OsMKK3, a Stress-Responsive Protein Kinase, Positively Regulates Rice Resistance to Nilaparvata lugens via Phytohormone Dynamics
Abstract
1. Introduction
2. Results
2.1. Expression Profiles of OsMKK3
2.2. OsMKK3 Negatively Regulates Rice Growth but Enhances Resistance to Wounding
2.3. OsMKK3 Positively Mediates Rice Defense to BPH
2.4. Overexpressed OsMKK3 Alters the Accumulation of JA, JA-Ile, ABA, and SA but Not Ethylene and H2O2 in Response to BPH Infestation
3. Discussion
4. Materials and Methods
4.1. Plant Growth
4.2. Insects
4.3. Isolation and Characterization of OsMKK3 cDNA
4.4. Generation of Transgenic Plants
4.5. Plant Treatments
4.6. qRT-PCR
4.7. Measurement of Plant Growth Parameters
4.8. BPH Performance Measurement
4.9. JA, JA-Ile, ABA, and SA Analysis
4.10. Ethylene Analysis
4.11. Hydrogen Peroxide Analysis
4.12. Data Analysis
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Hussain, A.; Khan, M.I.; Wu, R.; Yang, S.; Wang, Y.; Qiu, A.; Guan, D.; Ashraf, M.F.; Liu, Z.; He, S.; et al. Capsicum annuum HsfB2a positively regulates the response to Ralstonia solanacearum infection or high temperature and high humidity forming transcriptional cascade with CaWRKY6 and CaWRKY40. Plant Cell Physiol. 2018, 59, 2608–2623. [Google Scholar]
- Noman, A.; Hussain, A.; Ashraf, M.F.; Ifnan Khan, M.; Liu, Z.; He, S. CabZIP53 is targeted by CaWRKY40 and act as positive regulator in pepper defense against Ralstonia solanacearum and thermotolerance. Environ. Exp. Bot. 2019, 159, 138–148. [Google Scholar] [CrossRef]
- Ifnan Khan, M.; Zhang, Y.; Liu, Z.; Hu, J.; Liu, C.; Yang, S.; Hussain, A.; Furqan Ashraf, M.; Noman, A.; Shen, L.; et al. CaWRKY40b in pepper acts as a negative regulator in response to Ralstonia solanacearum by directly modulating defense genes including CaWRKY40. Int. J. Mol. Sci. 2018, 19, 1403. [Google Scholar] [CrossRef] [PubMed]
- Hettenhausen, C.; Schuman, M.C.; Wu, J. MAPK signaling: A key element in plant defense response to insects. Insect Sci. 2015, 22, 157–164. [Google Scholar] [CrossRef] [PubMed]
- Islam, W.; Noman, A.; Qasim, M.; Wang, L. Plant responses to pathogen attack: Small RNAs in focus. Int. J. Mol. Sci. 2018, 19, 515. [Google Scholar] [CrossRef] [PubMed]
- Schuman, M.C.; Baldwin, I.T. The layers of plant responses to insect herbivores. Annu. Rev. Entomol. 2016, 61, 373–394. [Google Scholar] [CrossRef]
- Erb, M.; Meldau, S.; Howe, G.A. Role of phytohormones in insect-specific plant reactions. Trends Plant Sci. 2012, 17, 250–259. [Google Scholar] [CrossRef] [PubMed]
- Kant, M.R.; Jonckheere, W.; Knegt, B.; Lemos, F.; Liu, J.; Schimmel, B.C.; Villarroel, C.A.; Ataide, L.M.; Dermauw, W.; Glas, J.J.; et al. Mechanisms and ecological consequences of plant defence induction and suppression in herbivore communities. Ann. Bot. 2015, 115, 1015–1051. [Google Scholar] [CrossRef]
- Pieterse, C.M.; Van der Does, D.; Zamioudis, C.; Leon-Reyes, A.; Van Wees, S.C. Hormonal modulation of plant immunity. Annu. Rev. Cell Dev. Biol. 2012, 28, 489–521. [Google Scholar] [CrossRef]
- Verma, V.; Ravindran, P.; Kumar, P.P. Plant hormone-mediated regulation of stress responses. BMC Plant Biol. 2016, 16, 86. [Google Scholar] [CrossRef]
