Comprehensive Analysis of Differentially Expressed mRNA, lncRNA and circRNA and Their ceRNA Networks in the Longissimus Dorsi Muscle of Two Different Pig Breeds
Abstract
:1. Introduction
2. Results
2.1. Predictions and Properties of lncRNAs and circRNAs in Porcine LD Muscle
2.2. Expressional Difference of mRNA, lncRNAs and circRNAs between HN and DLY Pigs
2.3. Functional Analysis of DEMs and DECs
2.4. Construction of a Potential lncRNA/circRNA-miRNA-mRNA Regulatory Network
2.5. Validation of the Expressional Level of the MYOD1-related Competitive Endogenous RNA (ceRNA)
3. Discussion
4. Materials and Methods
4.1. Ethics Approval
4.2. Experimental Animals and Sample Collection
4.3. Total RNA Isolation and Illumina Sequencing
4.4. Read Mapping and Transcript Assembly
4.5. Identification of lncRNA
4.6. Identification of circRNA
4.7. Differentially Expressed RNA Identification and Pathway Analysis
4.8. Construction of the lncRNA/circRNA-miRNA-mRNA Network
4.9. Reverse Transcription Quantitative PCR (RT-qPCR)
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
Abbreviations
| BCLAF1 | Apoptosis regulator (BCL2)-associated transcription factor 1 |
| c-JUN | c-Jun Proto-Oncogene |
| DIAPH3 | Diaphanous-related formin-3 |
| DEMs | Differentially expressed mRNAs |
| Linc-MD1 | Muscle-specific long noncoding RNA |
| ceRNA | Competitive endogenous RNA |
| circRNA | Circular RNA |
| CNCICOL3A1 | Coding-Non-Coding-IndexCollagen type III alpha 1 |
| CPC | Coding Potential Calculator |
| DDO | D-aspartate oxidase |
| DECs | Differentially expressed circRNAs |
| DELs | Differentially expressed lncRNAs |
| DLY | Duroc × Landrace × Yorkshire |
| EBF2 | EBF transcription factor 2 |
| FABP4 | Fatty acid binding protein 4 |
| FGFR4 | Fibroblast growth factor receptor 4 |
| FoxO1 | Forkhead box O1 |
| FPKM | Fragments per kilo base per million read |
| GAPDH | Glyceraldehyde-3-phosphate dehydrogenase |
| GFPT1 | Glutamine-fructose-6-phosphate transaminase 1 |
| GO | Gene Ontology |
| HN | Huainan |
| IGF1R | Insulin-like growth factor 1 receptor |
| IGF2 | Insulin-like growth factor 2 |
| IMF | Intramuscular fat |
| KEGG | Kyoto Encyclopedia of Genes and Genomes |
| LD | Longissimus dorsi |
| LPIN1 | Lipin 1 |
| LncRNA | Long non-coding RNA |
| LncRNA ADNCR | Adipocyte differentiation-associated lncRNA |
| MAML1 | Mammalian Mastermind-like 1 |
| MEF2C | Myocyte enhancer factor-2C |
| miRNA | Micro RNA |
| MREs | MiRNA response elements |
| mtDNA | Mitochondrial DNA |
| MUFA | Monounsaturated fatty acids |
| MYOD1 | Myogenic differentiation 1 |
| NCOA3 | Nuclear receptor co-activator 3 |
| ncRNAs | Non-coding RNAs |
| PDGFRα | Platelet-derived growth factor receptor alpha |
| PLEK | k-mer scheme |
| PPARD | Peroxisome proliferator-activated receptor delta |
| PPARG | Peroxisome proliferator-activated receptor gamma |
| PRC2 | Polycomb repressive complex 2 |
| RIN | RNA integrity number |
| RPM | Reads per million mapped reads |
| rRNA | Ribosomal RNA |
| RT-qPCR | Reverse transcription quantitative PCR |
| SFA | Saturated fatty acids |
| TGF-β1 | Transforming growth factor beta 1 |
| TOBF1 | Transient octamer binding factor 1 |
