Asperuloside and Asperulosidic Acid Exert an Anti-Inflammatory Effect via Suppression of the NF-κB and MAPK Signaling Pathways in LPS-Induced RAW 264.7 Macrophages
Abstract
1. Introduction
2. Results
2.1. Effects of Five Iridoids on RAW 264.7 Cell Viability
2.2. Effects of Five Iridoids on Inflammatory Mediators and Inflammatory Cytokines in RAW 264.7 Cells
2.3. Effects of ASP and ASPA on TNF-α and IL-6 mRNA Expression in LPS-Induced RAW 264.7 Cells
2.4. Effects of ASP and ASPA on iNOS and COX-2 Protein and mRNA Expression in LPS-Induced RAW 264.7 Cells
2.5. Effects of ASP and ASPA on NF-κB and MAPK Pathways in LPS-Induced RAW 264.7 Cells
3. Discussion
4. Materials and Methods
4.1. Chemicals, Reagents, and Cell Line
4.2. Cell Culture
4.3. Cell Viability Assay
4.4. ELISA Assay of NO, PGE2, TNF-α, and IL-6
4.5. Real-Time PCR Assay
4.6. Western Blot Analysis
4.7. Statistical Analyses
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Tall, A.R.; Yvan-Charvet, L. Cholesterol, inflammation and innate immunity. Nat. Rev. Immunol. 2015, 15, 104–116. [Google Scholar] [CrossRef] [PubMed]
- Fernandez, M.I.; Pedron, T.; Tournebize, R.; Olivo-Marin, J.C.; Sansonetti, P.J.; Phalipon, A. Anti-inflammatory role for intracellular dimeric immunoglobulin a by neutralization of lipopolysaccharide in epithelial cells. Immunity 2003, 18, 739–749. [Google Scholar] [CrossRef]
- Mancino, A.; Termanini, A.; Barozzi, I.; Ghisletti, S.; Ostuni, R.; Prosperini, E.; Ozato, K.; Natoli, G. A dual cis-regulatory code links IRF8 to constitutive and inducible gene expression in macrophages. Genes Dev. 2015, 29, 394–408. [Google Scholar] [CrossRef] [PubMed]
- Voll, R.E.; Herrmann, M.; Roth, E.A.; Stach, C.; Kalden, J.R.; Girkontaite, I. Immunosuppressive effects of apoptotic cells. Nature 1997, 390, 350–351. [Google Scholar] [CrossRef] [PubMed]
- Kiemer, A.K.; Hartung, T.; Huber, C.; Vollmar, A.M. Phyllanthusamarus has anti-inflammatory potential by inhibition of iNOS, COX-2, and cytokines via the NF-κB pathway. J. Hepatol. 2003, 38, 289–297. [Google Scholar] [CrossRef]
- Kawahara, K.; Hohjoh, H.; Inazumi, T.; Tsuchiya, S.; Sugimoto, Y. Prostaglandin E 2-induced inflammation: Relevance of prostaglandin E receptors. BBA-Mol. Cell Biol. Lipids 2015, 1851, 414–421. [Google Scholar] [CrossRef] [PubMed]
- Blaser, H.; Dostert, C.; Mak, T.W.; Brenner, D. TNF and ROS crosstalk in inflammation. Trends Cell Biol. 2016, 26, 249–261. [Google Scholar] [CrossRef] [PubMed]
- Zhai, X.T.; Zhang, Z.Y.; Jiang, C.H.; Chen, J.Q.; Ye, J.Q.; Jia, X.B.; Yang, Y.; Ni, Q.; Wang, S.X.; Song, J.; et al. Nauclea officinalis inhibits inflammation in LPS-mediated RAW 264.7 macrophages by suppressing the NF-κB signaling pathway. J. Ethnopharmacol. 2016, 183, 159–165. [Google Scholar] [CrossRef] [PubMed]
- Tak, P.P.; Firestein, G.S. NF-κB: A key role in inflammatory diseases. J. Clin. Investig. 2001, 107, 7–11. [Google Scholar] [CrossRef] [PubMed]
- Craig, R.; Larkin, A.; Mingo, A.M.; Thuerauf, D.J.; Andrews, C.; McDonough, P.M.; Glembotski, C.C. p38 MAPK and NF-κB collaborate to induce interleukin-6 gene expression and release evidence for a cytoprotective autocrine signaling pathway in a cardiac myocyte model system. J. Biol. Chem. 2000, 275, 23814–23824. [Google Scholar] [CrossRef] [PubMed]
