A Growth Factor-Free Co-Culture System of Osteoblasts and Peripheral Blood Mononuclear Cells for the Evaluation of the Osteogenesis Potential of Melt-Electrowritten Polycaprolactone Scaffolds
Abstract
1. Introduction
2. Results
2.1. Scaffolds’ Morphology
2.2. Visualization of Cell Morphology
2.3. Visualization of the Mineralized Extracellular Matrix
2.4. ALP and TRAP Activity
2.5. Analysis of Gene Expression
3. Discussion
4. Materials and Methods
4.1. Scaffolds Fabrication and Post-Processing
4.2. Cell Isolation
4.3. Scaffold Sterilization and Cell Seeding
4.4. Visualization of Cell Morphology
4.5. Visualization of Mineralized Cell Matrix by Von Kossa Staining
4.6. Cell Proliferation
4.7. Alkaline Phosphatase (ALP) Assay
4.8. Tartrate-Resistant Acid Phosphatase (TRAP) Assay
4.9. Gene Expression by Quantitative Reverse Transcription Polymerase Chain Reaction (qRT-PCR)
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Abbreviations
| TERM | tissue engineering and regenerative medicine |
| EU-MDR | European Union medical device regulation |
| AM | additive manufacturing |
| MEW | melt electro-writing |
| PCL | polycaprolactone |
| OB | osteoblasts |
| PBMC | peripheral mononuclear cells |
| ECM | extracellular matrix |
| ALP | alkaline phosphatase |
| TRAP | tartrate-resistant acid phosphatase |
| RT-qPCR | quantitative reverse transcription-polymerase chain reaction |
References
- Moreno, M.; Amaral, M.H.; Lobo, J.M.; Silva, A.C. Scaffolds for Bone Regeneration: State of the Art. Curr. Pharm. Des. 2016, 22, 2726–2736. [Google Scholar] [CrossRef] [PubMed]
- Cipitria, A.; Reichert, J.C.; Epari, D.R.; Saifzadeh, S.; Berner, A.; Schell, H.; Mehta, M.; Schuetz, M.A.; Duda, G.N.; Hutmacher, D.W. Polycaprolactone scaffold and reduced rhBMP-7 dose for the regeneration of critical-sized defects in sheep tibiae. Biomaterials 2013, 34, 9960–9968. [Google Scholar] [CrossRef] [PubMed]
- Reichert, J.C.; Wullschleger, M.E.; Cipitria, A.; Lienau, J.; Cheng, T.K.; Schütz, M.A.; Duda, G.N.; Nöth, U.; Eulert, J.; Hutmacher, D.W. Custom-made composite scaffolds for segmental defect repair in long bones. Int. Orthop. 2011, 35, 1229–1236. [Google Scholar] [CrossRef] [PubMed]
- Turnbull, G.; Clarke, J.; Picard, F.; Riches, P.; Jia, L.; Han, F.; Li, B.; Shu, W. 3D bioactive composite scaffolds for bone tissue engineering. Bioact. Mater. 2018, 3, 278–314. [Google Scholar] [CrossRef] [PubMed]
- Hollister, S.J. Porous scaffold design for tissue engineering. Nat. Mater. 2005, 4, 518. [Google Scholar] [CrossRef] [PubMed]
- Brown, T.D.; Dalton, P.D.; Hutmacher, D.W. Direct writing by way of melt electrospinning. Adv. Mater. 2011, 23, 5651–5657. [Google Scholar] [CrossRef] [PubMed]
- Hochleitner, G.; Fürsattel, E.; Giesa, R.; Groll, J.; Schmidt, H.-W.; Dalton, P.D. Melt Electrowriting of Thermoplastic Elastomers. Macromol. Rapid Commun. 2018, 39, 1800055. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Chen, M.; Wei, X.; Hao, Y.; Wang, J. Evaluation of 3D-Printed Polycaprolactone Scaffolds Coated with Freeze-Dried Platelet-Rich Plasma for Bone Regeneration. Materials 2017, 10, 831. [Google Scholar] [CrossRef] [PubMed]
- Garg, T.; Singh, O.; Arora, S.; Rayasa, M. Scaffold: A Novel Carrier for Cell and Drug Delivery. Crit. Rev. Ther. Drug Carrier Syst. 2012, 29, 1–63. [Google Scholar] [CrossRef] [PubMed]
- Chen, T.; Cai, T.; Jin, Q.; Ji, J. Design and fabrication of functional polycaprolactone. e-Polymer 2015, 15, 3–13. [Google Scholar]
- Woodruff, M.A.; Hutmacher, D.W. The return of a forgotten polymer—Polycaprolactone in the 21st century. Prog. Polym. Sci. 2010, 35, 1217–1256. [Google Scholar] [CrossRef]
