Differences in Liver TFAM Binding to mtDNA and mtDNA Damage between Aged and Extremely Aged Rats
Abstract
:1. Introduction
2. Results
2.1. Citrate Synthase Activity, Amount of TFAM, and Contents of mtDNA and “Common Deletion”
2.2. TFAM Binding to mtDNA
2.3. MtDNA Damage
3. Discussion
4. Materials and Methods
4.1. Animals
4.2. Determination of Citrate Synthase Activity
4.3. Western Blots
4.4. Determination of mtDNA and mtDNA 4.8 Kb Deletion Content
4.5. Mitochondrial DNA Immunoprecipitation (mIP) and Quantitative PCR of mIP DNA
4.6. Analysis of Modified Purines
4.7. Statistics
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
Abbreviations
Fpg | Formamidopyrimidine DNA glycosylase |
References
- López-Otín, C.; Blasco, M.A.; Partridge, L.; Serrano, M.; Kroemer, G. The hallmarks of aging. Cell 2013, 153, 1194–1217. [Google Scholar] [CrossRef]
- Held, N.M.; Houtkooper, R.H. Mitochondrial quality control pathways as determinants of metabolic health. Bioessays 2015, 37, 867–876. [Google Scholar] [CrossRef] [PubMed]
- López-Lluch, G.; Santos-Ocaña, C.; Sánchez-Alcázar, J.A.; Fernández-Ayala, D.J.; Asencio-Salcedo, C.; Rodríguez-Aguilera, J.C.; Navas, P. Mitochondrial responsibility in ageing process: Innocent, suspect or guilty. Biogerontology 2015, 16, 599–620. [Google Scholar] [CrossRef]
- Picca, A.; Sirago, G.; Pesce, V.; Lezza, A.M.S.; Calvani, R.; Bossola, M.; Villani, E.R.; Landi, F.; Leeuwenburgh, C.; Bernabei, R.; et al. Administration of Enalapril Started Late in Life Attenuates Hypertrophy and Oxidative Stress Burden, Increases Mitochondrial Mass, and Modulates Mitochondrial Quality Control Signaling in the Rat Heart. Biomolecules 2018, 8, 177. [Google Scholar] [CrossRef] [PubMed]
- De Benedictis, G.; Rose, G.; Carrieri, G.; De Luca, M.; Falcone, E.; Passarino, G.; Bonafe, M.; Monti, D.; Baggio, G.; Bertolini, S.; et al. Mitochondrial DNA inherited variants are associated with successful aging and longevity in humans. FASEB J. 1999, 13, 1532–1536. [Google Scholar] [CrossRef] [PubMed]
- Kolovou, G.D.; Kolovou, V.; Mavrogeni, S. We are ageing. Biomed. Res. Int. 2014, 2014, 808307. [Google Scholar] [CrossRef]
- Marzetti, E.; Eva, S.; Anne, H.; Chung, H.; Giovannini, S.; Leeuwenburgh, C. Age-related activation of mitochondrial caspase-independent apoptotic signaling in rat gastrocnemius muscle. Mech. Ageing Dev. 2008, 129, 542–549. [Google Scholar] [CrossRef] [Green Version]
- Baker, D.J.; Hepple, R.T. Elevated caspase and AIF gene expression correlate with progression of sarcopenia during aging in male F344BN rats. Exp. Gerontol. 2006, 41, 1149–1156. [Google Scholar] [CrossRef]
- Hepple, R.T.; Hagen, J.L.; Krause, D.J.; Baker, D.J. Skeletal muscle aging in F344BN F1-hybrid rats: II. Improved contractile economy in senescence helps compensate for reduced ATP-generating capacity. J. Gerontol. A Biol. Sci. Med. Sci. 2004, 59, 1111–1119. [Google Scholar] [CrossRef]
- Hagen, J.L.; Krause, D.J.; Baker, D.J.; Fu, M.H.; Tarnopolsky, M.A.; Hepple, R.T. Skeletal muscle aging in F344BN F1-hybrid rats: I. Mitochondrial dysfunction contributes to the age-associated reduction in VO2max. J. Gerontol. A Biol. Sci. Med. Sci. 2004, 59, 1099–1110. [Google Scholar] [CrossRef] [PubMed]
- Picca, A.; Pesce, V.; Sirago, G.; Fracasso, F.; Leeuwenburgh, C.; Lezza, A.M.S. “What makes some rats live so long?” The mitochondrial contribution to longevity through balance of mitochondrial dynamics and mtDNA content. Exp. Gerontol. 2016, 85, 33–40. [Google Scholar] [CrossRef]