- Editorial Board of Flora of China. The Chinese Academy of Sciences, Flora of China; Science Press: Beijing, China, 1999; Volume 71, p. 75. [Google Scholar]
- Nanjing University of Chinese Medicine. Dictionary of Chinese Traditional Medicine (Zhong Yao Da Ci Dian), 2nd ed.; Shanghai Scientific & Technical Publishers: Shanghai, China, 2006; pp. 1039–1041. [Google Scholar]
- Chen, R.; He, J.; Tong, X.; Tang, L.; Liu, M. The Hedyotis diffusa Willd (Rubiaceae): A review on phytochemistry, pharmacology, quality control and pharmacokinetics. Molecules 2016, 21, 710. [Google Scholar] [CrossRef] [PubMed]
- Kim, Y.; Park, E.J.; Kim, J.; Kim, Y.B.; Kim, S.R.; Kim, Y.C. Neuroprotective constituents from Hedyotis diffusa. J. Nat. Prod. 2001, 64, 75–78. [Google Scholar] [CrossRef] [PubMed]
- Li, M.; Jiang, R.W.; Hon, P.M.; Cheng, L.; Li, L.L.; Zhou, J.R.; Shaw, P.C.; But, P.P.H. Authentication of the anti-tumor herb Baihuasheshecao with bioactive marker compounds and molecular sequences. Food Chem. 2010, 119, 1239–1245. [Google Scholar] [CrossRef]
- He, J.Y.; Li, J.F.; Liu, H.; Yang, Z.C.; Zhou, F.H.; Wei, T.; Dong, Y.Q.; Xue, H.J.; Tang, L.; Liu, M.H. Scandoside exerts anti-Inflammatory effect via suppressing NF-κB and MAPK signaling pathways in LPS-induced RAW 264.7 macrophages. Int. J. Mol. Sci. 2018, 19, 457. [Google Scholar] [CrossRef] [PubMed]
- Ye, J.H.; Liu, M.H.; Zhang, X.L.; He, J.Y. Chemical profiles and protective effect of Hedyotis diffusa Willd in lipopolysaccharide-induced renal inflammation mice. Int. J. Mol. Sci. 2015, 16, 27252–27269. [Google Scholar] [CrossRef] [PubMed]
- Lin, C.W.; Hwang, T.L.; Chen, F.A.; Huang, C.H.; Hung, H.Y.; Wu, T.S. Chemical constituents of the rhizomes of Bletilla formosana and their potential anti-inflammatory activity. J. Nat. Prod. 2016, 79, 1911–1921. [Google Scholar] [CrossRef] [PubMed]
- Li, D.; Chen, J.; Ye, J.; Zhai, X.; Song, J.; Jiang, C.; Wang, J.; Zhang, H.; Jia, X.; Zhu, F. Anti-inflammatory effect of the six compounds isolated from Nauclea officinalis Pierrc ex Pitard, and molecular mechanism of strictosamide via suppressing the NF-κB and MAPK signaling pathway in LPS-induced RAW 264.7 macrophages. J. Ethnopharmacol. 2017, 196, 66–74. [Google Scholar] [CrossRef] [PubMed]
- Shen, D.Y.; Kuo, P.C.; Huang, S.C.; Hwang, T.L.; Chan, Y.Y.; Shieh, P.C.; Ngan, N.T.; Thang, T.D.; Wu, T.S. Constituents from the leaves of Clausena lansium and their anti-inflammatory activity. J. Nat. Med. 2017, 71, 96–104. [Google Scholar] [CrossRef] [PubMed]
- Saravanan, S.; Islam, V.I.; Babu, N.P.; Pandikumar, P.; Thirugnanasambantham, K.; Chellappandian, M.; Raj, C.S.D.; Paulraj, M.G.; Ignacimuthu, S. Swertiamarin attenuates inflammation mediators via modulating NF-κB/Iκb and JAK2/STAT3 transcription factors in adjuvant induced arthritis. Eur. J. Pharm. Sci. 2014, 56, 70–86. [Google Scholar] [CrossRef] [PubMed]
- Shi, Q.; Cao, J.; Fang, L.; Zhao, H.; Liu, Z.; Ran, J.; Zheng, X.; Li, X.; Zhou, Y.; Ge, D.; et al. Geniposide suppresses LPS-induced nitric oxide, PGE2 and inflammatory cytokine by downregulating NF-κB, MAPK and AP-1 signaling pathways in macrophages. Int. Immunopharmacol. 2014, 20, 298–306. [Google Scholar] [CrossRef] [PubMed]
- Tran, P.H.; Le, V.D.; Do, T.H.; Nquyen, T.L.; Nquyen, P.T.; Nquyen, T.T.; Nquyen, T.D. Anti-inflammatory constituents from Psychotria prainii H. Lév. Nat. Prod. Res. 2017. [Google Scholar] [CrossRef] [PubMed]
