Epsc Involved in the Encoding of Exopolysaccharides Produced by Bacillus amyloliquefaciens FZB42 Act to Boost the Drought Tolerance of Arabidopsis thaliana
Abstract
1. Introduction
2. Results
2.1. Epsc Contributes to the Ameliorative Effect of B. amyloliquefaciens on the Drought Tolerance of A. thaliana
2.2. The Presence of EpsC Promoted Antioxidant Metabolism in Droughted A. thaliana Plants
2.3. The Presence of EpsC Influenced Stomatal Control from Detached Leaves in Droughted A. thaliana Plants
2.4. The Presence of EpsC Altered the Transcript Levels of Stress-Responsive Genes in Arabidopsis Plants
2.5. The Additional Drought Tolerance Induced by Inoculation with FZB42 Involved the Action of both Ethylene and Jasmonate
2.6. The Absence of epsC Impaired Biofilm Formation and Compromised the Colonization of Arabidopsis Roots
2.7. Composition of the Exopolysaccharides Produced by B. amyloliquefaciens FZB42
3. Discussion
4. Materials and Methods
4.1. Plant Materials
4.2. Bacterial Strains and Plasmids
4.3. Construction of an epsC Mutant in FZB42
4.4. Analysis of the Monosaccharide Composition FZB42 Exopolysaccharide
4.5. Biofilm Formation and Growth of FZB42 and the epsC Mutant
4.6. Inoculation of A. thaliana with B. amyloliquefaciens
4.7. Adherence to and Colonization of A. thaliana Roots by Wild Type FZB42 and the epsC Mutant Cells
4.8. Stomatal Aperture Measurement
4.9. Physiological Assays
4.10. Quantitative Real Time PCR (qRT-PCR) Analysis
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Chaves, M.M.; Maroco, J.P.; Pereira, J.S. Understanding plant responses to drought—From genes to the whole plant. Funct. Plant Biol. 2003, 30, 239–264. [Google Scholar] [CrossRef]
- Lugtenberg, B.; Kamilova, F. Plant-growth-promoting rhizobacteria. Annu. Rev. Microbiol. 2009, 63, 541–556. [Google Scholar] [CrossRef] [PubMed]
- Vessey, J.K. Plant growth promoting rhizobacteria as biofertilizers. Plant Soil 2003, 255, 571–586. [Google Scholar] [CrossRef]
- Bhattacharyya, P.N.; Jha, D.K. Plant growth-promoting rhizobacteria (PGPR): Emergence in agriculture. World J. Microb. Biotechnol. 2012, 28, 1327–1350. [Google Scholar] [CrossRef] [PubMed]
- He, A.-L.; Niu, S.-Q.; Zhao, Q.; Li, Y.-S.; Gou, J.-Y.; Gao, H.-J.; Suo, S.-Z.; Zhang, J.-L. Induced salt tolerance of perennial ryegrass by a novel bacterium strain from the rhizosphere of a desert shrub Haloxylon ammodendron. Int. J. Mol. Sci. 2018, 19, 469. [Google Scholar] [CrossRef] [PubMed]
- Van Loon, L.C. Plant responses to plant growth-promoting bacteria. Eur. J. Plant Pathol. 2007, 119, 243–254. [Google Scholar] [CrossRef]
- Richardson, A.E.; Barea, J.-M.; McNeill, A.M.; Prigent-Combaret, C. Acquisition of phosphorus and nitrogen in the rhizosphere and plant growth promotion by microorganisms. Plant Soil 2009, 321, 305–339. [Google Scholar] [CrossRef]
- Yang, J.; Kloepper, J.W.; Ryu, C.M. Rhizosphere bacteria help plants tolerate abiotic stress. Trends Plant Sci. 2009, 14, 1–4. [Google Scholar] [CrossRef] [PubMed]
- Paul, D.; Lade, H. Plant-growth-promoting rhizobacteria to improve crop growth in saline soils: A review. Agron. Sustain. Dev. 2014, 34, 737–752. [Google Scholar] [CrossRef]