- Picca, A.; Pesce, V.; Fracasso, F.; Joseph, A.M.; Leeuwenburgh, C.; Lezza, A.M. A comparison among the tissue-specific effects of aging and calorie restriction on TFAM amount and TFAM-binding activity to mtDNA in rat. Biochim. Biophys. Acta 2014, 1840, 2184–2191. [Google Scholar] [CrossRef] [Green Version]
- Nicassio, L.; Fracasso, F.; Sirago, G.; Musicco, C.; Picca, A.; Marzetti, E.; Calvani, R.; Cantatore, P.; Gadaleta, M.N.; Pesce, V. Dietary supplementation with acetyl-l-carnitine counteracts age-related alterations of mitochondrial biogenesis, dynamics and antioxidant defenses in brain of old rats. Exp. Gerontol. 2017, 98, 99–109. [Google Scholar] [CrossRef]
- Chimienti, G.; Picca, A.; Sirago, G.; Fracasso, F.; Calvani, R.; Bernabei, R.; Russo, F.; Carter, C.S.; Leeuwenburgh, C.; Pesce, V.; et al. Increased TFAM binding to mtDNA damage hot spots is associated with mtDNA loss in aged rat heart. Free Radic. Biol. Med. 2018, 124, 447–453. [Google Scholar] [CrossRef]
- Mengel-From, J.; Thinggaard, M.; Dalgard, C.; Kyvik, K.O.; Christensen, K.; Christiansen, L. Mitochondrial DNA copy number in peripheral blood cells declines with age and is associated with general health among elderly. Hum. Genet. 2014, 133, 1149–1159. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, C.; White, S.H.; Warren, L.K.; Wohlgemuth, S.E. Skeletal muscle from aged American Quarter Horses shows impairments in mitochondrial biogenesis and expression of autophagy markers. Exp. Gerontol. 2018, 102, 19–27. [Google Scholar] [CrossRef]
- Clay Montier, L.L.; Deng, J.J.; Bai, Y. Number matters: Control of mammalian mitochondrial DNA copy number. J. Genet. Genomics 2009, 36, 125–131. [Google Scholar] [CrossRef]
- Campbell, C.T.; Kolesar, J.E.; Kaufman, B.A. Mitochondrial transcription factor A regulates mitochondrial transcription initiation, DNA packaging, and genome copy number. Biochim. Biophys. Acta 2012, 1819, 921–929. [Google Scholar] [CrossRef] [PubMed]
- Picca, A.; Lezza, A.M. Regulation of mitochondrial biogenesis through TFAM-mitochondrial DNA interactions: Useful insights from aging and calorie restriction studies. Mitochondrion 2015, 25, 67–75. [Google Scholar] [CrossRef]
- Picca, A.; Pesce, V.; Fracasso, F.; Joseph, A.M.; Leeuwenburgh, C.; Lezza, A.M.S. Aging and calorie restriction oppositely affect mitochondrial biogenesis through TFAM binding at both origins of mitochondrial DNA replication in rat liver. PLoS ONE 2013, 8, e74644. [Google Scholar] [CrossRef] [PubMed]
- Turturro, A.; Witt, W.W.; Lewis, S.; Hass, B.S.; Lipman, R.D.; Hart, R.W. Growth curves and survival characteristics of the animals used in the Biomarkers of Aging Program. J. Gerontol. A Biol. Sci. Med. Sci. 1999, 54, B492–B501. [Google Scholar] [CrossRef] [PubMed]
- Gadaleta, M.N.; Rainaldi, G.; Lezza, A.M.; Milella, F.; Fracasso, F.; Cantatore, P. Mitochondrial DNA copy number and mitochondrial DNA deletion in adult and senescent rats. Mutat. Res. 1992, 275, 181–193. [Google Scholar] [CrossRef]
- Yowe, D.L.; Ames, B.N. Quantitation of age-related mitochondrial DNA deletions in rat tissues shows that their pattern of accumulation differs from that of humans. Gene 1998, 209, 23–30. [Google Scholar] [CrossRef]
- Gondo, Y.; Masui, Y.; Kamide, K.; Ikebe, K.; Arai, Y.; Ishizaki, T. SONIC Study. In Encyclopedia of Geropsychology; Pachana, N.A., Ed.; Springer: Singapore, 2016; pp. 2227–2235. [Google Scholar] [CrossRef]