| VSMCs | Vascular smooth muscle cells |
References
- Nonneman, D.J.; Shackelford, S.D.; King, D.A.; Wheeler, T.L.; Wiedmann, R.T.; Snelling, W.M.; Rohrer, G.A. Genome-wide association of meat quality traits and tenderness in swine. J. Anim. Sci. 2013, 91, 4043–4050. [Google Scholar] [CrossRef] [PubMed]
- Rosenvold, K.; Andersen, H.J. Factors of significance for pork quality—A review. Meat Sci. 2003, 64, 219–237. [Google Scholar] [CrossRef]
- Liu, X.X.; Xiong, X.W.; Yang, J.; Zhou, L.S.; Yang, B.; Ai, H.S.; Ma, H.B.; Xie, X.H.; Huang, Y.X.; Fang, S.M.; et al. Genome-wide association analyses for meat quality traits in Chinese Erhualian pigs and a Western Duroc × (Landrace × Yorkshire) commercial population. Genet. Sel. Evol. 2015, 47, 44. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Hua, L.S.; Chen, J.F.; Zhang, J.Q.; Bai, X.X.; Gao, B.W.; Li, C.J.; Shi, Z.H.; Sheng, W.D.; Gao, Y.; et al. Identification and characterization of long non-coding RNAs in subcutaneous adipose tissue from castrated and intact full-sib pair Huainan male pigs. BMC Genom. 2017, 542. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Yan, X.L.; Liu, R.; Fu, Q.Q.; Zhou, G.H.; Zhang, W.G. Differences in calpain system, desmin degradation and water holding capacity between commercial Meishan and Duroc × Landrace × Yorkshire crossbred pork. Anim. Sci. J. 2016, 87, 109–116. [Google Scholar] [CrossRef] [PubMed]
- Shen, L.Y.; Chen, L.; Zhang, S.H.; Zhang, Y.; Wang, J.Y.; Zhu, L. MicroRNA-23a reduces slow myosin heavy chain isoforms composition through myocyte enhancer factor 2C (MEF2C) and potentially influences meat quality. Meat. Sci. 2016, 116, 201–206. [Google Scholar] [CrossRef] [PubMed]
- Chuan-Hao, L.; Wei, C.; Jia-Qing, H.; Yan-Dong, W.; Shou-Dong, W.; Yong-Qing, Z.; Hui, W. MiRNA-29a targets COL3A1 to regulate the level of type III collagen in pig. Gene 2016, 592, 140–147. [Google Scholar] [CrossRef] [PubMed]
- Han, H.Y.; Gu, S.H.; Chu, W.W.; Sun, W.X.; Wei, W.; Dang, X.Y.; Tian, Y.; Liu, K.Q.; Chen, J. MiR-17-5p regulates differential expression of NCOA3 in pig intramuscular and subcutaneous adipose tissue. Lipids 2017, 52, 939–949. [Google Scholar] [CrossRef] [PubMed]
- Sun, Y.M.; Qin, J.; Liu, S.G.; Cai, R.; Chen, X.C.; Wang, X.M.; Pang, W.J. PDGFRalpha regulated by miR-34a and FoxO1 promotes adipogenesis in porcine intramuscular preadipocytes through erk signaling pathway. Int. J. Mol. Sci. 2017, 18, 2424. [Google Scholar] [CrossRef] [PubMed]
- Wei, W.; Li, B.J.; Liu, K.Q.; Jiang, A.W.; Dong, C.; Jia, C.; Chen, J.; Liu, H.L.; Wu, W.J. Identification of key microRNAs affecting drip loss in porcine longissimus dorsi by RNA-Seq. Gene 2018, 647, 276–282. [Google Scholar] [CrossRef] [PubMed]
- Du, J.J.; Xu, Y.; Zhang, P.W.; Zhao, X.; Gan, M.L.; Li, Q.; Ma, J.D.; Tang, G.Q.; Jiang, Y.Z.; Wang, J.Y.; et al. MicroRNA-125a-5p affects adipocytes proliferation, differentiation and fatty acid composition of porcine intramuscular fat. Int. J. Mol. Sci. 2018, 19, 501. [Google Scholar] [CrossRef] [PubMed]