- Wang, C.-J.; Yang, W.; Wang, C.; Gu, C.; Niu, D.-D.; Liu, H.-X.; Wang, Y.-P.; Guo, J.-H. Induction of drought tolerance in cucumber plants by a consortium of three plant growth-promoting rhizobacterium strains. PLoS ONE 2012, 7, e52565. [Google Scholar] [CrossRef] [PubMed]
- Nadeem, S.M.; Ahmad, M.; Zahir, Z.A.; Javaid, A.; Ashraf, M. The role of mycorrhizae and plant growth promoting rhizobacteria (PGPR) in improving crop productivity under stressful environments. Biotechnol. Adv. 2014, 32, 429–448. [Google Scholar] [CrossRef] [PubMed]
- Kohler, J.; Hernández, J.A.; Caravaca, F.; Roldán, A. Plant-growth-promoting rhizobacteria and arbuscular mycorrhizal fungi modify alleviation biochemical mechanisms in water-stressed plants. Funct. Plant Biol. 2008, 35, 141–151. [Google Scholar] [CrossRef]
- Calvo-Polanco, M.; Sánchez-Romera, B.; Aroca, R.; Asins, M.J.; Declerck, S.; Dodd, I.C.; Martínez-Andújar, C.; Albacete, A.; Ruiz-Lozano, J.M. Exploring the use of recombinant inbred lines in combination with beneficial microbial inoculants (AM fungus and PGPR) to improve drought stress tolerance in tomato. Environ. Exp. Bot. 2016, 131, 47–57. [Google Scholar] [CrossRef]
- Wilkinson, S.; Davies, W.J. ABA-based chemical signalling: The co-ordination of responses to stress in plants. Plant Cell Environ. 2002, 25, 195–210. [Google Scholar] [CrossRef] [PubMed]
- Figueiredo, M.V.; Burity, H.A.; Martínez, C.R.; Chanway, C.P. Alleviation of drought stress in the common bean (Phaseolus vulgaris L.) by co-inoculation with Paenibacillus polymyxa and Rhizobium tropici. Appl. Soil Ecol. 2008, 40, 182–188. [Google Scholar] [CrossRef]
- Tiwari, S.; Prasad, V.; Chauhan, P.S.; Lata, C. Bacillus amyloliquefaciens confers tolerance to various abiotic stresses and modulates plant response to phytohormones through osmoprotection and gene expression regulation in rice. Front. Plant Sci. 2017, 8, 1510. [Google Scholar] [CrossRef] [PubMed]
- Glick, B.R.; Cheng, Z.; Czarny, J.; Duan, J. Promotion of plant growth by ACC deaminase-producing soil bacteria. In New Perspectives and Approaches in Plant Growth-Promoting Rhizobacteria Research, 1st ed.; Bakker, P.A.H.M., Raaijmakers, J.M., Bloemberg, G., Höfte, M., Lemanceau, P., Cooke, B.M., Eds.; Springer: Dordrecht, The Netherlands, 2007; pp. 329–339. ISBN 978-1-4020-6776-1. [Google Scholar]
- Branda, S.S.; Vik, A.; Friedman, L.; Kolter, R. Biofilms: The matrix revisited. Trends Microbiol. 2005, 13, 20–26. [Google Scholar] [CrossRef] [PubMed]
- Davey, M.E.; O’toole, G.A. Microbial biofilms: From ecology to molecular genetics. Microbiol. Mol. Biol. Rev. 2000, 64, 847–867. [Google Scholar] [CrossRef] [PubMed]
- Stewart, P.S.; Franklin, M.J. Physiological heterogeneity in biofilms. Nat. Rev. Microbiol. 2008, 6, 199–210. [Google Scholar] [CrossRef] [PubMed]
- Zhang, N.; Wang, D.; Liu, Y.; Li, S.; Shen, Q.; Zhang, R. Effects of different plant root exudates and their organic acid components on chemotaxis, biofilm formation and colonization by beneficial rhizosphere-associated bacterial strains. Plant Soil 2014, 374, 689–700. [Google Scholar] [CrossRef]
