation; cellular component organization; establishment of localization; immune system process; nucleic acid-templated transcription; protein metabolic process; response to stimulus; signaling; system development. | |
CC: cell projection; cytoskeleton; extracellular region; non-membrane-bounded organelle; plasma membrane; synapse. | |
Ldlr | MF: none. |
BP: cell differentiation; cellular component organization; establishment of localization; homeostatic process; immune system process; lipid metabolic process; protein metabolic process; response to stimulus; system development. | |
CC: cytoplasmic vesicle; endosome; extracellular region; Golgi apparatus; plasma membrane; vacuole. | |
Insig1 | MF: none. |
BP: cell differentiation; cellular component organization; establishment of localization; homeostatic process; lipid metabolic process; nucleic acid-templated transcription; response to stimulus; signaling; system development. | |
CC: endoplasmic reticulum. |
Name Ensembl ID | Species Gene Type | Location Length | Changes (dcEF vs. Control) | Function | Refs |
---|---|---|---|---|---|
AI480526 (ENSMUSG00000090086.7) | Mus musculus LncRNA | Chr12 (1697 bp) | Down-regulated | May be related to the maturation of red blood cells. No specific function reported yet. | [39,40,41] |
Gm26520 (ENSMUSG00000097429.1) | Mus musculus LncRNA | Chr12 (1423 bp) | Down-regulated | No specific function reported yet. | [39] |
Gm26532 (ENSMUSG00000097296.1) | Mus musculus LncRNA | Chr8 (690 bp) | Down-regulated | No specific function reported yet. | [42] |
Gm28187 (ENSMUSG00000099375.1) | Mus musculus LncRNA | Chr1 (2134 bp) | Down-regulated | May be related to mammary tumor cell proliferation and migration. | [43] |
Snhg20 (ENSMUSG00000086859.4) | Mus musculus LncRNA | Chr11 (627 bp) | Down-regulated | Promote tumor cell proliferation. | [39,44,45] |
Pathway Name | Fold Change or p-Value | |||||
---|---|---|---|---|---|---|
HDF-a dcEF: 100 mV/mm 1 h [47] | Human Adult Epidermal Keratinocytes dcEF: 100 mV/mm 1 h [48] | CL1–5 dcEF: 300 mV/mm 2 h [49] | U87 mg dcEF: 250 mV/mm 8 h [50] | DAOY dcEF: 250 mV/mm 8 h [50] | RAW 264.7 dcEF: 200 mV/mm 4 h | |
Transcription | YAF2: 2.6 JMJD1C: 2.4 ZBTB24: 2.0 ZNF15L1: 1.8 LRRFIP1: 1.8 ZNF207: 1.7 RNF12: 1.7 SIX1: 1.5 FOXJ1: 1.4 ITPR1: 1.6 IL1RAPL1: 1.4 MAPK1: 1.4 | WNK1: 1.8 RAB6IP2: 1.7 PICALM: 1.7 ATP11B: 1.7 CENTG2: 1.6 SEC15L2: 1.6 AP3B1: 1.5 ATP6V0E: 1.5 FLVCR: 1.5 | NFYA: 1.16 NFYC: 1.27 | Gene: NA p = 0.00000718 | Gene: NA p = 1.23 × 10−8 | Gadd45a: 3.25 Ddit3: 3.48 Fcgr1: 3.18 Lmo2: 1.72 Mmp9: 4.64 Traf1: 2.95 Nupr1: 3.46 Mllt3: 1.83 Nfkbiz: 2.63 Hist2h3c2: 3.51 |
Primers | Sequences (5′ to 3′) | Product (bp) | |
---|---|---|---|
GAPDH | Forward | TGTGTCCGTCGTGGATCTGA | 150 |
Reverse | TTGCTGTTGAAGTCGCAGGAG | ||
Fcgr1 | Forward | GGTTCCTCAATGCCAAGT | 128 |
Reverse | TTATTCTTCCATCCGTGACA | ||
Ypel3 | Forward | ACCTCTTCAACTCTGTAGTG | 154 |
Reverse | TACTTCTGGCTGCTCTCA | ||
Hcar2 | Forward | ACTGTCCACCTCCTCTATAC | 194 |
Reverse | TGTCTGTCCATCTGTCTCT | ||
Mmp9 | Forward | AGATTCTCCGTGTCCTGTA | 163 |
Reverse | AGTCTGACCTGAACCATAAC | ||
Eid3 | Forward | TAGCGACTGCGATGATAG | 187 |
Reverse | CATATCTCCACTTCCTTCCA | ||
Lrp8 | Forward | GACAAGGAGTAAGAAGAATGAG | 115 |
Reverse | ACAGCAGCGAGTGAATAC | ||
Ldlr | Forward | GTGTGAAGATATTGACGAGTG | 162 |
Reverse | TTGGTGAAGAGCAGATAGC | ||
Insig1 | Forward | CTAAGAGTGAGTCGCTGTC | 196 |
Reverse | GTGTTGTGTTCTATGCTGTC | ||
AI480526 | Forward | GGTCTGTGCTTAGTCTCTG | 156 |
Reverse | TGCTACCTGGAACCTTGT | ||
Gm26520 | Forward | CAATGGTGGAGGAGAGGA | 124 |
Reverse | GATGCTAGTGAGGTCAAGAA | ||
Gm26532 | Forward | GCCTCAGGATATGAACAGAT | 131 |
Reverse | TCAGCCAGTTCCAATTAGTC | ||
Gm28187 | Forward | CCAACACATATACAGCAGAAG | 124 |
Reverse | TCCACCTCCTATCCTCCT | ||
Snhg20 | Forward | CTGGCTGCTTCTGTGTTG | 123 |
Reverse | TGCTTCCGTCTAGTCGTT |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, H.; Liu, S.; Du, Y.; Tan, J.; Luo, J.; Sun, Y. Hub Proteins Involved in RAW 264.7 Macrophages Exposed to Direct Current Electric Field. Int. J. Mol. Sci. 2020, 21, 4505. https://doi.org/10.3390/ijms21124505
Li H, Liu S, Du Y, Tan J, Luo J, Sun Y. Hub Proteins Involved in RAW 264.7 Macrophages Exposed to Direct Current Electric Field. International Journal of Molecular Sciences. 2020; 21(12):4505. https://doi.org/10.3390/ijms21124505
Chicago/Turabian StyleLi, Huijuan, Shibin Liu, Yongqian Du, Jie Tan, Jiezhang Luo, and Yulong Sun. 2020. "Hub Proteins Involved in RAW 264.7 Macrophages Exposed to Direct Current Electric Field" International Journal of Molecular Sciences 21, no. 12: 4505. https://doi.org/10.3390/ijms21124505
APA StyleLi, H., Liu, S., Du, Y., Tan, J., Luo, J., & Sun, Y. (2020). Hub Proteins Involved in RAW 264.7 Macrophages Exposed to Direct Current Electric Field. International Journal of Molecular Sciences, 21(12), 4505. https://doi.org/10.3390/ijms21124505