The Acute Phase Response Is a Prominent Renal Proteome Change in Sepsis in Mice
Abstract
1. Introduction
2. Results
2.1. LPS-Induced Severe Inflammation in the Kidney
2.2. LPS-Induced Tubular Damage in the Kidney
2.3. Renal Protein Concentration Changes at Early Phases of AKI
2.4. Acute Phase Proteins Were the Most Upregulated Proteins in the Kidney in the Late Phase After LPS Administration
2.5. Most of the Upregulated Proteins Were Related to Inflammation in the Late Phase
2.6. Acute Phase Protein Synthesis Was Stimulated in the Kidney after LPS
3. Discussion
4. Materials and Methods
4.1. Animal Studies
4.2. LPS Application
- Group 1 (EP1.5): LPS at 40 mg/kg BW, and sacrificed at 1.5 h post-injection (n = 7)
- Group 2 (EP6): LPS at 40 mg/kg BW, and sacrificed at 6 h post-injection (n = 7)
- Group 3 (LP24): LPS at 10 mg/kg BW, and sacrificed at 24 h post-injection (n = 7)
- Group 4 (LP48): LPS at 10 mg/kg BW, and sacrificed at 48 h post-injection (n = 7)
4.3. Organ Harvest
4.4. Plasma Urea Determination
4.5. Tissue Homogenization
4.6. Sample Preparation for Mass Spectrometry
4.7. Mass Spectrometry Analysis
4.8. Data Analysis
4.9. RNA Preparation
4.10. qPCR Analysis of Gene Expression
4.11. Protein Classification
4.12. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Abbreviations
A1AGP | α-1-acid glycoprotein |
A2m | alpha-2-macroglobulin |
AKI | acute kidney injury |
Alb | serum albumin |
ApoA1 | apolipoprotein A1 |
ApoE | apolipoprotein E |
APP | acute phase protein |
APR | acute phase response/reaction |
BW | bodyweight |
C3 | complement C3 |
Chil3 | chitinase-like protein 3 |
CHI3L1 | Chitinase-3-like protein 1 |
Cp | ceruloplasmin |
DBP | vitamin D-binding protein |
EP | early phase (of LPS-induced systemic inflammation) |
Fga | fibrinogen-α |
Fgb | fibrinogen-β |
FC | fold change |
Fgg | fibrinogen-γ |
FHC | ferritin heavy chain |
GO | Gene Ontology |
Hp | haptoglobin |
Hpx | hemopexin |
i.p. | intraperitoneal |
Itih1 | inter-alpha-trypsin inhibitor heavy chain H1 |
Itih4 | inter alpha-trypsin inhibitor heavy chain 4 |
LFQ | label free quantification (of mass spectrometry data) |
LP | late phase (of LPS-induced systemic inflammation) |
LPS | lipopolysaccharide |
Lcn-2 | lipocalin-2 |
NGAL | neutrophil gelatinase-associated lipocalin |
NMRI | (mice developed by the) Naval Medical Research Institute |
PAI-1 | plasminogen activator inhibitor-1 |
Saa | serum amyloid A |
Serpina1 | alpha-1-antitrypsin |
Serpina3k | serine protease inhibitor A3K |
Serpina3n | serine protease inhibitor A3N |
Tf | transferrin |
Vwa5a | von Willebrand factor A domain-containing protein 5A |
References
- Kempker, J.A.; Martin, G.S. The changing epidemiology and definitions of sepsis. Clin. Chest Med. 2016, 37, 165–179. [Google Scholar] [CrossRef] [PubMed]
- Wittebole, X.; Szakmany, T.; Lupu, M.-N.; Lipman, J.; Leone, M.; Ñamendys-Silva, S.A.; Vincent, J.-L.; Martin-Loeches, I.; Sakr, Y.; Jaschinski, U. Sepsis in intensive care unit patients: Worldwide data from the Intensive Care over Nations Audit. Open Forum Infect. Dis. 2018, 5, 1–9. [Google Scholar]
- Singer, M.; Deutschman, C.S.; Seymour, C.; Shankar-Hari, M.; Annane, D.; Bauer, M.; Bellomo, R.; Bernard, G.R.; Chiche, J.D.; Coopersmith, C.M.; et al. The third international consensus definitions for sepsis and septic shock (sepsis-3). J. Am. Med. Assoc. 2016, 315, 801–810. [Google Scholar] [CrossRef] [PubMed]
- Ma, S.; Evans, R.G.; Iguchi, N.; Tare, M.; Parkington, H.C.; Bellomo, R.; May, C.N.; Lankadeva, Y.R. Sepsis-induced acute kidney injury: A disease of the microcirculation. Microcirculation 2019, 26, e12483. [Google Scholar] [CrossRef]
- Mårtensson, J.; Bellomo, R. Sepsis-induced acute kidney injury. Crit. Care Clin. 2015, 31, 649–660. [Google Scholar] [CrossRef]
