The Direct Interaction between E93 and Kr-h1 Mediated Their Antagonistic Effect on Ovary Development of the Brown Planthopper
Abstract
1. Introduction
2. Results
2.1. Downregulation of Kr-h1 Partially Recovered the Deteriorating Effect of E93 Knock-Down on Metamorphosis
2.2. Downregulation of Kr-h1 Partially Recovered the Deteriorating Effect of E93 Knock-Down on Ovary Development
2.3. E93 Interacts Directly with Kr-h1
2.4. Sub-Cellular Localization of E93 and Kr-h1
2.5. Expression of E93 and Kr-h1 was Increased When Kr-h1 is Down-Regulated Compared to the Knock Down of E93 Alone
3. Discussion
4. Materials and Methods
4.1. Insects
4.2. Cloning of Genes for dsRNA Synthesis
4.3. RNAi
4.4. qRT-PCR
4.5. Egg Counting, Ovary Dissection, and Classification
4.6. Construction of Plasmids
4.7. Cell Culture
4.8. Transiently Transfects Plasmid into Cells
4.9. GST Pull-Down
4.10. Co-Immunoprecipitation (Co-IP)
4.11. Western Blotting
4.12. Cellular Localization Experiment
4.13. Imaging and Statistical Analyses
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Jindra, M.; Palli, S.R.; Riddiford, L.M. The juvenile hormone signaling pathway in insect development. Annu. Rev. Entomol. 2013, 58, 181–204. [Google Scholar] [CrossRef]
- Riddiford, L.M. Juvenile hormone action: A 2007 perspective. J. Insect Physiol. 2008, 54, 895–901. [Google Scholar] [CrossRef]
- Riddiford, L.M. How does juvenile hormone control insect metamorphosis and reproduction? Gen. Comp. Endocrinol. 2012, 179, 477–484. [Google Scholar] [CrossRef]
- Riddiford, L.M.; Ashburner, M. Effects of juvenile hormone mimics on larval development and metamorphosis of Drosophila melanogaster. Gen. Comp. Endocrinol. 1991, 82, 172–183. [Google Scholar] [CrossRef]
- Riddiford, L.M.; Truman, J.W.; Mirth, C.K.; Shen, Y.C. A role for juvenile hormone in the prepupal development of Drosophila melanogaster. Development 2010, 137, 1117–1126. [Google Scholar] [CrossRef] [PubMed]
- Jin, M.N.; Xue, J.; Yao, Y.; Lin, X.D. Molecular Characterization and Functional Analysis of Krüppel-homolog 1 (Kr-h1) in the Brown Planthopper, Nilaparvata lugens (Stål). J. Integr. Agric. 2014, 13, 1972–1981. [Google Scholar] [CrossRef]
- Minakuchi, C.; Zhou, X.; Riddiford, L.M. Kruppel homolog 1 (Kr-h1) mediates juvenile hormone action during metamorphosis of Drosophila melanogaster. Mech. Dev. 2008, 125, 91–105. [Google Scholar] [CrossRef] [PubMed]
- Fussnecker, B.; Grozinger, C. Dissecting the role of Kr-h1 brain gene expression in foraging behavior in honey bees (Apis mellifera). Insect Mol. Biol. 2008, 17, 515–522. [Google Scholar] [CrossRef]
- Jindra, M.; Bellés, X.; Shinoda, T. Molecular basis of juvenile hormone signaling. Curr. Opin. Insect Sci. 2015, 11, 39–46. [Google Scholar] [CrossRef]
- Jiang, J.; Xu, Y.; Lin, X. Role of Broad-Complex (Br) and Kruppel homolog 1 (Kr-h1) in the Ovary Development of Nilaparvata lugens. Front. Physiol. 2017, 8, 1013. [Google Scholar] [CrossRef] [PubMed]
- Urena, E.; Manjon, C.; Franch-Marro, X.; Martin, D. Transcription factor E93 specifies adult metamorphosis in hemimetabolous and holometabolous insects. Proc. Natl. Acad. Sci. USA 2014, 111, 7024–7029. [Google Scholar] [CrossRef] [PubMed]
- Mou, X.; Duncan, D.M.; Baehrecke, E.H.; Duncan, I. Control of target gene specificity during metamorphosis by the steroid response gene E93. Proc. Natl. Acad. Sci. USA 2012, 109, 2949–2954. [Google Scholar] [CrossRef] [PubMed]
- Belles, X.; Santos, C.G. The MEKRE93 (Methoprene tolerant-Kruppel homolog 1-E93) pathway in the regulation of insect metamorphosis, and the homology of the pupal stage. Insect Biochem. Mol. Biol. 2014, 52, 60–68. [Google Scholar] [CrossRef]
- Lee, C.Y.; Wendel, D.P.; Reid, P.; Lam, G.; Thummel, C.S.; Baehrecke, E.H. E93 directs steroid-triggered programmed cell death in Drosophila. Mol. Cell 2000, 6, 433–443. [Google Scholar] [CrossRef]
- Baehrecke, E.H.; Thummel, C.S. The Drosophila E93 gene from the 93F early puff displays stage- and tissue-specific regulation by 20-hydroxyecdysone. Dev. Biol. 1995, 171, 85–97. [Google Scholar] [CrossRef]
- Kage, E.; Hayashi, Y.; Takeuchi, H.; Hirotsu, T.; Kunitomo, H.; Inoue, T.; Arai, H.; Iino, Y.; Kubo, T. MBR-1, a novel helix-turn-helix transcription factor, is required for pruning excessive neurites in Caenorhabditis elegans. Curr. Biol. 2005, 15, 1554–1559. [Google Scholar] [CrossRef] [PubMed]