- Stam, J.M.; Kroes, A.; Li, Y.; Gols, R.; van Loon, J.J.; Poelman, E.H.; Dicke, M. Plant interactions with multiple insect herbivores: From community to genes. Annu. Rev. Plant Biol. 2014, 65, 689–713. [Google Scholar] [CrossRef]
- Cheng, X.; Zhu, L.; He, G. Towards understanding of molecular interactions between rice and the brown planthopper. Mol. Plant 2013, 6, 621–634. [Google Scholar] [CrossRef] [PubMed]
- Ling, Y.; Weilin, Z. Genetic and biochemical mechanisms of rice resistance to planthopper. Plant Cell Rep. 2016, 35, 1559–1572. [Google Scholar] [CrossRef] [PubMed]
- Hussain, A.; Li, X.; Weng, Y.; Liu, Z.; Ashraf, M.F.; Noman, A.; Yang, S.; Ifnan, M.; Qiu, S.; Yang, Y.; et al. CaWRKY22 acts as a positive regulator in pepper response to Ralstonia solanacearum by constituting networks with CaWRKY6, CaWRKY27, CaWRKY40, and CaWRKY58. Int. J. Mol. Sci. 2018, 19, 1426. [Google Scholar] [CrossRef] [PubMed]
- Wu, J.; Baldwin, I.T. Herbivory-induced signalling in plants: Perception and action. Plant Cell Environ. 2009, 32, 1161–1174. [Google Scholar] [CrossRef] [PubMed]
- Hanks, S.; Quinn, A.; Hunter, T. The protein kinase family: Conserved features and deduced phylogeny of the catalytic domains. Science 1988, 241, 42–52. [Google Scholar] [CrossRef]
- Hazzalin, C.A.; Mahadevan, L.C. MAPK-regulated transcription: A continuously variable gene switch? Nat. Rev. Mol. Cell Biol. 2002, 3, 30–40. [Google Scholar] [CrossRef]
- Meng, X.; Zhang, S. MAPK cascades in plant disease resistance signaling. Annu. Rev. Phytopathol. 2013, 51, 245–266. [Google Scholar] [CrossRef]
- De Zelicourt, A.; Colcombet, J.; Hirt, H. The role of MAPK modules and ABA during abiotic stress signaling. Trends Plant Sci. 2016, 21, 677–685. [Google Scholar] [CrossRef]
- Xu, J.; Zhang, S. Mitogen-activated protein kinase cascades in signaling plant growth and development. Trends Plant Sci. 2015, 20, 56–64. [Google Scholar] [CrossRef]
- Danquah, A.; de Zelicourt, A.; Colcombet, J.; Hirt, H. The role of ABA and MAPK signaling pathways in plant abiotic stress responses. Biotechnol. Adv. 2014, 32, 40–52. [Google Scholar] [CrossRef] [PubMed]
- Wu, J.; Hettenhausen, C.; Meldau, S.; Baldwin, I.T. Herbivory rapidly activates MAPK signaling in attacked and unattacked leaf regions but not between leaves of Nicotiana attenuata. Plant Cell 2007, 19, 1096–1122. [Google Scholar] [CrossRef] [PubMed]
- El-Esawi, M.A.; Alayafi, A.A. Overexpression of rice Rab7 gene improves drought and heat tolerance and increases grain yield in rice (Oryza sativa L.). Genes 2019, 10, 56. [Google Scholar] [CrossRef] [PubMed]
- Hettenhausen, C.; Baldwin, I.T.; Wu, J. Nicotiana attenuata MPK4 suppresses a novel jasmonic acid (JA) signaling-independent defense pathway against the specialist insect Manduca sexta, but is not required for the resistance to the generalist Spodoptera littoralis. New Phytol. 2013, 199, 787–799. [Google Scholar] [CrossRef]
- Kumar, K.R.; Srinivasan, T.; Kirti, P.B. A mitogen-activated protein kinase gene, AhMPK3 of peanut: Molecular cloning, genomic organization, and heterologous expression conferring resistance against Spodoptera litura in tobacco. Mol. Genet. Genom. 2009, 282, 65–81. [Google Scholar] [CrossRef]
- Giacometti, R.; Ilina, N.; Eduardo, P.A.; Zavala, J.A. Stink bug nezara viridula sustains late MAPKs phosphorylation status and induces expression of genes related with cell wall rearrangement in developing soybean seeds. Arthropod Plant Interact. 2018, 12, 531–541. [Google Scholar] [CrossRef]
