Enhanced Ganoderic Acids Accumulation and Transcriptional Responses of Biosynthetic Genes in Ganoderma lucidum Fruiting Bodies by Elicitation Supplementation
Abstract
:1. Introduction
2. Results
2.1. Effect of Sodium Acetate on the Dry Weight of Fruiting Body
2.2. Effect of Sodium Acetate on Accumulation of GAs
2.3. Effect of Sodium Acetate on the Expression of Key GAs Biosynthesis Genes
2.4. Effect of Sodium Acetate on the Expression of acs and Acetyl-CoA Content
2.5. Effect of Sodium Acetate on the Expression of Genes in Calcineurin Signals Pathway
3. Discussion
4. Materials and Methods
4.1. Strains and Culture Conditions
4.2. Measurement of Ganoderic Acids
4.3. Transcriptional Analysis
4.4. Extraction and Measurement of Acetyl Coenzyme A (Acetyl-CoA)
4.5. Experimental Design and Statistical Analysis
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Bishop, K.S.; Kao, C.H.J.; Xu, Y.; Glucina, M.P.; Paterson, R.R.M.; Ferguson, L.R. From 2000 years of Ganoderma lucidum to recent developments in nutraceuticals. Phytochemistry 2015, 114, 56–65. [Google Scholar] [CrossRef] [PubMed]
- Chen, S.L.; Xu, J.; Liu, C.; Zhu, Y.J.; Nelson, D.R.; Zhou, S.G.; Li, C.F.; Wang, L.Z.; Guo, X.; Sun, Y.Z.; et al. Genome sequence of the model medicinal mushroom Ganoderma lucidum. Nat. Commun. 2012, 3, 913. [Google Scholar] [CrossRef] [PubMed]
- Wang, W.F.; Xiao, H.; Zhong, J.J. Biosynthesis of a ganoderic acid in Saccharomyces cerevisiae by expressing a cytochrome P450 gene from Ganoderma lucidum. Biotechnol. Bioeng. 2018, 115, 1842–1854. [Google Scholar] [CrossRef]
- Boh, B.; Berovic, M.; Zhang, J.; Zhi-Bin, L. Ganoderma lucidum and its pharmaceutically active compounds. Biotechnol. Annu. Rev. 2007, 13, 265–301. [Google Scholar] [PubMed]
- Cör, D.; Knez, Ž.; Hrnčič, M.K. Antitumour, antimicrobial, antioxidant and antiacetylcholinesterase effect of Ganoderma Lucidum terpenoids and polysaccharides: a review. Molecules 2018, 23, 649. [Google Scholar] [CrossRef] [PubMed]
- Xu, J.W.; Zhao, W.; Zhong, J.J. Biotechnological production and application of ganoderic acids. Appl. Microbiol. Biotechnol. 2010, 87, 457–466. [Google Scholar] [CrossRef] [PubMed]
- Cao, P.F.; Wu, C.G.; Dang, Z.H.; Shi, L.; Jiang, A.L.; Ren, A.; Zhao, M.W. Effects of exogenous salicylic acid on ganoderic acid biosynthesis and the expression of key genes in the ganoderic acid biosynthesis pathway in the Lingzhi or Reishi medicinal mushroom, Ganoderma lucidum (Agaricomycetes). Int. J. Med. Mushrooms 2017, 19, 65–73. [Google Scholar] [CrossRef] [PubMed]
- Hu, Y.; Ahmed, S.; Li, J.; Luo, B.; Gao, Z.; Zhang, Q.; Li, X.; Hu, X. Improved ganoderic acids production in Ganoderma lucidum by wood decaying components. Sci. Rep. 2017, 7, 46623. [Google Scholar] [CrossRef]
- Ren, A.; Qin, L.; Shi, L.; Dong, X.; Mu, D.S.; Li, Y.X.; Zhao, M.W. Methyl jasmonate induces ganoderic acid biosynthesis in the basidiomycetous fungus Ganoderma lucidum. Bioresource Technol. 2010, 101, 6785–6790. [Google Scholar] [CrossRef]