- Vaquette, C.; Ivanovski, S.; Hamlet, S.M.; Hutmacher, D.W. Effect of culture conditions and calcium phosphate coating on ectopic bone formation. Biomaterials 2013, 34, 5538–5551. [Google Scholar] [CrossRef] [PubMed]
- Poh, P.S.P.; Hutmacher, D.W.; Holzapfel, B.M.; Solanki, A.K.; Stevens, M.M.; Woodruff, M.A. In vitro and in vivo bone formation potential of surface calcium phosphate-coated polycaprolactone and polycaprolactone/bioactive glass composite scaffolds. Acta Biomater. 2016, 30, 319–333. [Google Scholar] [CrossRef] [PubMed]
- Seyedjafari, E.; Soleimani, M.; Ghaemi, N.; Shabani, I. Nanohydroxyapatite-coated electrospun poly(l-lactide) nanofibers enhance osteogenic differentiation of stem cells and induce ectopic bone formation. Biomacromolecules 2010, 11, 3118–3125. [Google Scholar] [CrossRef] [PubMed]
- Mavis, B.; Demirtas, T.T.; Gumusderelioglu, M.; Gunduz, G.; Colak, U. Synthesis, characterization and osteoblastic activity of polycaprolactone nanofibers coated with biomimetic calcium phosphate. Acta Biomater 2009, 5, 3098–3111. [Google Scholar] [CrossRef] [PubMed]
- O’Brien, F.J. Biomaterials & scaffolds for tissue engineering. Mater. Today 2011, 14, 88–95. [Google Scholar] [CrossRef]
- Webber, M.J.; Khan, O.F.; Sydlik, S.A.; Tang, B.C.; Langer, R. A perspective on the clinical translation of scaffolds for tissue engineering. Ann. Biomed. Eng. 2015, 43, 641–656. [Google Scholar] [CrossRef] [PubMed]
- Hopper, N.; Wardale, J.; Brooks, R.; Power, J.; Rushton, N.; Henson, F. Peripheral Blood Mononuclear Cells Enhance Cartilage Repair in in vivo Osteochondral Defect Model. PLoS ONE 2015, 10, e0133937. [Google Scholar] [CrossRef] [PubMed]
- Bucala, R.; Spiegel, L.; Chesney, J.; Hogan, M.; Cerami, A. Circulating fibrocytes define a new leukocyte subpopulation that mediates tissue repair. Mol. Med. 1994, 1, 71–81. [Google Scholar] [CrossRef] [PubMed]
- Kuwana, M.; Okazaki, Y.; Kodama, H.; Izumi, K.; Yasuoka, H.; Ogawa, Y.; Kawakami, Y.; Ikeda, Y. Human circulating CD14+ monocytes as a source of progenitors that exhibit mesenchymal cell differentiation. J. Leukoc. Biol. 2003, 74, 833–845. [Google Scholar] [CrossRef] [PubMed]
- Curran, J.M.; Gallagher, J.A.; Hunt, J.A. The inflammatory potential of biphasic calcium phosphate granules in osteoblast/macrophage co-culture. Biomaterials 2005, 26, 5313–5320. [Google Scholar] [CrossRef] [PubMed]
- Seo, Y.K.; Yoon, H.H.; Park, Y.S.; Song, K.Y.; Lee, W.S.; Park, J.K. Correlation between scaffold in vivo biocompatibility and in vitro cell compatibility using mesenchymal and mononuclear cell cultures. Cell Biol. Toxicol. 2009, 25, 513–522. [Google Scholar] [CrossRef] [PubMed]
- Abo-Aziza, F.A.M.; Zaki, A.A. The Impact of Confluence on Bone Marrow Mesenchymal Stem (BMMSC) Proliferation and Osteogenic Differentiation. Int. J. Hematol. Oncol. Stem Cell Res. 2017, 11, 121–132. [Google Scholar] [PubMed]
- Boyce, B.F.; Xing, L. Biology of RANK, RANKL, and osteoprotegerin. Arthritis Res. Ther. 2007, 9 (Suppl. 1), S1. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Xiao, Y.; Liu, C. The Horizon of Materiobiology: A Perspective on Material-Guided Cell Behaviors and Tissue Engineering. Chem. Rev. 2017, 117, 4376–4421. [Google Scholar] [CrossRef] [PubMed]
- Jonsson, K.B.; Frost, A.; Nilsson, O.; Ljunghall, S.; Ljunggren, O. Three isolation techniques for primary culture of human osteoblast-like cells: A comparison. Acta Orthop. Scand. 1999, 70, 365–373. [Google Scholar] [CrossRef] [PubMed]