- Gabay, C.; Kushner, I. Acute-phase proteins and other systemic responses to inflammation. N. Engl. J. Med. 1999, 340, 448–454. [Google Scholar] [CrossRef]
- Moshage, H. Cytokines and the hepatic acute phase response. J. Pathol. 1997, 181, 257–266. [Google Scholar] [CrossRef]
- Schrödl, W.; Büchler, R.; Wendler, S.; Reinhold, P.; Muckova, P.; Reindl, J.; Rhode, H. Acute phase proteins as promising biomarkers: Perspectives and limitations for human and veterinary medicine. Proteom.-Clin. Appl. 2016, 10, 1077–1092. [Google Scholar] [CrossRef]
- Henriquez-Camacho, C.; Losa, J. Biomarkers for sepsis. Biomed. Res. Int. 2014. [Google Scholar] [CrossRef]
- Kaucsár, T.; Godó, M.; Révész, C.; Kovács, M.; Mócsai, A.; Kiss, N.; Albert, M.; Krenács, T.; Szénási, G.; Hamar, P. Urine/plasma neutrophil gelatinase associated lipocalin ratio is a sensitive and specific marker of subclinical acute kidney injury in mice. PLoS ONE 2016, 11, e0148043. [Google Scholar] [CrossRef]
- Chakraborty, S.; Kaur, S.; Guha, S.; Batra, S.K. The multifaceted roles of neutrophil gelatinase associated lipocalin (NGAL) in inflammation and cancer. Biochim. Biophys. Acta 2012, 1826, 129–169. [Google Scholar] [CrossRef] [PubMed]
- Zyłka, A.; Gala-Błądzińska, A.; Dumnicka, P.; Ceranowicz, P.; Kuźniewski, M.; Gil, K.; Olszanecki, R.; Kuśnierz-Cabala, B. Is Urinary NGAL determination useful for monitoring kidney function and assessment of cardiovascular disease? A 12-Month observation of patients with Type 2 diabetes. Dis. Mark. 2016. [Google Scholar] [CrossRef]
- Sporek, M.; Gala-Błądzińska, A.; Dumnicka, P.; Mazur-Laskowska, M.; Kielczewski, S.; Walocha, J.; Ceranowicz, P.; Kuźniewski, M.; Mituś, J.; Kuśnierz-Cabala, B. Urine NGAL is useful in the clinical evaluation of renal function in the early course of acute pancreatitis. Folia Medica Crac. 2016, 56, 13–25. [Google Scholar]
- Schrezenmeier, E.V.; Barasch, J.; Budde, K.; Westhoff, T.; Schmidt-Ott, K.M. Biomarkers in acute kidney injury—Pathophysiological basis and clinical performance. Acta Physiol. 2017, 219, 554–572. [Google Scholar] [CrossRef] [PubMed]
- Buonafine, M.; Martinez-Martinez, E.; Jaisser, F. More than a simple biomarker: The role of NGAL in cardiovascular and renal diseases. Clin. Sci. 2018, 132, 909–923. [Google Scholar] [CrossRef] [PubMed]
- Sporek, M.; Dumnicka, P.; Gala-Błądzińska, A.; Mazur-Laskowska, M.; Walocha, J.; Ceranowicz, P.; Warzecha, Z.; Dembiński, A.; Kuźniewski, M.; Olszanecki, R.; et al. Determination of serum neutrophil gelatinase-associated lipocalin at the early stage of acute pancreatitis. Folia Medica Crac. 2016, 56, 5–16. [Google Scholar]
- Thorsvik, S.; Bakke, I.; van Beelen Granlund, A.; Røyset, E.S.; Damås, J.K.; Østvik, A.E.; Sandvik, A.K. Expression of neutrophil gelatinase-associated lipocalin (NGAL) in the gut in Crohn’s disease. Cell Tissue Res. 2018, 374, 339–348. [Google Scholar] [CrossRef] [PubMed]
- Wajda, J.; Dumnicka, P.; Maraj, M.; Ceranowicz, P.; Kuźniewski, M.; Kuśnierz-Cabala, B. Potential prognostic markers of acute kidney injury in the early phase of acute pancreatitis. Int. J. Mol. Sci. 2019, 20, 3714. [Google Scholar] [CrossRef]
- Kellum, J.A.; Prowle, J.R. Paradigms of acute kidney injury in the intensive care setting. Nat. Rev. Nephrol. 2018, 14, 217–230. [Google Scholar] [CrossRef]
- Doi, K.; Leelahavanichkul, A.; Yuen, P.S.T.; Star, R.A. Animal models of sepsis and sepsis-induced kidney injury. J. Clin. Investig. 2009, 119, 2868–2878. [Google Scholar] [CrossRef]
- Lilley, E.; Armstrong, R.; Clark, N.; Gray, P.; Hawkins, P.; Mason, K.; López-Salesansky, N.; Stark, A.K.; Jackson, S.K.; Thiemermann, C.; et al. Refinement of animal models of sepsis and septic shock. Shock 2015, 43, 304–316. [Google Scholar] [CrossRef] [PubMed]
- Bascands, J.L.; Bachvarova, M.; Neau, E.; Schanstra, J.P.; Bachvarov, D. Molecular determinants of LPS-induced acute renal inflammation: Implication of the kinin B1receptor. Biochem. Biophys. Res. Commun. 2009, 386, 407–412. [Google Scholar] [CrossRef] [PubMed]