- Sun, Y.; Chen, X.; Qin, J.; Liu, S.; Zhao, R.; Yu, T.; Chu, G.; Yang, G. Comparative analysis of long noncoding RNAs expressed during intramuscular adipocytes adipogenesis in fat-type and lean-type pigs. J. Agric. Food Chem. 2018, 66, 12122–12130. [Google Scholar] [CrossRef] [PubMed]
- Yu, X.; Wang, Z.; Sun, H.; Yang, Y.; Li, K.; Tang, Z.L. Long non-coding MEG3 is a marker for skeletal muscle development and meat production traits in pigs. Anim. Genet. 2018, 49, 571–578. [Google Scholar] [CrossRef] [PubMed]
- Jin, J.J.; Lv, W.; Xia, P.; Xu, Z.Y.; Zheng, A.D.; Wang, X.J.; Wang, S.S.; Zeng, R.; Luo, H.M.; Li, G.L. Long noncoding RNA SYISL regulates myogenesis by interacting with polycomb repressive complex 2. Proc. Natl. Acad. Sci. USA 2018, 115, E9802–E9811. [Google Scholar] [CrossRef] [PubMed]
- Guo, Y.W.; Wang, J.N.; Zhu, M.F.; Zeng, R.; Xu, Z.Y.; Li, G.L.; Zuo, B. Identification of MyoD-responsive transcripts reveals a novel long non-coding RNA (lncRNA-AK143003) that negatively regulates myoblast differentiation. Sci. Rep. 2017, 7, 2828. [Google Scholar] [CrossRef] [PubMed]
- Wei, N.; Wang, Y.; Xu, R.X.; Wang, G.Q.; Xiong, Y.; Yu, T.Y.; Yang, G.S.; Pang, W.J. PU. 1 antisense lncRNA against its mRNA translation promotes adipogenesis in porcine preadipocytes. Anim. Genet. 2015, 46, 133–140. [Google Scholar] [CrossRef] [PubMed]
- Xu, J.Y.; Chang, N.B.; Rong, Z.H.; Li, T.; Xiao, L.; Yao, Q.P.; Jiang, R.; Jiang, J. CircDiaph3 regulates rat vascular smooth muscle cell differentiation, proliferation, and migration. Faseb. J. 2018, 33, 2659–2668. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.H.; Li, M.L.; Wang, Y.H.; Liu, J.; Zhang, M.L.; Fang, X.T.; Chen, H.; Zhang, C.L. A Zfp609 circular RNA regulates myoblast differentiation by sponging miR-194-5p. Int. J. Biol. Macromol. 2019, 121, 1308–1313. [Google Scholar] [CrossRef] [PubMed]
- Ouyang, H.J.; Chen, X.L.; Li, W.M.; Li, Z.H.; Nie, Q.H.; Zhang, X.Q. Circular RNA circSVIL promotes Myoblast proliferation and differentiation by sponging miR-203 in chicken. Front. Genet. 2018, 9, 172. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Wei, X.F.; Yang, J.M.; Dong, D.; Hao, D.; Huang, Y.Z.; Lan, X.Y.; Plath, M.; Lei, C.Z.; Ma, Y.; et al. CircFGFR4 promotes differentiation of Myoblasts via binding miR-107 to relieve its inhibition of Wnt3a. Mol. Ther. Nucleic Acids 2018, 11, 272–283. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; Liu, K.Q.; Shan, B.S.; Wei, S.J.; Li, D.F.; Han, H.Y.; Wei, W.; Chen, J.; Liu, H.L.; Zhang, L.F. A genome-wide landscape of mRNAs, lncRNAs, and circRNAs during subcutaneous adipogenesis in pigs. J. Anim. Plant Sci. 2018, 9, 76. [Google Scholar] [CrossRef] [PubMed]
- Li, A.; Huang, W.L.; Zhang, X.X.; Xie, L.L.; Miao, X.Y. Identification and characterization of CircRNAs of two pig breeds as a new biomarker in metabolism-related diseases. Cell Physiol. Biochem. 2018, 47, 2458–2470. [Google Scholar] [CrossRef] [PubMed]
- Guo, X.Y.; He, C.X.; Wang, Y.Q.; Sun, C.; Li, G.M.; Su, Q. Circular RNA profiling and bioinformatic modeling identify its regulatory role in hepatic steatosis. Bio. Res. Int. 2017, 2017, 5936171. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.Y.; Zhu, L.; Bai, M.; Liu, Y.; Zhan, Y.; Deng, T.; Yang, H.O.; Sun, W.; Wang, X.Y.; Zhu, K.G.; et al. Exosomal circRNA derived from gastric tumor promotes white adipose browning by targeting the miR-133/PRDM16 pathway. Int. J. Cancer 2018. [Google Scholar] [CrossRef] [PubMed]