- Xu, J.W.; Xu, Y.N.; Zhong, J.J. Enhancement of ganoderic acid accumulation by overexpression of an N-terminal truncated 3-hydroxy-3-methylglutaryl CoA reductase gene in the basidiomycete Ganoderma lucidum. Appl. Enviorn. Microbiol. 2012, 78, 7968–7976. [Google Scholar] [CrossRef]
- Ding, Y.X.; Ou-Yang, X.; Shang, C.H.; Ren, A.; Shi, L.; Li, Y.X.; Zhao, M.W. Molecular cloning, characterization, and differential expression of a farnesyl-diphosphate synthase gene from the basidiomycetous fungus Ganoderma lucidum. Biosci. Biotechnol. Biochem. 2008, 72, 1571–1579. [Google Scholar] [CrossRef] [PubMed]
- Zhao, M.W.; Liang, W.Q.; Zhang, D.B.; Wang, N.; Wang, C.G.; Pan, Y.J. Cloning and characterization of squalene synthase (SQS) gene from Ganoderma lucidum. J. Microbiol. Biotechnol. 2007, 17, 1106–1112. [Google Scholar] [PubMed]
- Shang, C.H.; Shi, L.; Ren, A.; Qin, L.; Zhao, M.W. Molecular cloning, characterization, and differential expression of a lanosterol synthase gene from Ganoderma lucidum. Biosci. Biotechnol. Biochem. 2010, 74, 974–978. [Google Scholar] [CrossRef] [PubMed]
- Liu, D.; Gong, J.; Dai, W.; Kang, X.; Huang, Z.; Zhang, H.M.; Liu, W.; Liu, L.; Ma, J.; Xia, Z.; Chen, Y.; et al. The genome of Ganderma lucidum provide insights into triterpense biosynthesis and wood degradation. PLoS ONE 2012, 7, e36146. [Google Scholar]
- Shi, L.; Ren, A.; Mu, D.; Zhao, M. Current progress in the study on biosynthesis and regulation of ganoderic acids. Appl. Microbiol. Biotechnol. 2010, 88, 1243–1251. [Google Scholar] [CrossRef] [PubMed]
- Liang, C.X.; Li, Y.B.; Xu, J.W.; Wang, J.L.; Miao, X.Y.; Tang, Y.J.; Gu, T.; Zhong, J.J. Enhanced biosynthetic gene expressions and production of ganoderic acids in static liquid culture of Ganoderma lucidum under phenobarbital induction. Appl. Microbiol. Biotechnol. 2010, 86, 1367–1374. [Google Scholar] [CrossRef] [PubMed]
- Xu, Y.N.; Xia, X.X.; Zhong, J.J. Induced effect of Na+ on ganoderic acid biosynthesis in static liquid culture of Ganoderma lucidum via calcineurin signal transduction. Biotechnol. Bioeng. 2013, 110, 1913–1923. [Google Scholar] [CrossRef]
- You, B.J.; Lee, M.H.; Tien, N.; Lee, M.S.; Hsieh, H.C.; Tseng, L.H.; Chung, Y.L.; Lee, H.Z. A novel approach to enhancing ganoderic acid production by Ganoderma lucidum using apoptosis induction. PLoS ONE 2013, 8, e53616. [Google Scholar] [CrossRef]
- Zhang, J.M.; Zhong, J.J.; Geng, A.L. Improvement of ganoderic acid production by fermentation of Ganoderma lucidum with cellulase as an elicitor. Process Biochem. 2014, 49, 1580–1586. [Google Scholar] [CrossRef]
- Hu, G.; Zhai, M.; Niu, R.; Xu, X.; Liu, Q.; Jia, J. Optimization of culture condition for ganoderic acid production in Ganoderma lucidum liquid static culture and design of a suitable bioreactor. Molecules 2018, 23, 2563. [Google Scholar] [CrossRef]
- Li, H.J.; Zhang, D.H.; Han, L.L.; Yu, X.; Zhao, P.; Li, T.; Zhong, J.J.; Xu, J.W. Further improvement in ganoderic acid production in static liquid culture of Ganoderma lucidum by integrating nitrogen limitation and calcium ion addition. Bioprocess Biosyst. Eng. 2016, 39, 75–80. [Google Scholar] [CrossRef] [PubMed]