- Puca, A.A.; Spinelli, C.; Accardi, G.; Villa, F.; Caruso, C. Centenarians as a model to discover genetic and epigenetic signatures of healthy ageing. Mech. Ageing Dev. 2018, 174, 95–102. [Google Scholar] [CrossRef] [PubMed]
- Khan, S.S.; Singer, B.D.; Vaughan, D.E. Molecular and physiological manifestations and measurement of aging in humans. Aging Cell. 2017, 16, 624–633. [Google Scholar] [CrossRef]
- Shadyab, A.H.; LaCroix, A.Z. Genetic factors associated with longevity: A review of recent findings. Ageing Res. Rev. 2015, 19, 1–7. [Google Scholar] [CrossRef]
- Navarro, A.; Boveris, A. The mitochondrial energy transduction system and the aging process. Am. J. Physiol. Cell Physiol. 2007, 292, C670–C686. [Google Scholar] [CrossRef]
- Pesce, V.; Nicassio, L.; Fracasso, F.; Musicco, C.; Cantatore, P.; Gadaleta, M.N. Acetyl-L-carnitine activates the peroxisome proliferator-activated receptor-γ coactivators PGC-1α/PGC-1β-dependent signaling cascade of mitochondrial biogenesis and decreases the oxidized peroxiredoxins content in old rat liver. Rejuvenation Res. 2012, 15, 136–139. [Google Scholar] [CrossRef]
- Hebert, S.L.; Marquet-de Rougé, P.; Lanza, I.R.; McCrady-Spitzer, S.K.; Levine, J.A.; Middha, S.; Carter, R.E.; Klaus, K.A.; Therneau, T.M.; Highsmith, E.W.; et al. Mitochondrial Aging and Physical Decline: Insights From Three Generations of Women. J. Gerontol. A Biol. Sci. Med. Sci. 2015, 70, 1409–1417. [Google Scholar] [CrossRef] [Green Version]
- Edris, W.; Burgett, B.; Stine, O.C.; Filburn, C.R. Detection and quantitation by competitive PCR of an age-associated increase in a 4.8-kb deletion in rat mitochondrial DNA. Mutat. Res. 1994, 316, 69–78. [Google Scholar] [CrossRef]
- Lodeiro, M.F.; Uchida, A.; Bestwick, M.; Moustafa, I.M.; Arnold, J.J.; Shadel, G.S.; Cameron, C.E. Transcription from the second heavy-strand promoter of human mtDNA is repressed by transcription factor A in vitro. Proc. Natl. Acad. Sci. USA 2012, 109, 6513–6518. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zollo, O.; Tiranti, V.; Sondheimer, N. Transcriptional requirements of the distal heavy-strand promoter of mtDNA. Proc. Natl. Acad. Sci. USA 2012, 109, 6508–6512. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shutt, T.E.; Bestwick, M.; Shadel, G.S. The core human mitochondrial transcription initiation complex. It only takes two to tango. Transcription 2011, 2, 55–59. [Google Scholar] [CrossRef] [PubMed]
- Hudson, E.K.; Hogue, B.A.; Souza-Pinto, N.C.; Croteau, D.L.; Anson, R.M.; Bohr, V.A.; Hansford, R.G. Age-associated change in mitochondrial DNA damage. Free Radic. Res. 1998, 29, 573–579. [Google Scholar] [CrossRef]
- López-Torres, M.; Gredilla, R.; Sanz, A.; Barja, G. Influence of aging and long-term caloric restriction on oxygen radical generation and oxidative DNA damage in rat liver mitochondria. Free Radic. Biol. Med. 2002, 32, 882–889. [Google Scholar] [CrossRef]
- Nakamoto, H.; Kaneko, T.; Tahara, S.; Hayashi, E.; Naito, H.; Radak, Z.; Goto, S. Regular exercise reduces 8-oxodG in the nuclear and mitochondrial DNA and modulates the DNA repair activity in the liver of old rats. Exp. Gerontol. 2007, 42, 287–295. [Google Scholar] [CrossRef]
- Souza-Pinto, N.C.; Croteau, D.L.; Hudson, E.K.; Hansford, R.G.; Bohr, V.A. Age-associated increase in 8-oxo-deoxyguanosine glycosylase/AP lyase activity in rat mitochondria. Nucleic Acids Res. 1999, 27, 1935–1942. [Google Scholar] [CrossRef] [Green Version]