- Memczak, S.; Jens, M.; Elefsinioti, A.; Torti, F.; Krueger, J.; Rybak, A.; Maier, L.; Mackowiak, S.D.; Gregersen, L.H.; Munschauer, M.; et al. Circular RNAs are a large class of animal RNAs with regulatory potency. Nature 2013, 495, 333–338. [Google Scholar] [CrossRef] [PubMed]
- Zhao, W.M.; Mu, Y.L.; Ma, L.; Wang, C.; Tang, Z.L.; Yang, S.L.; Zhou, R.; Hu, X.J.; Li, M.H.; Li, K. Systematic identification and characterization of long intergenic non-coding RNAs in fetal porcine skeletal muscle development. Sci. Rep. 2015, 5, 8957. [Google Scholar] [CrossRef] [PubMed]
- Joo, S.T.; Kim, G.D.; Hwang, Y.H.; Ryu, Y.C. Control of fresh meat quality through manipulation of muscle fiber characteristics. Meat. Sci. 2013, 95, 828–836. [Google Scholar] [CrossRef] [PubMed]
- Ryu, Y.C.; Kim, B.C. Comparison of histochemical characteristics in various pork groups categorized by postmortem metabolic rate and pork quality. J. Anim. Sci. 2006, 84, 894–901. [Google Scholar] [CrossRef] [PubMed]
- Song, K.X.; Wang, S.X.; Mani, M.; Mani, A. Wnt signaling, de novo lipogenesis, adipogenesis and ectopic fat. Oncotarget 2014, 5, 11000–11003. [Google Scholar] [CrossRef] [PubMed]
- Kurihara, K. Glutamate: from discovery as a food flavor to role as a basic taste (umami). Am. J. Clin. Nutr. 2009, 90, 719s–722s. [Google Scholar] [CrossRef] [PubMed]
- Wu, T.; Zhang, Z.H.; Yuan, Z.Q.; Lo, L.J.; Chen, J.; Wang, Y.Z.; Peng, J.R. Distinctive genes determine different intramuscular fat and muscle fiber ratios of the longissimus dorsi muscles in Jinhua and landrace pigs. PLoS ONE 2013, 8, e53181. [Google Scholar] [CrossRef] [PubMed]
- Long, Y.; Wang, X.; Youmans, D.T.; Cech, T.R. How do lncRNAs regulate transcription? Sci. Adv. 2017, 3, eaao2110. [Google Scholar] [CrossRef] [PubMed]
- Marchese, F.P.; Raimondi, I.; Huarte, M. The multidimensional mechanisms of long noncoding RNA function. Genome Biol. 2017, 18, 206. [Google Scholar] [CrossRef] [PubMed]
- Chakraborty, D.; Paszkowski-Rogacz, M.; Berger, N.; Ding, L.; Mircetic, J.; Fu, J.; Iesmantavicius, V.; Choudhary, C.; Anastassiadis, K.; Stewart, A.F.; et al. LncRNA Panct1 maintains mouse embryonic stem cell identity by regulating TOBF1 recruitment to oct-sox sequences in early G1. Cell Rep. 2017, 21, 3012–3021. [Google Scholar] [CrossRef] [PubMed]
- Zhu, E.D.; Zhang, J.J.; Li, Y.C.; Yuan, H.R.; Zhou, J.; Wang, B.L. Long noncoding RNA Plnc1 controls adipocyte differentiation by regulating peroxisome proliferator-activated receptor gamma. Faseb J. 2019, 33, 2396–2408. [Google Scholar] [CrossRef] [PubMed]
- Zhao, X.Y.; Li, S.; Wang, G.X.; Yu, Q.; Lin, J.D. A long noncoding RNA transcriptional regulatory circuit drives thermogenic adipocyte differentiation. Mol. Cell 2014, 55, 372–382. [Google Scholar] [CrossRef] [PubMed]