- Kanatani, M.; Sugimoto, T.; Fukase, M.; Fujita, T. Effect of elevated extracellular calcium on the proliferation of osteoblastic MC3T3-E1 cells: Its direct and indirect effects via monocytes. Biochem. Biophys. Res. Commun. 1991, 181, 1425–1430. [Google Scholar] [CrossRef]
- Moura, C.G.; Souza, M.A.; Kohal, R.J.; Dechichi, P.; Zanetta-Barbosa, D.; Jimbo, R.; Teixeira, C.C.; Teixeira, H.S.; Tovar, N.; Coelho, P.G. Evaluation of osteogenic cell culture and osteogenic/peripheral blood mononuclear human cell co-culture on modified titanium surfaces. Biomed. Mater. 2013, 8, 035002. [Google Scholar] [CrossRef] [PubMed]
- Fujisaki, K.; Tanabe, N.; Suzuki, N.; Kawato, T.; Takeichi, O.; Tsuzukibashi, O.; Makimura, M.; Ito, K.; Maeno, M. Receptor activator of NF-kappaB ligand induces the expression of carbonic anhydrase II, cathepsin K, and matrix metalloproteinase-9 in osteoclast precursor RAW264.7 cells. Life Sci. 2007, 80, 1311–1318. [Google Scholar] [CrossRef] [PubMed]
- Buhling, F.; Reisenauer, A.; Gerber, A.; Kruger, S.; Weber, E.; Bromme, D.; Roessner, A.; Ansorge, S.; Welte, T.; Rocken, C. Cathepsin K—A marker of macrophage differentiation? J. Pathol. 2001, 195, 375–382. [Google Scholar] [CrossRef] [PubMed]





| Gene | Sequence | Tm (°C) |
|---|---|---|
| RunX2 | Forward: TGCCTAGGCGCATTTCAGGTGC Reverse: TGAGGTGACTGGCGGGGTGT | 60 |
| ALP | Forward: ACGTGGCTAAGAATGTCATC Reverse: CTGGTAGGCGATGTCCTTA | 60 |
| OCN | Forward: CCAGCGGTGCAGAGTCCAGC Reverse: GACACCCTAGACCGGGCCGT | 60 |
| OPG | Forward: GGGACCACAATGAACAAGCTG Reverse: TGTTTTAGGGAGGTGCCAGG | 56 |
| CTSK | Forward: GGCCCGAGTGGGACCTGTCT Reverse: CCCSCTGCCSSSSCCGCSTGG | 56 |
| TRAP | Forward: CCCTCGGAGAAACTGCATCAT Reverse: CATGTCCATCCAGGGGGAGA | 60 |
| RANK | Forward: TGCCTTGCAGGCTACTTCTC Reverse: CCTGCTGACCAAAGTTTGCC | 56 |
| RANKL | Forward: GGGCCAGGTTGTCTGCAGCGT Reverse: ACCATGAGCCATCCACCACCAGG | 58 |
| Col1A1 | Forward: GCCAAGAAGAAGACATCCCAGC Reverse: TCCCTTGGCACCATCCAA | 58 |
| β-Tubulin | Forward: GAGGGCGAGGACGAGGCTTA Reverse: TCTAACAGAGGCAAAACTGAGCACC | 60 |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hammerl, A.; Diaz Cano, C.E.; De-Juan-Pardo, E.M.; van Griensven, M.; Poh, P.S.P. A Growth Factor-Free Co-Culture System of Osteoblasts and Peripheral Blood Mononuclear Cells for the Evaluation of the Osteogenesis Potential of Melt-Electrowritten Polycaprolactone Scaffolds. Int. J. Mol. Sci. 2019, 20, 1068. https://doi.org/10.3390/ijms20051068
Hammerl A, Diaz Cano CE, De-Juan-Pardo EM, van Griensven M, Poh PSP. A Growth Factor-Free Co-Culture System of Osteoblasts and Peripheral Blood Mononuclear Cells for the Evaluation of the Osteogenesis Potential of Melt-Electrowritten Polycaprolactone Scaffolds. International Journal of Molecular Sciences. 2019; 20(5):1068. https://doi.org/10.3390/ijms20051068
Chicago/Turabian StyleHammerl, Andreas, Carlos E. Diaz Cano, Elena M. De-Juan-Pardo, Martijn van Griensven, and Patrina S.P. Poh. 2019. "A Growth Factor-Free Co-Culture System of Osteoblasts and Peripheral Blood Mononuclear Cells for the Evaluation of the Osteogenesis Potential of Melt-Electrowritten Polycaprolactone Scaffolds" International Journal of Molecular Sciences 20, no. 5: 1068. https://doi.org/10.3390/ijms20051068
APA StyleHammerl, A., Diaz Cano, C. E., De-Juan-Pardo, E. M., van Griensven, M., & Poh, P. S. P. (2019). A Growth Factor-Free Co-Culture System of Osteoblasts and Peripheral Blood Mononuclear Cells for the Evaluation of the Osteogenesis Potential of Melt-Electrowritten Polycaprolactone Scaffolds. International Journal of Molecular Sciences, 20(5), 1068. https://doi.org/10.3390/ijms20051068