- Singh, I.K.; Kumar, S.; Singh, S.; Singh, A. Expression profiling of mitogen-activated protein kinase genes from chickpea (Cicer arietinum L.) in response to Helicoverpa armigera, wounding and signaling compounds. J. Asia Pac. Entomol. 2017, 20, 942–948. [Google Scholar] [CrossRef]
- Wang, Q.; Li, J.; Hu, L.; Zhang, T.; Zhang, G.; Lou, Y. OsMPK3 positively regulates the JA signaling pathway and plant resistance to a chewing herbivore in rice. Plant Cell Rep. 2013, 32, 1075–1084. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; Li, J.; Xu, L.; Wang, Q.; Lou, Y.-G. Expressing OsMPK4 impairs plant growth but enhances the resistance of rice to the striped stem borer Chilo suppressalis. Int. J. Mol. Sci. 2018, 19, 1182. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Liu, X.; Wang, Q.; Huangfu, J.; Schuman, M.C.; Lou, Y. A group D MAPK protects plants from autotoxicity by suppressing herbivore-induced defense signaling. Plant Physiol. 2019, 179, 1386. [Google Scholar] [CrossRef]
- Hamel, L.P.; Nicole, M.C.; Sritubtim, S.; Morency, M.J.; Ellis, M.; Ehlting, J.; Beaudoin, N.; Barbazuk, B.; Klessig, D.; Lee, J.; et al. Ancient signals: Comparative genomics of plant MAPK and MAPKK gene families. Trends Plant Sci. 2006, 11, 192–198. [Google Scholar] [CrossRef] [PubMed]
- Takahashi, F.; Yoshida, R.; Ichimura, K.; Mizoguchi, T.; Seo, S.; Yonezawa, M.; Maruyama, K.; Yamaguchi-Shinozaki, K.; Shinozaki, K. The mitogen-activated protein kinase cascade MKK3-MPK6 is an important part of the jasmonate signal transduction pathway in Arabidopsis. Plant Cell 2007, 19, 805–818. [Google Scholar] [CrossRef]
- Li, Y.; Cai, H.; Liu, P.; Wang, C.; Gao, H.; Wu, C.; Yan, K.; Zhang, S.; Huang, J.; Zheng, C. Arabidopsis MAPKKK18 positively regulates drought stress resistance via downstream MAPKK3. Biochem. Biophys. Res. Commun. 2017, 484, 292–297. [Google Scholar] [CrossRef] [PubMed]
- Doczi, R.; Brader, G.; Pettko-Szandtner, A.; Rajh, I.; Djamei, A.; Pitzschke, A.; Teige, M.; Hirt, H. The Arabidopsis mitogen-activated protein kinase kinase MKK3 is upstream of group c mitogen-activated protein kinases and participates in pathogen signaling. Plant Cell 2007, 19, 3266–3279. [Google Scholar] [CrossRef] [PubMed]
- Danquah, A.; de Zelicourt, A.; Boudsocq, M.; Neubauer, J.; Frei Dit Frey, N.; Leonhardt, N.; Pateyron, S.; Gwinner, F.; Tamby, J.P.; Ortiz-Masia, D.; et al. Identification and characterization of an ABA-activated map kinase cascade in Arabidopsis thaliana. Plant J. 2015, 82, 232–244. [Google Scholar] [CrossRef]
- Enders, T.A.; Frick, E.M.; Strader, L.C. An Arabidopsis kinase cascade influences auxin-responsive cell expansion. Plant J. 2017, 92, 68–81. [Google Scholar] [CrossRef] [PubMed]
- Jalmi, S.; Sinha, A. Functional involvement of a mitogen activated protein kinase module, OsMKK3-OsMPK7-OsWRK30 in mediating resistance against Xanthomonas oryzae in rice. Sci. Rep. 2016, 6, 37973. [Google Scholar] [CrossRef]
- Lou, Y.-G.; Zhang, G.-R.; Zhang, W.-Q.; Hu, Y.; Zhang, J. Reprint of: Biological control of rice insect pests in china. Biol. Control 2014, 68, 103–116. [Google Scholar] [CrossRef]