- Timmusk, S.; Grantcharova, N.; Wagner, E.G.H. Paenibacillus polymyxa invades plant roots and forms biofilms. Appl. Environ. Microbiol. 2005, 71, 7292–7300. [Google Scholar] [CrossRef] [PubMed]
- Qiu, M.; Xu, Z.; Li, X.; Li, Q.; Zhang, N.; Shen, Q.; Zhang, R. Comparative proteomics analysis of Bacillus amyloliquefaciens SQR9 revealed the key proteins involved in in situ root colonization. J. Proteome Res. 2014, 13, 5581–5591. [Google Scholar] [CrossRef] [PubMed]
- Xu, Z.; Zhang, R.; Wang, D.; Qiu, M.; Feng, H.; Zhang, N.; Shen, Q. Enhanced control of cucumber wilt disease by Bacillus amyloliquefaciens SQR9 through altering the regulation of its DegU phosphorylation. Appl. Environ. Microbiol. 2014, 80, 2941–2950. [Google Scholar] [CrossRef] [PubMed]
- Weng, J.; Wang, Y.; Li, J.; Shen, Q.; Zhang, R. Enhanced root colonization and biocontrol activity of Bacillus amyloliquefaciens SQR9 by abrB gene disruption. Appl. Microbiol. Biotechnol. 2013, 97, 8823–8830. [Google Scholar] [CrossRef] [PubMed]
- Zhao, X.; Wang, Y.; Shang, Q.; Li, Y.; Hao, H.; Zhang, Y.; Guo, Z.; Yang, G.; Xie, Z.; Wang, R. Collagen-like proteins (ClpA, ClpB, ClpC, and ClpD) are required for biofilm formation and adhesion to plant roots by Bacillus amyloliquefaciens FZB42. PLoS ONE 2015, 10, e0117414. [Google Scholar] [CrossRef] [PubMed]
- John, A.; Leigh, D.L.C. Exopolysaccharides in plant-bacterial interactions. Annu. Rev. Microbiol. 1992, 46, 307–346. [Google Scholar]
- Ashraf, M.; Hasnain, S.; Berge, O.; Mahmood, T. Inoculating wheat seedlings with exopolysaccharide-producing bacteria restricts sodium uptake and stimulates plant growth under salt stress. Biol. Fert. Soils 2004, 40, 157–162. [Google Scholar] [CrossRef]
- Sandhya, V.; Grover, M.; Reddy, G.; Venkateswarlu, B. Alleviation of drought stress effects in sunflower seedlings by the exopolysaccharides producing Pseudomonas putida strain GAP-P45. Biol. Fert. Soils 2009, 46, 17–26. [Google Scholar] [CrossRef]
- Kasotia, A.; Varma, A.; Tuteja, N.; Choudhary, D.K. Amelioration of soybean plant from saline-induced condition by exopolysaccharide producing Pseudomonas-mediated expression of high affinity K+-transporter (HKT1) gene. Curr. Sci. 2016, 111, 1961–1967. [Google Scholar] [CrossRef]
- Naseem, H.; Bano, A. Role of plant growth-promoting rhizobacteria and their exopolysaccharide in drought tolerance of maize. J. Plant Interact. 2014, 9, 689–701. [Google Scholar] [CrossRef]
- Jennings, L.K.; Storek, K.M.; Ledvina, H.E.; Coulon, C.; Marmont, L.S.; Sadovskaya, I.; Secor, P.R.; Tseng, B.S.; Scian, M.; Filloux, A. Pel is a cationic exopolysaccharide that cross-links extracellular DNA in the Pseudomonas aeruginosa biofilm matrix. Proc. Natl. Acad. Sci. USA 2015, 112, 11353–11358. [Google Scholar] [CrossRef] [PubMed]
- Idris, E.E.; Iglesias, D.J.; Talon, M.; Borriss, R. Tryptophan-dependent production of indole-3-acetic acid (IAA) affects level of plant growth promotion by Bacillus amyloliquefaciens FZB42. Mol. Plant Microbe Interact. 2007, 20, 619–626. [Google Scholar] [CrossRef] [PubMed]
- Liu, S.; Hao, H.; Lu, X.; Zhao, X.; Wang, Y.; Zhang, Y.; Xie, Z.; Wang, R. Transcriptome profiling of genes involved in induced systemic salt tolerance conferred by Bacillus amyloliquefaciens FZB42 in Arabidopsis thaliana. Sci. Rep. 2017, 7, 10795. [Google Scholar] [CrossRef] [PubMed]