- Lim, H.G.; Lee, J.H.; Noh, M.H.; Jung, G.Y. Rediscovering acetate metabolism: Its potential sources and utilization for biobased transformation into value-added chemicals. J. Agric. Food Chem. 2018, 66, 3998–4006. [Google Scholar] [CrossRef] [PubMed]
- De Mey, M.; De Maeseneire, S.; Soetaert, W.; Vandamme, E. Minimizing acetate formation in E. coli fermentations. J. Ind. Microbiol. Biotechnol. 2007, 34, 689–700. [Google Scholar] [CrossRef] [PubMed]
- Yi, C.H.; Pan, H.; Seebacher, J.; Jang, I.H.; Hyberts, S.G.; Heffron, G.J.; Vander Heiden, M.G.; Yang, R.; Li, F.; Locasale, J.W.; et al. Metabolic regulation of protein N-alpha-acetylation by Bcl-xL promotes cell survival. Cell 2011, 146, 607–620. [Google Scholar] [CrossRef] [PubMed]
- Zhao, J.; Davis, L.C.; Verpoorte, R. Elicitor signal transduction leading to production of plant secondary metabolites. Biotechnol. Adv. 2005, 23, 283–333. [Google Scholar] [CrossRef]
- Feske, S.; Rao, A.; Hogan, P.G. The Ca2+-calcineurin-NFAT signaling pathway. New Compr. Biochem. 2007, 41, 365–401. [Google Scholar]
- Kader, M.A.; Lindberg, S. Cellular traits for sodium tolerance in rice (Oryza sativa L.). Plant Biotechnol. 2008, 25, 247–255. [Google Scholar] [CrossRef]
- Ariño, J.; Ramos, J.; Sychrova, H. Alkali metal cation transport and homeostasis in yeasts. Microbiol. Mol. Biol. R. 2010, 74, 95–120. [Google Scholar] [CrossRef]
- El-Kady, I.A.; El-Maraghy, S.S.M.; Zohri, A.N.A. Control of aflatoxin production on liquid medium and minced meat by salts and antibiotics. Fleischw. Int. 1997, 77, 40–43. [Google Scholar]
- Hou, L.; Li, Y.; Chen, M.; Li, Z. Improved fruiting of the straw mushroom (Volvariella volvacea) on cotton waste supplemented with sodium acetate. Appl. Microbiol. Biotechnol. 2017, 101, 8533–8541. [Google Scholar] [CrossRef] [PubMed]
- Liu, R.; Cao, P.; Ren, A.; Wang, S.; Yang, T.; Zhu, T.; Shi, L.; Zhu, J.; Jiang, A.L.; Zhao, M.W. SA inhibits complex III activity to generate reactive oxygen species and thereby induces GA overproduction in Ganoderma lucidum. Redox Biol. 2018, 16, 388–400. [Google Scholar] [CrossRef] [PubMed]
- Ye, L.; Liu, S.; Xie, F.; Zhao, L.; Wu, X. Enhanced production of polysaccharides and triterpenoids in Ganoderma lucidum fruit bodies on induction with signal transduction during the fruiting stage. PLoS ONE 2018, 13, e0196287. [Google Scholar] [CrossRef] [PubMed]
- Kenneth, J.L.; Thomas, D.S. Analysis of relative gene expression data using real-time quantitative PCR and the 2−∆∆Ct method. Methods 2001, 25, 402–408. [Google Scholar]
- Gao, T.; Shi, L.; Zhang, T.; Ren, A.; Jiang, A.; Yu, H.; Zhao, M. Cross-talk between calcium and ROS regulates hyphal branching and ganoderic acids biosynthesis in Ganoderma lucidum under copper stress. Appl. Environ. Microbiol. 2018, 84, e00438-18. [Google Scholar] [CrossRef] [PubMed]
- Ren, A.; Li, X.B.; Miao, Z.G.; Shi, L.; Jaing, A.L.; Zhao, M.W. Transcript and metabolite alterations increase ganoderic acid content in Ganoderma lucidum using acetic acid as an inducer. Biotechnol. Lett. 2014, 36, 2529–2536. [Google Scholar] [CrossRef] [PubMed]