- Wang, F.; Ning, D.; Chen, Y.; Dang, C.; Han, N.S.; Liu, Y.; Ye, G.Y. Comparing gene expression profiles between Bt and non-Bt rice in response to brown planthopper infestation. Front. Plant Sci. 2015, 6, 1181. [Google Scholar] [CrossRef]
- Zhou, G.; Qi, J.; Ren, N.; Cheng, J.; Erb, M.; Mao, B.; Lou, Y. Silencing OsHI-LOX makes rice more susceptible to chewing herbivores, but enhances resistance to a phloem feeder. Plant J. 2009, 60, 638–648. [Google Scholar] [CrossRef]
- Lu, J.; Ju, H.; Zhou, G.; Zhu, C.; Erb, M.; Wang, X.; Wang, P.; Lou, Y. An EAR-motif-containing ERF transcription factor affects herbivore-induced signaling, defense and resistance in rice. Plant J. 2011, 68, 583–596. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Luo, T.; Wang, W.; Cao, T.; Li, R.; Lou, Y. Silencing OsSLR1 enhances the resistance of rice to the brown planthopper Nilaparvata lugens. Plant Cell Environ. 2017, 40, 2147–2159. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Cao, L.; Zhang, Y.; Cao, C.; Liu, F.; Huang, F.; Qiu, Y.; Li, R.; Lou, X. Map-based cloning and characterization of BPH29, a B3 domain-containing recessive gene conferring brown planthopper resistance in rice. J. Exp. Bot. 2015, 66, 6035–6045. [Google Scholar] [CrossRef] [PubMed]
- Ge, Y.; Han, J.; Zhou, G.; Xu, Y.; Ding, Y.; Shi, M.; Guo, C.; Wu, G. Silencing of miR156 confers enhanced resistance to brown planthopper in rice. Planta 2018, 248, 813–826. [Google Scholar] [CrossRef] [PubMed]
- Guo, J.; Xu, C.; Wu, D.; Zhao, Y.; Qiu, Y.; Wang, X.; Ouyang, Y.; Cai, B.; Liu, X.; Jing, S.; et al. Bph6 encodes an exocyst-localized protein and confers broad resistance to planthoppers in rice. Nat. Genet. 2018, 50, 297–306. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Du, H.; Ding, X.; Zhou, Y.; Xie, P.; Wu, J. Mechanisms of callose deposition in rice regulated by exogenous abscisic acid and its involvement in rice resistance to Nilaparvata lugens stal (hemiptera: Delphacidae). Pest Manag. Sci. 2017, 73, 2559–2568. [Google Scholar] [CrossRef] [PubMed]
- Zhou, G.; Ren, N.; Qi, J.; Lu, J.; Xiang, C.; Ju, H.; Cheng, J.; Lou, Y. The 9-lipoxygenase Osr9-LOX1 interacts with the 13-lipoxygenase-mediated pathway to regulate resistance to chewing and piercing-sucking herbivores in rice. Physiol. Plant. 2014, 152, 59–69. [Google Scholar] [CrossRef] [PubMed]
- Huangfu, J.; Li, J.; Li, R.; Ye, M.; Kuai, P.; Zhang, T.; Lou, Y. The transcription factor OsWRKY45 negatively modulates the resistance of rice to the brown planthopper Nilaparvata lugens. Int. J. Mol. Sci. 2016, 17, 697. [Google Scholar] [CrossRef]
- Takahashi, F.; Mizoguchi, T.; Yoshida, R.; Ichimura, K.; Shinozaki, K. Calmodulin-dependent activation of MAP kinase for ROS homeostasis in Arabidopsis. Mol. Cell 2011, 41, 649–660. [Google Scholar] [CrossRef]
- Berr, A.; McCallum, E.J.; Alioua, A.; Heintz, D.; Heitz, T.; Shen, W.H. Arabidopsis histone methyltransferase SET DOMAIN GROUP8 mediates induction of the jasmonate/ethylene pathway genes in plant defense response to necrotrophic fungi. Plant Physiol. 2010, 154, 1403–1414. [Google Scholar] [CrossRef]
- Sethi, V.; Raghuram, B.; Sinha, A.K.; Chattopadhyay, S. A mitogen-activated protein kinase cascade module, MKK3-MPK6 and MYC2, is involved in blue light-mediated seedling development in Arabidopsis. Plant Cell 2014, 26, 3343–3357. [Google Scholar] [CrossRef] [PubMed]