- Kalmovarin, N.; Friedrichs, W.E.; O’Brien, H.V.; Linehan, L.A.; Bowman, B.H.; Yang, F. Extrahepatic expression of plasma protein genes during inflammation. Inflammation 1991, 15, 369–379. [Google Scholar] [CrossRef] [PubMed]
- Ault, B.H.; Colten, H.R. Cellular specificity of murine renal C3 expression in two models of inflammation. Immunology 1994, 81, 655–660. [Google Scholar] [PubMed]
- Cunningham, P.N.; Holers, V.M.; Alexander, J.J.; Guthridge, J.M.; Carroll, M.C.; Quigg, R.J. Complement is activated in kidney by endotoxin but does not cause the ensuing acute renal failure. Kidney Int. 2000, 58, 1580–1587. [Google Scholar] [CrossRef] [PubMed][Green Version]
- D’Armiento, J.; Dalal, S.S.; Chada, K. Tissue, temporal and inducible expression pattern of haptoglobin in mice. Gene 1997, 195, 19–27. [Google Scholar] [CrossRef]
- Baumann, H.; Wang, Y.; Richards, C.D.; Jones, C.A.; Black, T.A.; Gross, K.W. Endotoxin-induced renal inflammatory response: Oncostatin M as a major mediator of suppressed renin expression. J. Biol. Chem. 2000, 275, 22014–22019. [Google Scholar] [CrossRef]
- Zager, R.A.; Vijayan, A.; Johnson, A.C.M. Proximal tubule haptoglobin gene activation is an integral component of the acute kidney injury “stress response”. Am. J. Physiol. Physiol. 2012, 303, F139–F148. [Google Scholar] [CrossRef]
- Zager, R.A.; Johnson, A.C.M.; Becker, K. Renal cortical hemopexin accumulation in response to acute kidney injury. Am. J. Physiol.-Ren. Physiol. 2012, 303, F1460–F1472. [Google Scholar] [CrossRef]
- Gupta, K.K.; Donahue, D.L.; Sandoval-Cooper, M.J.; Castellino, F.J.; Ploplis, V.A. Abrogation of plasminogen activator inhibitor-1-vitronectin interaction ameliorates acute kidney injury in murine endotoxemia. PLoS ONE 2015, 10, e0120728. [Google Scholar] [CrossRef]
- Ware, L.B.; Johnson, A.C.M.; Zager, R.A. Renal cortical albumin gene induction and urinary albumin excretion in response to acute kidney injury. Am. J. Physiol. Renal Physiol. 2011, 300, F628–F638. [Google Scholar] [CrossRef] [PubMed]
- Zager, R.A.; Johnson, A.C.M.; Frostad, K.B. Rapid renal alpha-1 antitrypsin gene induction in experimental and clinical acute kidney injury. PLoS ONE 2014, 9, e98380. [Google Scholar] [CrossRef] [PubMed]
- Markanday, A. Acute phase reactants in infections: Evidence-based review and a guide for clinicians. Open Forum Infect. Dis. 2015, 2. [Google Scholar] [CrossRef] [PubMed]
- Devarajan, P. Biomarkers for the early detection of acute kidney injury. Curr. Opin. Pediatr. 2011, 23, 194–200. [Google Scholar] [CrossRef]
- Pietras, E.M.; Saha, S.K.; Cheng, G. The interferon response to bacterial and viral infections. J. Endotoxin Res. 2006, 12, 246–250. [Google Scholar] [CrossRef]
- Stinebring, W.R.; Younger, J.S. Patterns of interferon appearance in mice injected with bacteria or bacterial endotoxin. Nature 1964, 204, 712. [Google Scholar] [CrossRef]
- Buchanan, J.M.; Walter, C.A.; Robinson, L.K.; Eddy, C.A.; Yang, F.; Herbert, D.C.; Adrian, E.K.; Adrian, G.S.; Weaker, F.J.; Bowman, B.H. Expression of a human chimeric transferrin gene in senescent transgenic mice reflects the decrease of transferrin levels in aging humans. Biochim. Biophys. Acta 2003, 1132, 168–176. [Google Scholar]
- Leitner, D.F.; Connor, J.R. Functional roles of transferrin in the brain. Biochim. Biophys. Acta 2012, 1820, 393–402. [Google Scholar] [CrossRef]
- Linder, M.C. Ceruloplasmin and other copper binding components of blood plasma and their functions: An update. Metallomics 2016, 8, 887–905. [Google Scholar] [CrossRef]
- Tolosano, E.; Altruda, F. Hemopexin: Structure, function, and regulation. DNA Cell Biol. 2002, 21, 297–306. [Google Scholar] [CrossRef]