- Cai, R.; Sun, Y.M.; Qimuge, N.R.; Wang, G.Q.; Wang, Y.Q.; Chu, G.Y.; Yu, T.Y.; Yang, G.S.; Pang, W.J. Adiponectin AS lncRNA inhibits adipogenesis by transferring from nucleus to cytoplasm and attenuating adiponectin mRNA translation. Biochim. Biophys. Acta Mol. Cell Biol. Lipids 2018, 1863, 420–432. [Google Scholar] [CrossRef] [PubMed]
- Li, M.X.; Sun, X.M.; Cai, H.F.; Sun, Y.J.; Plath, M.; Li, C.J.; Lan, X.Y.; Lei, C.Z.; Lin, F.; Bai, Y.Y.; et al. Long non-coding RNA ADNCR suppresses adipogenic differentiation by targeting miR-204. Biochim. Biophys. Acta 2016, 1859, 871–882. [Google Scholar] [CrossRef] [PubMed]
- Song, C.C.; Wang, J.; Ma, Y.L.; Yang, Z.X.; Dong, D.; Li, H.; Yang, J.M.; Huang, Y.Z.; Plath, M.; Ma, Y.; et al. Linc-smad7 promotes myoblast differentiation and muscle regeneration via sponging miR-125b. Epigenetics 2018, 13, 591–604. [Google Scholar] [CrossRef] [PubMed]
- Zhou, B.; Yu, J.W. A novel identified circular RNA, circRNA_010567, promotes myocardial fibrosis via suppressing miR-141 by targeting TGF-beta1. Biochem. Biophys. Res. Commun. 2017, 487, 769–775. [Google Scholar] [CrossRef] [PubMed]
- Kim, D.J.; Bility, M.T.; Billin, A.N.; Willson, T.M.; Gonzalez, F.J.; Peters, J.M. PPARbeta/delta selectively induces differentiation and inhibits cell proliferation. Cell Death Differ. 2006, 13, 53–60. [Google Scholar] [CrossRef] [PubMed]
- Chen, L.H.; Yang, G.R. PPARs integrate the mammalian clock and energy metabolism. PPAR Res. 2014, 2014, 653017. [Google Scholar] [CrossRef] [PubMed]
- Nielsen, M.; Hansen, J.H.; Hedegaard, J.; Nielsen, R.O.; Panitz, F.; Bendixen, C.; Thomsen, B. MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing. Anim. Genet. 2010, 41, 159–168. [Google Scholar] [CrossRef] [PubMed]
- Reiner, G.; Heinricy, L.; Muller, E.; Geldermann, H.; Dzapo, V. Indications of associations of the porcine FOS proto-oncogene with skeletal muscle fibre traits. Anim. Genet. 2002, 33, 49–55. [Google Scholar] [CrossRef] [PubMed]
- Guo, Y.T.; Zhang, X.X.; Huang, W.L.; Miao, X.Y. Identification and characterization of differentially expressed miRNAs in subcutaneous adipose between Wagyu and Holstein cattle. Sci. Rep. 2017, 7, 44026. [Google Scholar] [CrossRef] [PubMed]
- Kuo, R.I.; Tseng, E.; Eory, L.; Paton, I.R.; Archibald, A.L.; Burt, D.W. Normalized long read RNA sequencing in chicken reveals transcriptome complexity similar to human. BMC Genom. 2017, 18, 323. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.H.; Ge, W.; Luo, Z.X.; Guo, Y.; Jiao, B.L.; Qu, L.; Zhang, Z.Y.; Wang, X. Integrated analysis of coding genes and non-coding RNAs during hair follicle cycle of cashmere goat (Capra hircus). BMC Genom. 2017, 18, 767. [Google Scholar] [CrossRef] [PubMed]
- Qu, X.Y.; Dang, X.M.; Wang, W.J.; Li, Y.; Xu, D.; Shang, D.; Chang, Y. Long noncoding RNAs and mRNA regulation in peripheral blood mononuclear cells of patients with chronic obstructive pulmonary disease. Mediat. Inflamm. 2018, 2018, 1–14. [Google Scholar] [CrossRef] [PubMed]
- Dou, Y.H.; Zhu, Y.; Ai, J.M.; Chen, H.K.; Liu, H.L.; Borgia, J.A.; Li, X.; Yang, F.; Jiang, B.; Wang, J.; Deng, Y.P. Plasma small ncRNA pair panels as novel biomarkers for early-stage lung adenocarcinoma screening. BMC Genom. 2018, 19, 545. [Google Scholar] [CrossRef] [PubMed]