- Li, C.; Dong, J.; Tian, J.; Deng, Z.; Song, X. LC/MS/MS determination and pharmacokinetic study of iridoid glycosides monotropein and deacetylasperulosidic acid isomers in rat plasma after oral administration of Morinda officinalis extract. Biomed. Chromatogr. 2015, 30, 163–168. [Google Scholar] [CrossRef] [PubMed]
- Qu, K.; Dai, J.; Zhao, L.; Lu, Y.; Li, B.; Zhao, X.; Hou, P.; Zhang, Y.; Bi, K.; Chen, X. A sensitive liquid chromatographic-mass spectrometric method for simultaneous quantification of six iridoid glycosides from Zhi-zi-chi decoction in rat plasma and its application to a pharmacokinetic study. J. Pharm. Biomed. Anal. 2013, 78–79, 83–91. [Google Scholar] [CrossRef] [PubMed]
- Minc-Golomb, D.; Tsarfaty, I.; Schwartz, J.P. Expression of inducible nitric oxide synthase by neurones following exposure to endotoxin and cytokine. Brit. J. Pharm. 1994, 112, 720–722. [Google Scholar] [CrossRef]
- Bogdan, C. Nitric oxide and the immune response. Nat. Immunol. 2001, 2, 907–916. [Google Scholar] [CrossRef] [PubMed]
- Reuter, S.; Gupta, S.C.; Chaturvedi, M.M.; Aggarwal, B.B. Oxidative stress, inflammation, and cancer: How are they linked? Free Radic. Biol. Med. 2010, 49, 1603–1616. [Google Scholar] [CrossRef] [PubMed]
- Simmons, D.L.; Botting, R.M.; Hla, T. Cyclooxygenase isozymes: The biology of prostaglandin synthesis and inhibition. Pharmacol. Rev. 2004, 56, 387–437. [Google Scholar] [CrossRef] [PubMed]
- Sun, L.L.; Wu, H.; Zhang, Y.Z.; Wang, R.; Wang, W.Y.; Wang, W.; Li, S.P.; Dai, L.; Zhang, Z.R. Design, synthesis and preliminary evaluation of the anti-inflammatory of the specific selective targeting druggable enzymome cyclooxygenase-2 (cox-2) small molecule. Pharm. Biol. 2016, 54, 2505–2514. [Google Scholar] [CrossRef] [PubMed]
- Choi, Y.K.; Ye, B.R.; Kim, J.; Kim, M.S.; Lee, W.W.; Ahn, G.N.; Kang, N.; Jung, W.K.; Heo, S.J. Bis (3-bromo-4, 5-dihydroxybenzyl) ether, a novel bromophenol from the marine red alga Polysiphonia morrowii that suppresses LPS-induced inflammatory response by inhibiting ROS-mediated ERK signaling pathway in RAW 264.7 macrophages. Biomed. Pharmacother. 2018, 103, 1170–1177. [Google Scholar] [CrossRef] [PubMed]
- Yayeh, T.; Oh, W.J.; Park, S.C.; Kim, T.H.; Cho, J.Y.; Park, H.J.; Lee, I.K.; Kim, S.K.; Hong, S.B.; Yun, B.S.; et al. Phellinus baumii ethyl acetate extract inhibits lipopolysaccharide-induced iNOS, COX-2, and proinflammatory cytokine expression in RAW264. 7 cells. J. Nat. Med. 2012, 66, 49–54. [Google Scholar] [CrossRef] [PubMed]
- Pan, M.H.; Lai, C.S.; Wang, Y.J.; Ho, C.T. Acacetin suppressed LPS-induced up-expression of iNOS and COX-2 in murine macrophages and TPA-induced tumor promotion in mice. Biochem. Pharmacol. 2006, 72, 1293–1303. [Google Scholar] [CrossRef] [PubMed]
- Varfolomeev, E.E.; Ashkenazi, A. Tumor necrosis factor: An apoptosis JuNKie? Cell 2004, 116, 491–497. [Google Scholar] [CrossRef]
- De Gonzalo-Calvo, D.; Neitzert, K.; Fernández, M.; Vega-Naredo, I.; Caballero, B.; García-Macía, M.; Suárez, F.M.; Rodríguez-Colunga, M.J.; Solano, J.J.; Coto-Montes, A. Differential inflammatory responses in aging and disease: TNF-α and IL-6 as possible biomarkers. Free Radic. Biol. Med. 2010, 49, 733–737. [Google Scholar] [CrossRef] [PubMed]