- Xu, Y.N.; Zhong, J.J. Impacts of calcium signal transduction on the fermentation production of antitumor ganoderic acids by medicinal mushroom Ganoderma lucidum. Biotechnol. Adv. 2012, 30, 1301–1308. [Google Scholar] [CrossRef]
Target Genes | Forward (5′–3′) | Reverse (5′–3′) | References |
---|---|---|---|
18S rRNA | TATCGAGTTCTGACTGGGTTGT | ATCCGTTGCTGAAAGTTGTAT | [17] |
hmgs | CCCATCAACGCTTCCACCA | GCTCCTCCTCCGAAATGC | [9] |
hmgr | GTCATCCTCCTATGCCAAAC | GGGCGTAGTCGTAGTCCTTC | [17] |
fps | CCTCATCACCGCTCCAGAA | AGGGCGACGGGAAGGTAGAA | [9] |
osc | AGGGAGAACCCGAAGCATT | CGTCCACAGCGTCGCATAAC | [17] |
sqs | CTGCTTATTCTACCTGGTGCTACG | GGCTTCACGGCGAGTTTGT | [34] |
GL19651 | AGCAAGCAGTGGCATAA | GTCCCATCACGGTTCTC | [35] |
GL20510 | ATGGCGAAGGAAACCC | CGTCGGCCTCGTAGATG | [35] |
GL20899 | CCAGCACCACGAGTTAGG | GCGTTCGCCAGTCCAAA | [35] |
GL21040 | GCTAACATCGTCCAAGTCG | ATAGTCAACCCAGCAAACA | [35] |
GL23180 | CAGGAGTTCTTGTCGGTTGC | TCGTTCGTGGCGAGGTAG | [35] |
GL23589 | TCGCCTGCTATTCCATTC | ACGGCAACAGTCGTGAGT | [35] |
GL23735 | CGTCTGTTCGTCCACCC | GCGAGCGACTTTCCTGTT | [35] |
GL24109 | AGGCGGTTGATGTTCG | TCATGCCATACGCTACG | [35] |
GL28494 | GGCGTTTGTCATCCTCC | CCTTCTGAATCTTGCCTGTT | [35] |
GL30345 | AGTGACCGTTCGTGTTCC | GTAGGCTCCAGGTTCTCG | [35] |
ena1 | GACACGAAGACATCCTCACCC | CCATCCCATCCTCCCACTC | [17] |
Ca2+-ATPase | GGCACTTATCCCCGTCCG | GATTGAGGGTCCGCCAGAG | [17] |
cam | GAGGTACATCTCCGCCGCC | TCACGAACTCCTCGCAGTTGAT | [36] |
cna | TCGGGGTCGTATAGGTCGG | CTTTGCGCTTTTGCGTGAG | [36] |
crz1 | GGGTGGCTGATGCAGAAATAC | CGAGGAGAGCGAGACGGG | [36] |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Meng, L.; Bai, X.; Zhang, S.; Zhang, M.; Zhou, S.; Mukhtar, I.; Wang, L.; Li, Z.; Wang, W. Enhanced Ganoderic Acids Accumulation and Transcriptional Responses of Biosynthetic Genes in Ganoderma lucidum Fruiting Bodies by Elicitation Supplementation. Int. J. Mol. Sci. 2019, 20, 2830. https://doi.org/10.3390/ijms20112830
Meng L, Bai X, Zhang S, Zhang M, Zhou S, Mukhtar I, Wang L, Li Z, Wang W. Enhanced Ganoderic Acids Accumulation and Transcriptional Responses of Biosynthetic Genes in Ganoderma lucidum Fruiting Bodies by Elicitation Supplementation. International Journal of Molecular Sciences. 2019; 20(11):2830. https://doi.org/10.3390/ijms20112830
Chicago/Turabian StyleMeng, Li, Xiaoran Bai, Shaoyan Zhang, Mengfei Zhang, Sen Zhou, Irum Mukhtar, Li Wang, Zhuang Li, and Wei Wang. 2019. "Enhanced Ganoderic Acids Accumulation and Transcriptional Responses of Biosynthetic Genes in Ganoderma lucidum Fruiting Bodies by Elicitation Supplementation" International Journal of Molecular Sciences 20, no. 11: 2830. https://doi.org/10.3390/ijms20112830
APA StyleMeng, L., Bai, X., Zhang, S., Zhang, M., Zhou, S., Mukhtar, I., Wang, L., Li, Z., & Wang, W. (2019). Enhanced Ganoderic Acids Accumulation and Transcriptional Responses of Biosynthetic Genes in Ganoderma lucidum Fruiting Bodies by Elicitation Supplementation. International Journal of Molecular Sciences, 20(11), 2830. https://doi.org/10.3390/ijms20112830