- Yang, H.; Xu, X.L.; Ma, H.M.; Jiang, J. Integrative analysis of transcriptomics and proteomics of skeletal muscles of the Chinese indigenous Shaziling pig compared with the Yorkshire breed. BMC Genet. 2016, 17, 80. [Google Scholar] [CrossRef] [PubMed]
- Xu, Y.J.; Jin, M.L.; Wang, L.J.; Zhang, A.D.; Zuo, B.; Xu, D.Q.; Ren, Z.Q.; Lei, M.G.; Mo, X.Y.; Li, F.E.; et al. Differential proteome analysis of porcine skeletal muscles between Meishan and Large White. J. Anim. Sci. 2009, 87, 2519–2527. [Google Scholar] [CrossRef] [PubMed]
- Li, M.Z.; Wu, H.L.; Luo, Z.G.; Xia, Y.D.; Guan, J.Q.; Wang, T.; Gu, Y.R.; Chen, L.; Zhang, K.; Ma, J.D.; et al. An atlas of DNA methylomes in porcine adipose and muscle tissues. Nat. Commun. 2012, 3, 850. [Google Scholar] [CrossRef] [PubMed]
- Cock, P.J.; Fields, C.J.; Goto, N.; Heuer, M.L.; Rice, P.M. The Sanger FASTQ file format for sequences with quality scores, and the Solexa/Illumina FASTQ variants. Nucleic Acids Res. 2010, 38, 1767–1771. [Google Scholar] [CrossRef] [PubMed]
- Kim, D.; Pertea, G.; Trapnell, C.; Pimentel, H.; Kelley, R.; Salzberg, S.L. TopHat2: accurate alignment of transcriptomes in the presence of insertions, deletions and gene fusions. Genome Biol. 2013, 14, R36. [Google Scholar] [CrossRef] [PubMed]
- Trapnell, C.; Williams, B.A.; Pertea, G.; Mortazavi, A.; Kwan, G.; van Baren, M.J.; Salzberg, S.L.; Wold, B.J.; Pachter, L. Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation. Nat. Biotechnol. 2010, 28, 511–515. [Google Scholar] [CrossRef] [PubMed]
- Ghosh, S.; Chan, C.K. Analysis of RNA-seq data using TopHat and cufflinks. Methods Mol. Biol. 2016, 1374, 339–361. [Google Scholar] [PubMed]
- Kong, L.; Zhang, Y.; Ye, Z.Q.; Liu, X.Q.; Zhao, S.Q.; Wei, L.; Gao, G. CPC: assess the protein-coding potential of transcripts using sequence features and support vector machine. Nucleic Acids Res. 2007, 35, W345–W349. [Google Scholar] [CrossRef] [PubMed]
- Sun, L.; Luo, H.T.; Bu, D.C.; Zhao, G.G.; Yu, K.T.; Zhang, C.H.; Liu, Y.N.; Chen, R.S.; Zhao, Y. Utilizing sequence intrinsic composition to classify protein-coding and long non-coding transcripts. Nucleic Acids Res. 2013, 41, e166. [Google Scholar] [CrossRef] [PubMed]
- Finn, R.D.; Bateman, A.; Clements, J.; Coggill, P.; Eberhardt, R.Y.; Eddy, S.R.; Heger, A.; Hetherington, K.; Holm, L.; Mistry, J.; et al. Pfam: the protein families database. Nucleic Acids Res. 2014, 42, D222–D230. [Google Scholar] [CrossRef] [PubMed]
- Li, A.M.; Zhang, J.Y.; Zhou, Z.Y. PLEK: A tool for predicting long non-coding RNAs and messenger RNAs based on an improved k-mer scheme. BMC Bioinform. 2014, 15, 311. [Google Scholar] [CrossRef] [PubMed]
- Huang da, W.; Sherman, B.T.; Lempicki, R.A. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat. Protoc. 2009, 4, 44–57. [Google Scholar] [CrossRef] [PubMed]
- Pasquinelli, A.E. MicroRNAs and their targets: recognition, regulation and an emerging reciprocal relationship. Nat. Rev. Genet. 2012, 13, 271–282. [Google Scholar] [CrossRef] [PubMed]
- Hou, X.H.; Yang, Y.L.; Zhu, S.Y.; Hua, C.J.; Zhou, R.; Mu, Y.L.; Tang, Z.L.; Li, K. Comparison of skeletal muscle miRNA and mRNA profiles among three pig breeds. Mol. Genet. Genom. 2016, 291, 559–573. [Google Scholar] [CrossRef] [PubMed]