- Delanghe, J.R.; Speeckaert, R.; Speeckaert, M.M. Complement C3 and its polymorphism: Biological and clinical consequences. Pathology 2014, 46, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Upragarin, N.; Landman, W.J.M.; Gaastra, W.; Gruys, E. Extrahepatic production of acute phase serum amyloid A. Histol. Histopathol. 2005, 20, 1295–1307. [Google Scholar] [PubMed]
- Koorts, A.M.; Viljoen, M. Ferritin and ferritin isoforms I: Structure-function relationships, synthesis, degradation and secretion. Arch. Physiol. Biochem. 2007, 113, 30–54. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Wang, M.; Kang, X.; Boontheung, P.; Li, N.; Nel, A.E.; Loo, J.A. Oxidative stress and asthma: Proteome analysis of chitinase-like proteins and FIZZ1 in lung tissue and bronchoalveolar lavage fluid. J. Proteome Res. 2009, 8, 1631–1638. [Google Scholar] [CrossRef]
- Lee, C.G.; Da Silva, C.A.; Dela Cruz, C.S.; Ahangari, F.; Ma, B.; Kang, M.-J.; He, C.; Takyar, S.; Elias, J.A. Role of chitin and chitinase/chitinase-like proteins in inflammation, tissue remodeling, and injury. Annu. Rev. Physiol. 2011, 73, 479–501. [Google Scholar] [CrossRef]
- Takeuch, O.; Akira, S. Epigenetic control of macrophage polarization. Eur. J. Immunol. 2011, 41, 2490–2493. [Google Scholar] [CrossRef]
- Cuartero, M.I.; Ballesteros, I.; Moraga, A.; Nombela, F.; Vivancos, J.; Hamilton, J.A.; Corbí, Á.L.; Lizasoain, I.; Moro, M.A. N2 neutrophils, novel players in brain inflammation after stroke: Modulation by the pparγ agonist rosiglitazone. Stroke 2013, 44, 3498–3508. [Google Scholar] [CrossRef]
- Benson, M.D. Acute-phase reactants. Curr. Opin. Rheumatol. 1989, 1, 209–214. [Google Scholar] [CrossRef]
- Maddens, B.; Ghesquière, B.; Vanholder, R.; Demon, D.; Vanmassenhove, J.; Gevaert, K.; Meyer, E. Chitinase-like proteins are candidate biomarkers for sepsis-induced acute kidney injury. Mol. Cell. Proteom. 2012, 11. [Google Scholar] [CrossRef]
- Bode, J.G.; Albrecht, U.; Häussinger, D.; Heinrich, P.C.; Schaper, F. Hepatic acute phase proteins—Regulation by IL-6- and IL-1-type cytokines involving STAT3 and its crosstalk with NF-κB-dependent signaling. Eur. J. Cell Biol. 2012, 91, 496–505. [Google Scholar] [CrossRef]
- Davalos, D.; Akassoglou, K. Fibrinogen as a key regulator of inflammation in disease. Semin. Immunopathol. 2012, 34, 43–62. [Google Scholar] [CrossRef] [PubMed]
- Ye, R.D.; Sun, L. Emerging functions of serum amyloid A in inflammation. J. Leukoc. Biol. 2015, 98, 923–929. [Google Scholar] [CrossRef] [PubMed]
- Giurgea, N.; Constantinescu, M.I.; Stanciu, R.; Suciu, S.; Muresan, A. Ceruloplasmin-acute-phase reactant or endogenous antioxidant? The case of cardiovascular disease. Med. Sci. Monit. 2005, 11, RA48–RA51. [Google Scholar] [PubMed]
- Tolosano, E.; Fagoonee, S.; Morello, N.; Vinchi, F.; Fiorito, V. Heme scavenging and the other facets of hemopexin. Antioxid. Redox Signal. 2010, 12, 305–320. [Google Scholar] [CrossRef] [PubMed]
- Quaye, I.K. Haptoglobin, inflammation and disease. Trans. R. Soc. Trop. Med. Hyg. 2008, 102, 735–742. [Google Scholar] [CrossRef]
- Choi-Miura, N.H.; Takahashi, K.; Yoda, M.; Saito, K.; Hori, M.; Ozaki, H.; Mazda, T.; Tomita, M. The novel acute phase protein, IHRP, inhibits actin polymerization and phagocytosis of polymorphonuclear cells. Inflamm. Res. 2000, 49, 305–310. [Google Scholar] [CrossRef]
- Hochepied, T.; Berger, F.G.; Baumann, H.; Libert, C. α1-acid glycoprotein: An acute phase protein with inflammatory and immunomodulating properties. Cytokine Growth Factor Rev. 2003, 14, 25–34. [Google Scholar] [CrossRef]
- Mangaraj, M.; Nanda, R.; Panda, S. Apolipoprotein A-I: A molecule of diverse function. Indian J. Clin. Biochem. 2016, 31, 253–259. [Google Scholar] [CrossRef]
- Zhang, H.; Wu, L.-M.; Wu, J. Cross-talk between apolipoprotein E and cytokines. Mediat. Inflamm. 2011, 2011, 1–10. [Google Scholar] [CrossRef]