- Hwa, C.-M.; Yang, X.-C. The AtMKK3 pathway mediates aba and salt signaling in Arabidopsis. Acta Physiol. Plant. 2007, 30, 277–286. [Google Scholar] [CrossRef]
- Schikora, A.; Carreri, A.; Charpentier, E.; Hirt, H. The dark side of the salad: Salmonella typhimurium overcomes the innate immune response of Arabidopsis thaliana and shows an endopathogenic lifestyle. PLoS ONE 2008, 3, e2279. [Google Scholar] [CrossRef] [PubMed]
- Matsuoka, D.; Soga, K.; Yasufuku, T.; Nanmori, T. Control of plant growth and development by overexpressing MAP3K17, an aba-inducible MAP3K, in Arabidopsis. Plant Biotechnol. 2018, 35, 171–176. [Google Scholar] [CrossRef]
- Matsuoka, D.; Yasufuku, T.; Furuya, T.; Nanmori, T. An abscisic acid inducible Arabidopsis MAPKKK, MAPKKK18 regulates leaf senescence via its kinase activity. Plant Mol. Biol. 2015, 87, 565–575. [Google Scholar] [CrossRef] [PubMed]
- De Vleesschauwer, D.; Gheysen, G.; Hofte, M. Hormone defense networking in rice: Tales from a different world. Trends Plant Sci. 2013, 18, 555–565. [Google Scholar] [CrossRef] [PubMed]
- Frei dit Frey, N.; Garcia, A.V.; Bigeard, J.; Zaag, R.; Bueso, E.; Garmier, M.; Pateyron, S.; de Tauzia-Moreau, M.-L.; Brunaud, V.; Balzergue, S.; et al. Functional analysis of Arabidopsis immune-related MAPKs uncovers a role for MPK3 as negative regulator of inducible defences. Genome Biol. 2014, 15, R87. [Google Scholar] [CrossRef] [PubMed]
- Seo, S.; Katou, S.; Seto, H.; Gomi, K.; Ohashi, Y. The mitogen-activated protein kinases WIPK and SIPK regulate the levels of jasmonic and salicylic acids in wounded tobacco plants. Plant J. 2007, 49, 899–909. [Google Scholar] [CrossRef]
- Shen, X.; Yuan, B.; Liu, H.; Li, X.; Xu, C.; Wang, S. Opposite functions of a rice mitogen-activated protein kinase during the process of resistance against Xanthomonas oryzae. Plant J. 2010, 64, 86–99. [Google Scholar] [CrossRef]
- Tanaka, T.; Ono, S.; Watakabe, Y.; Hiratsuka, K. Bioluminescence reporter assay system to monitor Arabidopsis MPK3 gene expression in response to infection by Botrytis cinerea. J. Gen. Plant Pathol. 2006, 72, 1–5. [Google Scholar] [CrossRef]
- Harun-Or-Rashid, M.; Kim, H.J.; Yeom, S.I.; Yu, H.A.; Manir, M.M.; Moon, S.S.; Kang, Y.J.; Chung, Y.R. Bacillus velezensis YC7010 enhances plant defenses against brown planthopper through transcriptomic and metabolic changes in rice. Front. Plant Sci. 2018, 9, 1904. [Google Scholar] [CrossRef] [PubMed]
- Zhou, P.; Mo, X.; Wang, W.; Chen, X.; Lou, Y. The commonly used bactericide bismerthiazol promotes rice defenses against herbivores. Int. J. Mol. Sci. 2018, 19, 1271. [Google Scholar] [CrossRef] [PubMed]
- Qi, J.; Li, J.; Han, X.; Li, R.; Wu, J.; Yu, H.; Hu, L.; Xiao, Y.; Lu, J.; Lou, Y. Jasmonic acid carboxyl methyltransferase regulates development and herbivory-induced defense response in rice. J. Integr. Plant Biol. 2016, 58, 564–576. [Google Scholar] [CrossRef] [PubMed]
- Chen, L.; Cao, T.; Zhang, J.; Lou, Y. Overexpression of OsGID1 enhances the resistance of rice to the brown planthopper Nilaparvata lugens. Int. J. Mol. Sci. 2018, 19, 2744. [Google Scholar] [CrossRef]
- Pan, G.; Liu, Y.; Ji, L.; Zhang, X.; He, J.; Huang, J.; Qiu, Z.; Liu, D.; Sun, Z.; Xu, T.; et al. Brassinosteroids mediate susceptibility to brown planthopper by integrating with the salicylic acid and jasmonic acid pathways in rice. J. Exp. Bot. 2018, 69, 4433–4442. [Google Scholar] [CrossRef]