- Li, A.; Zhang, X.X.; Shu, M.; Wu, M.J.; Wang, J.; Zhang, J.Y.; Wang, R.; Li, P.; Wang, Y. Arctigenin suppresses renal interstitial fibrosis in a rat model of obstructive nephropathy. Phytomedicine 2017, 30, 28–41. [Google Scholar] [CrossRef] [PubMed]
- Karin, M.; Greten, F.R. NF-κB: Linking inflammation and immunity to cancer development and progression. Nat. Rev. Immunol. 2005, 5, 749–759. [Google Scholar] [CrossRef] [PubMed]
- Viatour, P.; Merville, M.P.; Bours, V.; Chariot, A. Phosphorylation of NF-κB and IκB proteins: Implications in cancer and inflammation. Trends Biochem. Sci. 2005, 30, 43–52. [Google Scholar] [CrossRef] [PubMed]
- Johnson, G.L.; Lapadat, R. Mitogen-activated protein kinase pathways mediated by ERK, JNK, and p38 protein kinases. Science 2002, 298, 1911–1912. [Google Scholar] [CrossRef] [PubMed]
- Arthur, J.S.C.; Ley, S.C. Mitogen-activated protein kinases in innate immunity. Nat. Rev. Immunol. 2013, 13, 679–692. [Google Scholar] [CrossRef] [PubMed]
- Qiu, J.; Chi, G.; Wu, Q.; Ren, Y.; Chen, C.; Feng, H. Pretreatment with the compound asperuloside decreases acute lung injury via inhibiting MAPK and NF-κB signaling in a murine model. Int. Immunopharmacol. 2016, 31, 109–115. [Google Scholar] [CrossRef] [PubMed]
- Viljoen, A.; Mncwangi, N.; Vermaak, I. Anti-inflammatory iridoids of botanical origin. Curr. Med. Chem. 2012, 19, 2104–2127. [Google Scholar] [CrossRef] [PubMed]
- Mantovani, A.; Allavena, P.; Sica, A.; Balkwill, F. Cancer-related inflammation. Nature 2008, 454, 436–444. [Google Scholar] [CrossRef] [PubMed]






| Genes | Sense Primer Sequence 5′–3′ | Antisense Primer Sequence 5′–3′ |
|---|---|---|
| TNF-α | GCGACGTGGAACTGGCAGAA | CAGTAGACAGAAGAGCGTGGTG |
| IL-6 | GTTGCCTTCTTGGGACTGAT | CATTTCCACGATTTCCCAGA |
| iNOS | TGGAGCGAGTTGTGGATTGT | CTCTGCCTATCCGTCTCGTC |
| COX-2 | ACCTGGTGAACTACGACTGC | TGGTCGGTTTGATGTTACTG |
| β-actin | TGCTGTCCCTGTATGCCTCTG | GCTGTAGCCACGCTCGGTCA |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
He, J.; Lu, X.; Wei, T.; Dong, Y.; Cai, Z.; Tang, L.; Liu, M. Asperuloside and Asperulosidic Acid Exert an Anti-Inflammatory Effect via Suppression of the NF-κB and MAPK Signaling Pathways in LPS-Induced RAW 264.7 Macrophages. Int. J. Mol. Sci. 2018, 19, 2027. https://doi.org/10.3390/ijms19072027
He J, Lu X, Wei T, Dong Y, Cai Z, Tang L, Liu M. Asperuloside and Asperulosidic Acid Exert an Anti-Inflammatory Effect via Suppression of the NF-κB and MAPK Signaling Pathways in LPS-Induced RAW 264.7 Macrophages. International Journal of Molecular Sciences. 2018; 19(7):2027. https://doi.org/10.3390/ijms19072027
Chicago/Turabian StyleHe, Jingyu, Xianyuan Lu, Ting Wei, Yaqian Dong, Zheng Cai, Lan Tang, and Menghua Liu. 2018. "Asperuloside and Asperulosidic Acid Exert an Anti-Inflammatory Effect via Suppression of the NF-κB and MAPK Signaling Pathways in LPS-Induced RAW 264.7 Macrophages" International Journal of Molecular Sciences 19, no. 7: 2027. https://doi.org/10.3390/ijms19072027
APA StyleHe, J., Lu, X., Wei, T., Dong, Y., Cai, Z., Tang, L., & Liu, M. (2018). Asperuloside and Asperulosidic Acid Exert an Anti-Inflammatory Effect via Suppression of the NF-κB and MAPK Signaling Pathways in LPS-Induced RAW 264.7 Macrophages. International Journal of Molecular Sciences, 19(7), 2027. https://doi.org/10.3390/ijms19072027