- Saito, R.; Smoot, M.E.; Ono, K.; Ruscheinski, J.; Wang, P.L.; Lotia, S.; Pico, A.R.; Bader, G.D.; Ideker, T. A travel guide to cytoscape plugins. Nat. Methods 2012, 9, 1069–1076. [Google Scholar] [CrossRef] [PubMed]
- Liao, B.J.; Bao, X.C.; Liu, L.Q.; Feng, S.P.; Zovoilis, A.; Liu, W.B.; Xue, Y.T.; Cai, J.; Guo, X.P.; Qin, B.M.; et al. MicroRNA cluster 302-367 enhances somatic cell reprogramming by accelerating a mesenchymal-to-epithelial transition. J. Biol. Chem. 2011, 286, 17359–17364. [Google Scholar] [CrossRef] [PubMed]
- Zhang, C.L.; Wu, H.; Wang, Y.H.; Zhu, S.Q.; Liu, J.Q.; Fang, X.T.; Chen, H. Circular RNA of cattle casein genes are highly expressed in bovine mammary gland. J. Dairy Sci. 2016, 99, 4750–4760. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]







| Name | Location | Sequence (5′–3′) | Size (bp) |
|---|---|---|---|
| MYOD1 | chr2:44482283|44485063 | F: AAGTCAACGAGGCCTTCGAG R: GGGGGCCGCTATAATCCATC | 279 |
| TCON_00034808 | chr9:150794507|150796156 | F: CCCCTGTTTACTCACCGTGT R: CCCTCCGTGGCATTTACAGA | 94 |
| TCON_00016662 | chr17:69254966|69256307 | F: TGGAAATCTAATCCTGCGTCTT R: GCGGAAACTCTGCTCCCTAG | 105 |
| circRNA_2155 | chr13:217685619|217779051 | F: ATCTTGGTCGTGCTCCTGG R: CGTGGTTAGTTTCTGCGTTGG | 243 |
| circRNA_1203 | chr11:85020089|85113533 | F: TGTGACATCCCTCTGTACGAC R: GGGAACGGCTTTCTCGT | 108 |
| circRNA_6453 | chr7:24644089|24722398 | F: CGCGGGTACAGTCAGTTTGG R: GGTCACATGTGTCTTTGGAGG | 240 |
| GAPDH | chr5:66446302|66449510 | F: CTGCCCCTTCTGCTGATGC R: TCCACGATGCCGAAGTTGTC | 151 |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, J.; Ren, Q.; Hua, L.; Chen, J.; Zhang, J.; Bai, H.; Li, H.; Xu, B.; Shi, Z.; Cao, H.; et al. Comprehensive Analysis of Differentially Expressed mRNA, lncRNA and circRNA and Their ceRNA Networks in the Longissimus Dorsi Muscle of Two Different Pig Breeds. Int. J. Mol. Sci. 2019, 20, 1107. https://doi.org/10.3390/ijms20051107
Wang J, Ren Q, Hua L, Chen J, Zhang J, Bai H, Li H, Xu B, Shi Z, Cao H, et al. Comprehensive Analysis of Differentially Expressed mRNA, lncRNA and circRNA and Their ceRNA Networks in the Longissimus Dorsi Muscle of Two Different Pig Breeds. International Journal of Molecular Sciences. 2019; 20(5):1107. https://doi.org/10.3390/ijms20051107
Chicago/Turabian StyleWang, Jing, Qiaoling Ren, Liushuai Hua, Junfeng Chen, Jiaqing Zhang, Hongjie Bai, Haili Li, Bin Xu, Zhihai Shi, Hai Cao, and et al. 2019. "Comprehensive Analysis of Differentially Expressed mRNA, lncRNA and circRNA and Their ceRNA Networks in the Longissimus Dorsi Muscle of Two Different Pig Breeds" International Journal of Molecular Sciences 20, no. 5: 1107. https://doi.org/10.3390/ijms20051107
APA StyleWang, J., Ren, Q., Hua, L., Chen, J., Zhang, J., Bai, H., Li, H., Xu, B., Shi, Z., Cao, H., Xing, B., & Bai, X. (2019). Comprehensive Analysis of Differentially Expressed mRNA, lncRNA and circRNA and Their ceRNA Networks in the Longissimus Dorsi Muscle of Two Different Pig Breeds. International Journal of Molecular Sciences, 20(5), 1107. https://doi.org/10.3390/ijms20051107