- Ehlers, M.R. Immune-modulating effects of alpha-1 antitrypsin. Biol. Chem. 2014, 395, 1187–1193. [Google Scholar] [CrossRef]
- Mocchegiani, E.; Costarelli, L.; Giacconi, R.; Cipriano, C.; Muti, E.; Malavolta, M. Zinc-binding proteins (metallothionein and alpha-2 macroglobulin) and immunosenescence. Exp. Gerontol. 2006, 41, 1094–1107. [Google Scholar] [CrossRef] [PubMed]
- Gozzelino, R.; Soares, M.P. Coupling heme and iron metabolism via ferritin H chain. Antioxid. Redox Signal. 2014, 20, 1754–1769. [Google Scholar] [CrossRef] [PubMed]
- Gomme, P.T.; McCann, K.B. Transferrin: Structure, function and potential therapeutic actions. Drug Discov. Today 2005, 10, 267–273. [Google Scholar] [CrossRef]
- Meier, U.; Gressner, O.; Lammert, F.; Gressner, A.M. Gc-globulin: Roles in response to injury. Clin. Chem. 2006, 52, 1247–1253. [Google Scholar] [CrossRef] [PubMed]
- Gomez, H.; Ince, C.; De Backer, D.; Pickkers, P.; Payen, D.; Hotchkiss, J.; Kellum, J.A. A unified theory of sepsis-induced acute kidney injury: Inflammation, microcirculatory dysfunction, bioenergetics, and the tubular cell adaptation to injury. Shock 2014, 41, 3–11. [Google Scholar] [CrossRef] [PubMed]
- Pham, C.G.; Bubici, C.; Zazzeroni, F.; Papa, S.; Jones, J.; Alvarez, K.; Jayawardena, S.; de Smaele, E.; Cong, R.; Beaumont, C.; et al. Ferritin heavy chain upregulation by NF-κB inhibits TNFα-induced apoptosis by suppressing reactive oxygen species. Cell 2004, 119, 529–542. [Google Scholar] [CrossRef]
- Zarjou, A.; Bolisetty, S.; Joseph, R.; Traylor, A.; Apostolov, E.O.; Arosio, P.; Balla, J.; Verlander, J.; Darshan, D.; Kuhn, L.C.; et al. Proximal tubule h-ferritin mediates iron trafficking in acute kidney injury. J. Clin. Investig. 2013, 123, 4423–4434. [Google Scholar] [CrossRef]
- Bolisetty, S.; Zarjou, A.; Hull, T.D.; Traylor, A.M.; Perianayagam, A.; Joseph, R.; Kamal, A.I.; Arosio, P.; Soares, M.P.; Jeney, V.; et al. Macrophage and epithelial cell H-ferritin expression regulates renal inflammation. Kidney Int. 2015, 88, 95–108. [Google Scholar] [CrossRef]
- Hatcher, H.C.; Tesfay, L.; Torti, S.V.; Torti, F.M. Cytoprotective effect of ferritin H in renal ischemia reperfusion injury. PLoS ONE 2015, 10, e0138505. [Google Scholar] [CrossRef]
- Heemann, U.; Szabo, A.; Hamar, P.; Müller, V.; Witzke, O.; Lutz, J.; Philipp, T. Lipopolysaccharide pretreatment protects from renal ischemia/reperfusion injury: Possible connection to an interleukin-6-dependent pathway. Am. J. Pathol. 2000, 156, 287–293. [Google Scholar] [CrossRef]
- Kaucsár, T.; Bodor, C.; Godó, M.; Szalay, C.; Révész, C.; Németh, Z.; Mózes, M.; Szénási, G.; Rosivall, L.; Soti, C.; et al. LPS-induced delayed preconditioning is mediated by Hsp90 and involves the heat shock response in mouse kidney. PLoS ONE 2014, 9, e92004. [Google Scholar] [CrossRef] [PubMed]
- Sutton, T.A. Alteration of microvascular permeability in acute kidney injury. Microvasc. Res. 2009, 77, 4–7. [Google Scholar] [CrossRef] [PubMed]
- Goto, T.; Fujigaki, Y.; Sun, D.F.; Yamamoto, T.; Hishida, A. Plasma protein extravasation and vascular endothelial growth factor expression with endothelial nitric oxide synthase induction in gentamicin-induced acute renal failure in rats. Virchows Archiv 2004, 444, 362–374. [Google Scholar] [CrossRef] [PubMed]
- Sörensen, I.; Susnik, N.; Inhester, T.; Degen, J.L.; Melk, A.; Haller, H.; Schmitt, R. Fibrinogen, acting as a mitogen for tubulointerstitial fibroblasts, promotes renal fibrosis. Kidney Int. 2011, 80, 1035–1044. [Google Scholar] [CrossRef]
- Sörensen-Zender, I.; Rong, S.; Susnik, N.; Lange, J.; Gueler, F.; Degen, J.L.; Melk, A.; Haller, H.; Schmitt, R. Role of fibrinogen in acute ischemic kidney injury. Am. J. Physiol. Physiol. 2013, 305, F777–F785. [Google Scholar] [CrossRef]