- Xie, S.; Jiang, H.; Ding, T.; Xu, Q.; Chai, W.; Cheng, B. Bacillus amyloliquefaciens FZB42 repressed plant miR846 to induce systemic resistance via jasmonic acid-dependent signaling pathway. Mol. Plant Pathol. 2017, 19, 1612–1623. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.H.; Koumoutsi, A.; Scholz, R.; Eisenreich, A.; Schneider, K.; Heinemeyer, I.; Morgenstern, B.; Voss, B.; Hess, W.R.; Reva, O.; et al. Comparative analysis of the complete genome sequence of the plant growth–promoting bacterium Bacillus amyloliquefaciens FZB42. Nat. Biotechnol. 2007, 25, 1007–1014. [Google Scholar] [CrossRef] [PubMed]
- Niu, X.; Song, L.; Xiao, Y.; Ge, W. Drought-tolerant plant growth-promoting rhizobacteria associated with foxtail millet in a semi-arid agroecosystem and their potential in alleviating drought stress. Front. Microbiol. 2018, 8, 2580. [Google Scholar] [CrossRef] [PubMed]
- Barnawal, D.; Bharti, N.; Pandey, S.S.; Pandey, A.; Chanotiya, C.S.; Kalra, A. Plant growth-promoting rhizobacteria enhance wheat salt and drought stress tolerance by altering endogenous phytohormone levels and TaCTR1/TaDREB2 expression. Physiol. Plantarum 2017, 161, 502–514. [Google Scholar] [CrossRef] [PubMed]
- Huang, X.-F.; Zhou, D.; Lapsansky, E.R.; Reardon, K.F.; Guo, J.; Andales, M.J.; Vivanco, J.M.; Manter, D.K. Mitsuaria sp. and Burkholderia sp. from Arabidopsis rhizosphere enhance drought tolerance in Arabidopsis thaliana and maize (Zea mays L.). Plant Soil 2017, 419, 523–539. [Google Scholar] [CrossRef]
- Xiong, J.-L.; Li, J.; Wang, H.-C.; Zhang, C.-L.; Naeem, M.S. Fullerol improves seed germination, biomass accumulation, photosynthesis and antioxidant system in Brassica napus L. under water stress. Plant Physiol. Biochem. 2018, 129, 130–140. [Google Scholar] [CrossRef] [PubMed]
- Xiong, H.; Yu, J.; Miao, J.; Li, J.; Zhang, H.; Wang, X.; Liu, P.; Zhao, Y.; Jiang, C.; Yin, Z. Natural variation in OsLG3 increases drought tolerance in rice by inducing ROS scavenging. Plant Physiol. 2018, 178, 451–467. [Google Scholar] [CrossRef] [PubMed]
- Yamada, M.; Morishita, H.; Urano, K.; Shiozaki, N.; Yamaguchi-Shinozaki, K.; Shinozaki, K.; Yoshiba, Y. Effects of free proline accumulation in petunias under drought stress. J. Exp. Bot. 2005, 56, 1975–1981. [Google Scholar] [CrossRef] [PubMed]
- Wang, W.-B.; Kim, Y.-H.; Lee, H.-S.; Kim, K.-Y.; Deng, X.-P.; Kwak, S.-S. Analysis of antioxidant enzyme activity during germination of alfalfa under salt and drought stresses. Plant Physiol. Biochem. 2009, 47, 570–577. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.; Liang, D.; Li, C.; Hao, Y.; Ma, F.; Shu, H. Influence of drought stress on the cellular ultrastructure and antioxidant system in leaves of drought-tolerant and drought-sensitive apple rootstocks. Plant Physiol. Biochem. 2012, 51, 81–89. [Google Scholar] [CrossRef] [PubMed]
- Gururani, M.A.; Upadhyaya, C.P.; Baskar, V.; Venkatesh, J.; Nookaraju, A.; Park, S.W. Plant growth-promoting rhizobacteria enhance abiotic stress tolerance in Solanum tuberosum through inducing changes in the expression of ROS-scavenging enzymes and improved photosynthetic performance. J. Plant Growth Regul. 2013, 32, 245–258. [Google Scholar] [CrossRef]