- Fernandes, I.; Bastien, Y.; Wai, T.; Nygard, K.; Lin, R.; Cormier, O.; Lee, H.S.; Eng, F.; Bertos, N.R.; Pelletier, N.; et al. Ligand-dependent nuclear receptor corepressor LCoR functions by histone deacetylase-dependent and -independent mechanisms. Mol. Cell 2003, 11, 139–150. [Google Scholar] [CrossRef]
- Gujar, H.; Palli, S.R. Kruppel homolog 1 and E93 mediate Juvenile hormone regulation of metamorphosis in the common bed bug, Cimex lectularius. Sci. Rep. 2016, 6, 26092. [Google Scholar] [CrossRef]
- Liu, H.; Wang, J.; Li, S. E93 predominantly transduces 20-hydroxyecdysone signaling to induce autophagy and caspase activity in Drosophila fat body. Insect Biochem. Mol. Biol. 2014, 45, 30–39. [Google Scholar] [CrossRef]
- Urena, E.; Chafino, S.; Manjon, C.; Franch-Marro, X.; Martin, D. The Occurrence of the Holometabolous Pupal Stage Requires the Interaction between E93, Kruppel-Homolog 1 and Broad-Complex. PLOS Genet. 2016, 12, e1006020. [Google Scholar] [CrossRef]
- Liu, X.; Dai, F.; Guo, E.; Li, K.; Ma, L.; Tian, L.; Cao, Y.; Zhang, G.; Palli, S.R.; Li, S. 20-Hydroxyecdysone (20E) Primary Response Gene E93 Modulates 20E Signaling to Promote Bombyx Larval-Pupal Metamorphosis. J. Biol. Chem. 2015, 290, 27370–27383. [Google Scholar] [CrossRef]
- Lin, X.; Yao, Y.; Wang, B. Methoprene-tolerant (Met) and Krupple-homologue 1 (Kr-h1) are required for ovariole development and egg maturation in the brown plant hopper. Sci. Rep. 2015, 5, 18064. [Google Scholar] [CrossRef]
- Kayukawa, T.; Jouraku, A.; Ito, Y.; Shinoda, T. Molecular mechanism underlying juvenile hormone-mediated repression of precocious larval-adult metamorphosis. Proc. Natl. Acad. Sci. USA 2017, 114, 1057–1062. [Google Scholar] [CrossRef]
- Yoshida, S.; Forno, D.A.; Cock, J.H. Laboratory Manual for Physiological Studies of Rice; International Rice Research Institute: Leguna, Philippines, 1976. [Google Scholar]
- Lin, X.; Yao, Y.; Jin, M.; Li, Q. Characterization of the Distal-less gene homologue, NlDll, in the brown planthopper, Nilaparvata lugens (Stal). Gene 2014, 535, 112–118. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Yuan, M.; Lu, Y.; Zhu, X.; Wan, H.; Shakeel, M.; Zhan, S.; Jin, B.R.; Li, J. Selection and evaluation of potential reference genes for gene expression analysis in the brown planthopper, Nilaparvata lugens (Hemiptera: Delphacidae) using reverse-transcription quantitative PCR. PLOS ONE 2014, 9, e86503. [Google Scholar] [CrossRef]
Name | Sequence (5′-3′) |
---|---|
E93F | ATGGACAGCAAGGCCTGGCATC |
E93R | CTATGACTCTTGCCGTTCTGATC |
E93QF | AACAACCTCCCGAAATGCAT |
E93QR | TGCATATGATGGTGGTGGTG |
KrhQF | TGATGAGGCACACGATGACT |
KrhQR | ATGGAAGGCCACATCAAGAG |
RP15 | CCGATCGTGTGGCGTTGAAGGG |
RP15 | ATGGCCGACATTCTTCCAGGTCC |
dsGFP | TAATACGACTCACTATAGGGAGACCACGGGCGAGGAGCTGTTCACCG |
dsGFP | TAATACGACTCACTATAGGGAGACCACGCAGGACCATGTGATCGCGC |
dsKrF | TAATACGACTCACTATAGGGAGACCACGTGGGGTTCAGTCCTGAGGA |
dsKrR | TAATACGACTCACTATAGGGAGACCACCAGTCGAACACACACCGGAC |
dsE93F | TAATACGACTCACTATAGGGAGACCACGCCAGCTTACATGACGAAGA |
dsE93R | TAATACGACTCACTATAGGGAGACCACCAGAGTGCAGGATGGATGAC |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mao, Y.; Li, Y.; Gao, H.; Lin, X. The Direct Interaction between E93 and Kr-h1 Mediated Their Antagonistic Effect on Ovary Development of the Brown Planthopper. Int. J. Mol. Sci. 2019, 20, 2431. https://doi.org/10.3390/ijms20102431
Mao Y, Li Y, Gao H, Lin X. The Direct Interaction between E93 and Kr-h1 Mediated Their Antagonistic Effect on Ovary Development of the Brown Planthopper. International Journal of Molecular Sciences. 2019; 20(10):2431. https://doi.org/10.3390/ijms20102431
Chicago/Turabian StyleMao, Yiwen, Yan Li, Han Gao, and Xinda Lin. 2019. "The Direct Interaction between E93 and Kr-h1 Mediated Their Antagonistic Effect on Ovary Development of the Brown Planthopper" International Journal of Molecular Sciences 20, no. 10: 2431. https://doi.org/10.3390/ijms20102431
APA StyleMao, Y., Li, Y., Gao, H., & Lin, X. (2019). The Direct Interaction between E93 and Kr-h1 Mediated Their Antagonistic Effect on Ovary Development of the Brown Planthopper. International Journal of Molecular Sciences, 20(10), 2431. https://doi.org/10.3390/ijms20102431