- Zhou, H.; Chen, M.; Zhang, G.; Ye, R.D. Suppression of lipopolysaccharide-induced inflammatory response by fragments from serum amyloid A. J. Immunol. 2017, 199, 1105–1112. [Google Scholar] [CrossRef]
- Horvath, A.J.; Forsyth, S.L.; Coughlin, P.B. Expression patterns of murine antichymotrypsin-like genes reflect evolutionary divergence at the Serpina3 locus. J. Mol. Evol. 2004, 59, 488–497. [Google Scholar] [CrossRef]
- Ikeda, S.; Yamamoto, H.; Masuda, M.; Takei, Y.; Nakahashi, O.; Kozai, M.; Tanaka, S.; Nakao, M.; Taketani, Y.; Segawa, H.; et al. Downregulation of renal type IIa sodium-dependent phosphate cotransporter during lipopolysaccharide-induced acute inflammation. Am. J. Physiol. Physiol. 2014, 306, F744–F750. [Google Scholar] [CrossRef][Green Version]
- Vidmar, R.; Vizovišek, M.; Turk, D.; Turk, B.; Fonović, M. Protease cleavage site fingerprinting by label-free in-gel degradomics reveals pH-dependent specificity switch of legumain. EMBO J. 2017, 36, 2455–2465. [Google Scholar] [CrossRef]
- Sobotič, B.; Vizovišek, M.; Vidmar, R.; van Damme, P.; Gocheva, V.; Joyce, J.A.; Gevaert, K.; Turk, V.; Turk, B.; Fonović, M. Proteomic Identification of Cysteine Cathepsin Substrates Shed from the Surface of Cancer Cells. Mol. Cell. Proteom. 2015, 14, 2213–2228. [Google Scholar] [CrossRef]
- Cox, J.; Mann, M. MaxQuant enables high peptide identification rates, individualized p.p.b.-range mass accuracies and proteome-wide protein quantification. Nat. Biotechnol. 2008, 26, 1367–1372. [Google Scholar] [CrossRef] [PubMed]
- Deutsch, E.W.; Csordas, A.; Sun, Z.; Jarnuczak, A.; Perez-Riverol, Y.; Ternent, T.; Campbell, D.S.; Bernal-Llinares, M.; Okuda, S.; Kawano, S.; et al. The ProteomeXchange consortium in 2017: Supporting the cultural change in proteomics public data deposition. Nucleic Acids Res. 2017, 45, D1100–D1106. [Google Scholar] [CrossRef] [PubMed]
- Ashburner, M.; Ball, C.A.; Blake, J.A.; Botstein, D.; Butler, H.; Cherry, J.M.; Davis, A.P.; Dolinski, K.; Dwight, S.S.; Eppig, J.T.; et al. Gene Ontology: Tool for the unification of biology. Nat. Genet. 2000, 25, 25–29. [Google Scholar] [CrossRef] [PubMed]
- The Gene Ontology Consortium. The Gene Ontology Resource: 20 years and still GOing strong. Nucleic Acids Res. 2019, 47, D330–D338. [Google Scholar] [CrossRef]
- Mi, H.; Muruganujan, A.; Huang, X.; Ebert, D.; Mills, C.; Guo, X.; Thomas, P.D. Protocol update for large-scale genome and gene function analysis with the PANTHER classification system (v.14.0). Nat. Protoc. 2019, 14, 703. [Google Scholar] [CrossRef]
- Tang, H.; Thomas, P.D.; Kang, D.; Mills, C.; Muruganujan, A.; Huang, X.; Mi, H. PANTHER version 11: Expanded annotation data from Gene Ontology and Reactome pathways, and data analysis tool enhancements. Nucleic Acids Res. 2016, 45, D183–D189. [Google Scholar]
- Salgado, F.J.; Arias, P.; Canda-Sanchez, A.; Nogueir, M. Acute Phase Proteins as Biomarkers of Disease: From Bench to Clinical Practice. In Acute Phase Proteins as Early Non-Specific Biomarkers of Human and Veterinary Diseases; Veas, F., Ed.; InTech: London, UK, 2011; ISBN 978-953-307-873-1. [Google Scholar]
- Motulsky, H.J.; Brown, R.E. Detecting outliers when fitting data with nonlinear regression—A new method based on robust nonlinear regression and the false discovery rate. BMC Bioinform. 2006, 7, 123. [Google Scholar] [CrossRef]
EP1.5 | log2FC | EP6 | log2FC | |
---|---|---|---|---|
1 | GTPase HRas | 4.36 | GTPase HRas | 4.75 |
2 | Chitinase-like protein 3 | 3.60 | Chitinase-like protein 3 | 4.66 |
3 | Protein S100-A9 | 2.59 | Lipocalin-2 | 3.55 |
4 | Succinate-semialdehyde dehydrogenase, mitochondrial | 2.30 | H-2 class I histocompatibility antigen, L-D alpha chain | 3.31 |
5 | Mesencephalic astrocyte-derived neurotrophic factor | 2.29 | CD151 antigen | 3.28 |
6 | CD151 antigen | 2.27 | Protein S100-A9 | 3.12 |
7 | S-adenosylmethionine synthase isoform type-2 | 2.26 | Major urinary protein 3 | 2.78 |