- Ngumbi, E.; Kloepper, J. Bacterial-mediated drought tolerance: Current and future prospects. Appl. Soil Ecol. 2016, 105, 109–125. [Google Scholar] [CrossRef]
- Del Rio, D.; Stewart, A.J.; Pellegrini, N. A review of recent studies on malondialdehyde as toxic molecule and biological marker of oxidative stress. Nutr. Metab. Cardiovasc. 2005, 15, 316–328. [Google Scholar] [CrossRef] [PubMed]
- Cohen, A.C.; Bottini, R.; Pontin, M.; Berli, F.J.; Moreno, D.; Boccanlandro, H.; Travaglia, C.N.; Piccoli, P.N. Azospirillum brasilense ameliorates the response of Arabidopsis thaliana to drought mainly via enhancement of ABA levels. Physiol. Plantarum 2015, 153, 79–90. [Google Scholar] [CrossRef] [PubMed]
- Van Ha, C.; Leyva-González, M.A.; Osakabe, Y.; Tran, U.T.; Nishiyama, R.; Watanabe, Y.; Tanaka, M.; Seki, M.; Yamaguchi, S.; Van Dong, N. Positive regulatory role of strigolactone in plant responses to drought and salt stress. Proc. Natl. Acad. Sci. USA 2014, 111, 851–856. [Google Scholar]
- Li, W.; Nguyen, K.H.; Chu, H.D.; Van Ha, C.; Watanabe, Y.; Osakabe, Y.; Leyva-González, M.A.; Sato, M.; Toyooka, K.; Voges, L.; et al. The karrikin receptor KAI2 promotes drought resistance in Arabidopsis thaliana. PLoS Genet. 2017, 13, e1007076. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.; Wang, F.; Hong, Y.; Huang, J.; Shi, H.; Zhu, J.K. Two chloroplast proteins suppress drought resistance by affecting ROS production in guard cells. Plant Physiol. 2016, 172, 2491–2503. [Google Scholar] [CrossRef] [PubMed]
- Prudent, M.; Salon, C.; Souleimanov, A.; Emery, R.N.; Smith, D.L. Soybean is less impacted by water stress using Bradyrhizobium japonicum and thuricin-17 from Bacillus thuringiensis. Agron. Sustain. Dev. 2015, 35, 749–757. [Google Scholar] [CrossRef]
- Ali, L.; Khalid, M.; Asghar, H.N.; Asgher, M. Scrutinizing of rhizobacterial isolates for improving drought resilience in maize (Zea mays). Int. J. Agric. Biol. 2017, 19, 1054–1064. [Google Scholar] [CrossRef]
- Liu, F.; Xing, S.; Ma, H.; Du, Z.; Ma, B. Cytokinin-producing, plant growth-promoting rhizobacteria that confer resistance to drought stress in Platycladus orientalis container seedlings. Appl. Microbiol. Biotechnol. 2013, 97, 9155–9164. [Google Scholar] [CrossRef] [PubMed]
- Shinozaki, K.; Yamaguchi-Shinozaki, K. Gene networks involved in drought stress response and tolerance. J. Exp. Bot. 2007, 58, 221–227. [Google Scholar] [CrossRef] [PubMed]
- Gontia-Mishra, I.; Sapre, S.; Sharma, A.; Tiwari, S. Amelioration of drought tolerance in wheat by the interaction of plant growth-promoting rhizobacteria. Plant Biol. 2016, 18, 992–1000. [Google Scholar] [CrossRef] [PubMed]
- Montero-Barrientos, M.; Hermosa, R.; Cardoza, R.E.; Gutierrez, S.; Nicolas, C.; Monte, E. Transgenic expression of the Trichoderma harzianum hsp70 gene increases Arabidopsis resistance to heat and other abiotic stresses. J. Plant Physiol. 2010, 167, 659–665. [Google Scholar] [CrossRef] [PubMed]