- Pastukh, V.M.; Gorodnya, O.M.; Gillespie, M.N.; Ruchko, M.V. Regulation of mitochondrial genome replication by hypoxia: The role of DNA oxidation in D-loop region. Free Radic. Biol. Med. 2016, 96, 78–88. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Caston, R.A.; Demple, B. Risky repair: DNA-protein crosslinks formed by mitochondrial base excision DNA repair enzymes acting on free radical lesions. Free Radic. Biol. Med. 2017, 107, 146–150. [Google Scholar] [CrossRef]
- Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
- Srere, P.A. Citrate synthase: [EC 4.1.3.7. Citrate oxaloacetate-lyase (CoA-acetylating)]. Methods Enzymol. 1969, 13, 3–11. [Google Scholar]
- Picca, A.; Fracasso, F.; Pesce, V.; Cantatore, P.; Joseph, A.M.; Leeuwenburgh, C.; Gadaleta, M.N.; Lezza, A.M. Age- and calorie restriction-related changes in rat brain mitochondrial DNA and TFAM binding. Age 2013, 35, 1607–1620. [Google Scholar] [CrossRef]
- Vercauteren, K.; Pasko, R.A.; Gleyzer, N.; Marino, V.M.; Scarpulla, R.C. PGC-1-related coactivator: Immediate early expression and characterization of a CREB/NRF-1 binding domain associated with cytochrome c promoter occupancy and respiratory growth. Mol. Cell. Biol. 2006, 26, 7409–7419. [Google Scholar] [CrossRef]
Primer Set | Forward Primer | Reverse Primer | (nps) | (nps) |
---|---|---|---|---|
mtDNA | 5′GGTTCTTACTTCAGGGCCATCA3′ | 5′TGATTAGACCCGTTACCATCGA3′ | 15,785–15,806 | 15,868–15,847 |
β-actin | 5′CCCAGCCATGTACGTAGCCA3′ | 5′CGTCTCCGGAGTCCATCAC3′ | 2181–2200 | 2266–2248 |
4.8 Del | 5′AAGGACGAACCTGAGCCCTAATA3′ | 5′CGAAGTAGATGATGCGTATACTGTA3′ | 8109–8131 | 13,020–12,996 |
RT D-loop | 5′CACCCCCTACACCTGAAACTT3′ | 5′TTTGTGTCGGGAAATTTTACCAAT3′ | 16,092–16,112 | 16,250–16,227 |
RT Ori-L | 5′CAGCTAAATACCCTACTTACTGG3′ | 5′GCCCCCTTTTTACCAAAAAGCC3′ | 5120–5142 | 5270–5249 |
RT DR1 | 5′GACTAATCAAACTTATCATCAAACAA3′ | 5′ GCTGAGTGGTAGGGGTAAATGT3′ | 8061–8086 | 8210–8189 |
D-loop long | 5′TCTGGTCTTGTAAACCAAAAATGA3′ | 5′TGGAATTTTCTGAGGGTAGGC3′ | 15,302–15,325 | 16,302–16,282 |
Ori-L long | 5′AACCAGACCCAAACACGAAA3′ | 5′CTATTCCTGCTCAGGCTCCA3′ | 4414–4433 | 5407–5388 |
DR1 long | 5′CCGCCTAAACCAAGCTACAG3′ | 5′AAGGCTACGGCAAATTCAAG’ | 7536–7555 | 8541–8522 |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chimienti, G.; Picca, A.; Fracasso, F.; Marzetti, E.; Calvani, R.; Leeuwenburgh, C.; Russo, F.; Lezza, A.M.S.; Pesce, V. Differences in Liver TFAM Binding to mtDNA and mtDNA Damage between Aged and Extremely Aged Rats. Int. J. Mol. Sci. 2019, 20, 2601. https://doi.org/10.3390/ijms20102601
Chimienti G, Picca A, Fracasso F, Marzetti E, Calvani R, Leeuwenburgh C, Russo F, Lezza AMS, Pesce V. Differences in Liver TFAM Binding to mtDNA and mtDNA Damage between Aged and Extremely Aged Rats. International Journal of Molecular Sciences. 2019; 20(10):2601. https://doi.org/10.3390/ijms20102601
Chicago/Turabian StyleChimienti, Guglielmina, Anna Picca, Flavio Fracasso, Emanuele Marzetti, Riccardo Calvani, Christiaan Leeuwenburgh, Francesco Russo, Angela Maria Serena Lezza, and Vito Pesce. 2019. "Differences in Liver TFAM Binding to mtDNA and mtDNA Damage between Aged and Extremely Aged Rats" International Journal of Molecular Sciences 20, no. 10: 2601. https://doi.org/10.3390/ijms20102601
APA StyleChimienti, G., Picca, A., Fracasso, F., Marzetti, E., Calvani, R., Leeuwenburgh, C., Russo, F., Lezza, A. M. S., & Pesce, V. (2019). Differences in Liver TFAM Binding to mtDNA and mtDNA Damage between Aged and Extremely Aged Rats. International Journal of Molecular Sciences, 20(10), 2601. https://doi.org/10.3390/ijms20102601