- Li, C.; Luo, C.; Zhou, Z.; Wang, R.; Ling, F.; Xiao, L.; Lin, Y.; Chen, H. Gene expression and plant hormone levels in two contrasting rice genotypes responding to brown planthopper infestation. BMC Plant Biol. 2017, 17, 57. [Google Scholar] [CrossRef] [PubMed]
- Meldau, S.; Wu, J.; Baldwin, I. Silencing two herbivory-activated MAP kinases, SIPK and WIPK, does not increase Nicotiana attenuata’s susceptibility to herbivores in the glasshouse and in nature. New Phytol. 2009, 181, 161–173. [Google Scholar] [CrossRef]
- Suk Lee, J.; Wang, S.; Sritubtim, S.; Chen, J.-G.; Ellis, B. Arabidopsis mitogen-activated protein kinase MPK12 interacts with the MAPK phosphatase IBR5 and regulates auxin signaling. Plant J. 2008, 57, 975–985. [Google Scholar]
- Yw, K.; Chiu, W.L.; Tena, G.; Sheen, J. Functional analysis of oxidative stress-activated mitogen-activated protein kinase cascade in plants. Proc. Natl. Acad. Sci. USA 2000, 97, 2940–2945. [Google Scholar]
- Lu, J.; Robert, C.A.; Riemann, M.; Cosme, M.; Mene-Saffrane, L.; Massana, J.; Stout, M.J.; Lou, Y.; Gershenzon, J.; Erb, M. Induced jasmonate signaling leads to contrasting effects on root damage and herbivore performance. Plant Physiol. 2015, 167, 1100–1116. [Google Scholar] [CrossRef]
- Lu, Y.; Wang, X.; Lou, Y.; Cheng, J. Role of ethylene signaling in the production of rice volatiles induced by the rice brown planthopper Nilaparvata lugens. Chin. Sci. Bull. 2006, 51, 2457–2465. [Google Scholar] [CrossRef]
GENE | LOCUS | F-PRIMER (5′-3′) | R-PRIMER (5′-3′) | PROBE |
---|---|---|---|---|
OsACTIN | Os03g50885 | TGGACAGGTTATCACCATTGGT | CCGCAGCTTCCATTCCTATG | HEX-CGTTTCCGCTGCCCTGAGGTCC-BHQ1 |
OsMKK3 | Os06g27890 | TTTAGTTGAATTCCAGGGTGCA | AAGGACCCACCATCCATGTATT | FAM-TTCTGGACAAATAAGCATCGCCCT-BHQ2 |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhou, S.; Chen, M.; Zhang, Y.; Gao, Q.; Noman, A.; Wang, Q.; Li, H.; Chen, L.; Zhou, P.; Lu, J.; et al. OsMKK3, a Stress-Responsive Protein Kinase, Positively Regulates Rice Resistance to Nilaparvata lugens via Phytohormone Dynamics. Int. J. Mol. Sci. 2019, 20, 3023. https://doi.org/10.3390/ijms20123023
Zhou S, Chen M, Zhang Y, Gao Q, Noman A, Wang Q, Li H, Chen L, Zhou P, Lu J, et al. OsMKK3, a Stress-Responsive Protein Kinase, Positively Regulates Rice Resistance to Nilaparvata lugens via Phytohormone Dynamics. International Journal of Molecular Sciences. 2019; 20(12):3023. https://doi.org/10.3390/ijms20123023
Chicago/Turabian StyleZhou, Shuxing, Mengting Chen, Yuebai Zhang, Qing Gao, Ali Noman, Qi Wang, Heng Li, Lin Chen, Pengyong Zhou, Jing Lu, and et al. 2019. "OsMKK3, a Stress-Responsive Protein Kinase, Positively Regulates Rice Resistance to Nilaparvata lugens via Phytohormone Dynamics" International Journal of Molecular Sciences 20, no. 12: 3023. https://doi.org/10.3390/ijms20123023
APA StyleZhou, S., Chen, M., Zhang, Y., Gao, Q., Noman, A., Wang, Q., Li, H., Chen, L., Zhou, P., Lu, J., & Lou, Y. (2019). OsMKK3, a Stress-Responsive Protein Kinase, Positively Regulates Rice Resistance to Nilaparvata lugens via Phytohormone Dynamics. International Journal of Molecular Sciences, 20(12), 3023. https://doi.org/10.3390/ijms20123023