8 | Proteasome subunit alpha type-7 | 2.20 | Transmembrane emp24 domain-containing protein 2 | 2.36 |
9 | Peptidyl-prolyl cis-trans isomerase FKBP3 | 2.13 | Proteasome subunit alpha type-7 | 2.20 |
10 | Transmembrane emp24 domain-containing protein 2 | 2.10 | Cytochrome c oxidase subunit 7C, mitochondrial | 2.04 |
LP24 | log2FC | LP48 | log2FC | |
---|---|---|---|---|
1 | Lipocalin-2 | 6.36 | H-2 class I histocompatibility antigen, L-D alpha chain | 6.03 |
2 | Complement C3 | 6.09 | Lipocalin-2 | 5.71 |
3 | Hemopexin | 5.90 | Hemopexin | 5.62 |
4 | Fibrinogen alpha chain | 5.85 | Complement C3 | 5.58 |
5 | H-2 class I histocompatibility antigen, L-D alpha chain | 5.69 | Interferon-inducible GTPase 1 | 5.19 |
6 | Fibrinogen gamma chain | 5.67 | Fibrinogen gamma chain | 5.12 |
7 | Fibrinogen beta chain | 5.62 | Haptoglobin | 5.01 |
8 | Interferon-inducible GTPase 1 | 5.59 | Interferon-induced guanylate-binding protein 2 | 4.86 |
9 | Interferon-induced guanylate-binding protein 2 | 5.57 | Fibrinogen alpha chain | 4.76 |
10 | Haptoglobin | 5.25 | Fibrinogen beta chain | 4.75 |
11 | T cell specific GTPase 1 | 5.21 | Immunity-related GTPase family M protein 1 | 4.14 |
12 | Inter alpha-trypsin inhibitor, heavy chain 4 | 4.83 | Serum amyloid A-2 protein | 3.54 |
13 | Immunity-related GTPase family M protein 1 | 4.66 | Major vault protein | 3.52 |
14 | Serine protease inhibitor A3K | 4.49 | Chitinase-like protein 3 | 3.46 |
15 | Alpha-2-macroglobulin | 4.21 | Beta-2-microglobulin | 3.45 |
16 | Chitinase-like protein 3 | 3.96 | Serine protease inhibitor A3K | 3.44 |
17 | Serum amyloid A-2 protein | 3.92 | T cell specific GTPase 1 | 3.28 |
18 | CD151 antigen | 3.82 | Alpha-1-acid glycoprotein 1, Alpha-1-acid glycoprotein 2 | 3.24 |
19 | Ceruloplasmin | 3.72 | Napsin-A | 3.21 |
20 | Major vault protein | 3.72 | Inter alpha-trypsin inhibitor, heavy chain 4 | 3.19 |
Saline | EP1.5 | EP6 | LP24 | LP48 | |
---|---|---|---|---|---|
Lcn-2 | 20.65 ± 1.10 | 20.31 ± 1.00 | 24.20 ± 0.23 *** | 27.01 ± 0.66 *** | 26.36 ± 0.77 *** |
C3 | 21.94 ± 1.69 | 23.29 ± 1.23 | 21.24 ± 1.20 | 28.03 ± 0.41 *** | 27.51 ± 0.69 *** |
Fga | 21.78 ± 1.61 | 23.20 ± 2.08 | 22.85 ± 1.77 | 27.63 ± 0.53 *** | 26.54 ± 0.67 *** |
Fgb | 21.53 ± 1.56 | 21.84 ± 0.85 | 21.36 ± 0.55 | 27.15 ± 0.74 *** | 26.28 ± 0.88 *** |
Fgg | 21.26 ± 1.89 | 22.06 ± 1.42 | 23.00 ± 1.58 | 26.93 ± 0.44 *** | 26.38 ± 0.55 *** |
Saa1 | 20.84 ± 0.79 | 21.03 ± 0.79 | 21.01 ± 0.59 | 23.09 ± 0.57 ** | 23.84 ± 0.92 *** |
Saa2 | 20.38 ± 0.50 | 19.77 ± 0.78 | 21.28 ± 0.34 | 24.30 ± 0.39 *** | 23.91 ± 1.09 *** |
Cp | 21.34 ± 1.15 | 20.52 ± 0.68 | 19.85 ± 0.79 | 25.06 ± 0.29 *** | 24.41 ± 0.50 *** |
Hp | 21.06 ± 0.62 | 20.53 ± 0.48 | 21.04 ± 1.10 | 26.31 ± 0.58 *** | 26.07 ± 0.76 *** |
Hpx | 22.15 ± 0.84 | 20.66 ± 0.37 | 21.91 ± 1.03 | 28.05 ± 0.27 *** | 27.77 ± 0.67 *** |
Itih4 | 20.77 ± 0.76 | 20.73 ± 0.92 | 21.14 ± 0.49 | 25.60 ± 0.51 *** | 23.96 ± 1.33 ** |
FHC | 23.57 ± 0.72 | 24.65 ± 0.47 * | 24.99 ± 0.28 ** | 26.36 ± 0.32 *** | 26.26 ± 0.43 *** |
Tf | 26.25 ± 1.26 | 27.36 ± 0.44 | 26.83 ± 0.46 | 28.51 ± 0.27 ** | 27.79 ± 0.47 * |
Alb | 29.60 ± 0.85 | 31.06 ± 0.51 * | 29.97 ± 0.29 | 31.82 ± 0.20 *** | 30.47 ± 0.50 |
Serpina1a,c | 23.84 ± 1.30 | 25.81 ± 0.70 * | 25.44 ± 0.37 | 26.84 ± 0.28 *** | 25.32 ± 0.34 * |
Serpina3k | 22.88 ± 2.55 | 26.04 ± 0.79 | 25.22 ± 0.96 | 27.37 ± 0.52 ** | 26.32 ± 0.91 * |
Serpina3n | 20.53 ± 0.75 | 20.83 ± 0.84 | 20.90 ± 0.47 | 23.27 ± 0.41 ** | 22.06 ± 1.18 |
A2m | 22.13 ± 1.92 | 23.45 ± 2.12 | 21.00 ± 0.52 | 26.34 ± 0.52 ** | 25.16 ± 1.37 * |
B2m | 20.80 ± 0.75 | 20.05 ± 0.49 | 21.82 ± 1.45 | 23.70 ± 0.24 *** | 24.25 ± 0.37 *** |
ApoA1 | 25.16 ± 1.35 | 26.48 ± 0.67 | 25.26 ± 0.34 | 27.30 ± 0.68 * | 26.22 ± 0.35 |
ApoE | 20.42 ± 1.10 | 21.58 ± 1.12 | 20.58 ± 0.95 | 22.70 ± 1.20 * | 21.46 ± 0.81 |