- Pandey, V.; Ansari, M.W.; Tula, S.; Yadav, S.; Sahoo, R.K.; Shukla, N.; Bains, G.; Badal, S.; Chandra, S.; Gaur, A. Dose-dependent response of Trichoderma harzianum in improving drought tolerance in rice genotypes. Planta 2016, 243, 1251–1264. [Google Scholar] [CrossRef] [PubMed]
- Ali, F.; Bano, A.; Fazal, A. Recent methods of drought stress tolerance in plants. Plant Growth Regul. 2017, 82, 363–375. [Google Scholar] [CrossRef]
- Raghavendra, A.S.; Gonugunta, V.K.; Christmann, A.; Grill, E. ABA perception and signalling. Trends Plant Sci. 2010, 15, 395–401. [Google Scholar] [CrossRef] [PubMed]
- Chini, A.; Grant, J.J.; Seki, M.; Shinozaki, K.; Loake, G.J. Drought tolerance established by enhanced expression of the CC–NBS–LRR gene, ADR1, requires salicylic acid, EDS1 and ABI1. Plant J. 2004, 38, 810–822. [Google Scholar] [CrossRef] [PubMed]
- Kazan, K. Diverse roles of jasmonates and ethylene in abiotic stress tolerance. Trends Plant Sci. 2015, 20, 219–229. [Google Scholar] [CrossRef] [PubMed]
- Singh, D.; Laxmi, A. Transcriptional regulation of drought response: A tortuous network of transcriptional factors. Front. Plant Sci. 2015, 6, 895. [Google Scholar] [CrossRef] [PubMed]
- Golan, Y.; Shirron, N.; Avni, A.; Shmoish, M.; Gepstein, S. Cytokinins induce transcriptional reprograming and improve arabidopsis plant performance under drought and salt stress conditions. Front. Environ. Sci. 2016, 4, 63. [Google Scholar] [CrossRef]
- Pilon-Smits, E.A.; Terry, N.; Sears, T.; van Dun, K. Enhanced drought resistance in fructan-producing sugar beet. Plant Physiol. Biochem. 1999, 37, 313–317. [Google Scholar] [CrossRef]
- Pilon-Smits, E.A.; Ebskamp, M.J.; Paul, M.J.; Jeuken, M.J.; Weisbeek, P.J.; Smeekens, S.C. Improved performance of transgenic fructan-accumulating tobacco under drought stress. Plant Physiol. 1995, 107, 125–130. [Google Scholar] [CrossRef] [PubMed]
- Forni, C.; Duca, D.; Glick, B.R. Mechanisms of plant response to salt and drought stress and their alteration by rhizobacteria. Plant Soil 2017, 410, 335–356. [Google Scholar] [CrossRef]
- Ledger, T.; Rojas, S.; Timmermann, T.; Pinedo, I.; Poupin, M.J.; Garrido, T.; Richter, P.; Tamayo, J.; Donoso, R. Volatile-mediated effects predominate in Paraburkholderia phytofirmans growth promotion and salt stress tolerance of Arabidopsis thaliana. Front. Microbiol. 2016, 7, 1838. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.-M.; Zhang, H. The effects of bacterial volatile emissions on plant abiotic stress tolerance. Front. Plant Sci. 2015, 6, 774. [Google Scholar] [CrossRef] [PubMed]
- Fazli, M.; Almblad, H.; Rybtke, M.L.; Givskov, M.; Eberl, L.; Tolker-Nielsen, T. Regulation of biofilm formation in P. seudomonas and B. urkholderia species. Environ. Microbiol. 2014, 16, 1961–1981. [Google Scholar] [CrossRef] [PubMed]
- Rinaudi, L.V.; González, J.E. The low-molecular-weight fraction of exopolysaccharide II from Sinorhizobium meliloti is a crucial determinant of biofilm formation. J. Bacteriol. 2009, 191, 7216–7224. [Google Scholar] [CrossRef] [PubMed]
- Ramey, B.E.; Koutsoudis, M.; von Bodman, S.B.; Fuqua, C. Biofilm formation in plant–microbe associations. Curr. Opin. Microbiol. 2004, 7, 602–609. [Google Scholar] [CrossRef] [PubMed]