A1AGP | 20.12 ± 0.96 | 20.25 ± 0.58 | 20.57 ± 0.56 | 21.12 ± 1.02 | 23.36 ± 0.55 *** |
Itih1 | 20.10 ± 0.68 | 21.14 ± 0.50 | 21.08 ± 1.02 | 21.32 ± 0.36 * | 21.10 ± 0.69 |
DBP | 20.54 ± 0.75 | 21.04 ± 0.45 | 20.46 ± 0.29 | 22.78 ± 0.50 *** | 21.33 ± 0.37 |
Vwa5a | 20.75 ± 0.56 | 20.56 ± 0.58 | 20.44 ± 0.69 | 22.29 ± 1.57 | 23.08 ± 0.12 * |
GO Biological Process (LP24) | No. of Entities | p-Value | GO Biological Process (LP48) | No. of Entities | p-Value | |
---|---|---|---|---|---|---|
1 | response to stress | 16 | 9.68 × 10−8 | response to stress | 16 | 1.88 × 10−7 |
2 | immune system process | 15 | 1.22 × 10−8 | immune system process | 15 | 2.29 × 10−8 |
3 | defense response | 14 | 1.07 × 10−10 | defense response | 14 | 1.96 × 10−10 |
4 | response to chemical | 13 | 8.72 × 10−5 | immune response | 13 | 5.30 × 10−9 |
5 | immune response | 12 | 3.84 × 10−8 | response to organic substance | 12 | 2.26 × 10−5 |
6 | response to organic substance | 12 | 1.47 × 10−5 | cellular response to chemical stimulus | 12 | 1.09 × 10−5 |
7 | cellular response to chemical stimulus | 12 | 7.03 × 10−6 | innate immune response | 11 | 9.75 × 10−10 |
8 | innate immune response | 11 | 6.24 × 10−10 | cellular response to organic substance | 11 | 6.32 × 10−6 |
9 | multi-organism process | 11 | 2.76 × 10−5 | multi-organism process | 11 | 4.06 × 10−5 |
10 | response to external stimulus | 11 | 1.36 × 10−5 | response to external stimulus | 11 | 2.02 × 10−5 |
Target | Forward Primer | Reverse Primer |
---|---|---|
Fga | TGAGCCATCCCTAAACGCAG | GCCAGTCTGAGTCCTTGCAT |
Fgb | GGCTTCACGGTACAGAACGA | ATTTGGATTGGCTGCATGGC |
Fgg | ATGAACAAATGTCACGCAGGC | TCAACTTCATGATCCACGCTGA |
C3 | ATCCAGACAGACCAGACCATCT | AGGATGACGACTGTCTTGCC |
Cp | AGGCCCTGATGAGGAACATCT | TGCTGTGAGGAGCGACCT |
Hp | GTGGAGCACTTGGTTCGCTA | CCATAGAGCCACCGATGATGC |
Hpx | CGCTACTACTGCTTCCAGGG | AGCTATGCCATCCATCACGG |
FHC | CCCTTTGCAACTTCGTCGTTC | GAGCCACATCATCTCGGTCAA |
Tf | CCCAAGGATGGACTACAGGC | TGATGCTCCACTCGTCACAC |
Saa | GCAGGATGAAGCTACTCACCA | TGGTCAGCAATGGTGTCCTC |
Itih4 | TCCGTTGCAGCACAATATCCT | TCACTTCGAGCCACGAGAAC |
Alb | TTGGCAACAGACCTGACCAA | GTGTCATGCTCCACCTCACT |
Serpina1 | TTCCAACACCTCCTCCAAAC | CACCGCCTCAGCTATCTTTC |
Serpina1a | TCAATTCAGTGTCCTCTCCAGC | AAGTCTCCCAGGTTTGTAGCG |
Serpina1c | CCAGAAGGTTAGCCCAGATCCAC | GGCATAGAATAAGGAACGGCTAGT |
Serpina3k | CAGCAGGACAGATTCCAGCC | AGGAGTCAGCTATCACAGAGGC |
Chil3 | AGAAGCTCTCCAGAAGCAATCC | TCAGCTGGTAGGAAGATCCCA |
Lcn-2 | AGGTGGTACGTTGTGGGC | CTGTACCTGAGGATACCTGTG |
TNF-α | AAATGGCCTCCCTCTCATCA | AGATAGCAAATCGGCTGACG |
IL-6 | GATGCTACCAAACTGGATATAATC | GGTCCTTAGCCACTCCTTCTGTG |
GAPDH | CCAGAATGAGGATCCCAGAA | ACCACCTGAAACATGCAACA |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Róka, B.; Tod, P.; Kaucsár, T.; Vizovišek, M.; Vidmar, R.; Turk, B.; Fonović, M.; Szénási, G.; Hamar, P. The Acute Phase Response Is a Prominent Renal Proteome Change in Sepsis in Mice. Int. J. Mol. Sci. 2020, 21, 200. https://doi.org/10.3390/ijms21010200
Róka B, Tod P, Kaucsár T, Vizovišek M, Vidmar R, Turk B, Fonović M, Szénási G, Hamar P. The Acute Phase Response Is a Prominent Renal Proteome Change in Sepsis in Mice. International Journal of Molecular Sciences. 2020; 21(1):200. https://doi.org/10.3390/ijms21010200
Chicago/Turabian StyleRóka, Beáta, Pál Tod, Tamás Kaucsár, Matej Vizovišek, Robert Vidmar, Boris Turk, Marko Fonović, Gábor Szénási, and Péter Hamar. 2020. "The Acute Phase Response Is a Prominent Renal Proteome Change in Sepsis in Mice" International Journal of Molecular Sciences 21, no. 1: 200. https://doi.org/10.3390/ijms21010200
APA StyleRóka, B., Tod, P., Kaucsár, T., Vizovišek, M., Vidmar, R., Turk, B., Fonović, M., Szénási, G., & Hamar, P. (2020). The Acute Phase Response Is a Prominent Renal Proteome Change in Sepsis in Mice. International Journal of Molecular Sciences, 21(1), 200. https://doi.org/10.3390/ijms21010200