- Flemming, H.-C.; Wingender, J. The biofilm matrix. Nat. Rev. Microbiol. 2010, 8, 623–633. [Google Scholar] [CrossRef] [PubMed]
- Hori, K.; Matsumoto, S. Bacterial adhesion: From mechanism to control. Biochem. Eng. J. 2010, 48, 424–434. [Google Scholar] [CrossRef]
- Kumar, M.; Mishra, S.; Dixit, V.; Kumar, M.; Agarwal, L.; Chauhan, P.S.; Nautiyal, C.S. Synergistic effect of Pseudomonas putida and Bacillus amyloliquefaciens ameliorates drought stress in chickpea (Cicer arietinum L.). Plant Signal. Behav. 2016, 11, e1071004. [Google Scholar] [CrossRef] [PubMed]
- Danhorn, T.; Fuqua, C. Biofilm formation by plant-associated bacteria. Annu. Rev. Microbiol. 2007, 61, 401–422. [Google Scholar] [CrossRef] [PubMed]
- Staswick, P.E.; Su, W.; Howell, S.H. Methyl jasmonate inhibition of root growth and induction of a leaf protein are decreased in an Arabidopsis thaliana mutant. Proc. Natl. Acad. Sci. USA 1992, 89, 6837–6840. [Google Scholar] [CrossRef] [PubMed]
- Clarke, S.M.; Cristescu, S.M.; Miersch, O.; Harren, F.J.; Wasternack, C.; Mur, L.A. Jasmonates act with salicylic acid to confer basal thermotolerance in Arabidopsis thaliana. New Phytol. 2009, 182, 175–187. [Google Scholar] [CrossRef] [PubMed]
- Anagnostopoulos, C.; Spizizen, J. Requirements for transformation in Bacillus subtilis. J. Bacteriol. 1961, 81, 741–746. [Google Scholar] [PubMed]
- Fan, B.; Chen, X.H.; Budiharjo, A.; Bleiss, W.; Vater, J.; Borriss, R. Efficient colonization of plant roots by the plant growth promoting bacterium Bacillus amyloliquefaciens FZB42, engineered to express green fluorescent protein. J. Biotechnol. 2011, 151, 303–311. [Google Scholar] [CrossRef] [PubMed]
- Liu, C.; Lu, J.; Lu, L.; Liu, Y.; Wang, F.; Xiao, M. Isolation, structural characterization and immunological activity of an exopolysaccharide produced by Bacillus licheniformis 8-37-0-1. Bioresour. Technol. 2010, 101, 5528–5533. [Google Scholar] [CrossRef] [PubMed]
- Yang, H.; Wu, Y.; Gan, C.; Yue, T.; Yuan, Y. Characterization and antioxidant activity of a novel polysaccharide from Pholidota chinensis Lindl. Carbohydr. Polym. 2016, 138, 327–334. [Google Scholar] [CrossRef] [PubMed]
- Quigley, M.E.; Englyst, H.N. Determination of the uronic acid constituents of non-starch polysaccharides by high-performance liquid chromatography with pulsed amperometric detection. Analyst 1994, 119, 1511–1518. [Google Scholar] [CrossRef] [PubMed]
- Gao, T.; Greenwich, J.; Li, Y.; Wang, Q.; Chai, Y. The bacterial tyrosine kinase activator TkmA contributes to biofilm formation largely independent of the cognate kinase PtkA in Bacillus subtilis. J. Bacteriol. 2015. [Google Scholar] [CrossRef] [PubMed]
- Hodges, D.M.; Forney, C.F. The effects of ethylene, depressed oxygen and elevated carbon dioxide on antioxidant profiles of senescing spinach leaves. J. Exp. Bot. 2000, 51, 645–655. [Google Scholar] [CrossRef] [PubMed]
- Meloni, D.A.; Oliva, M.A.; Martinez, C.A.; Cambraia, J. Photosynthesis and activity of superoxide dismutase, peroxidase and glutathione reductase in cotton under salt stress. Environ. Exp. Bot. 2003, 49, 69–76. [Google Scholar] [CrossRef]
- Demiral, T.; Türkan, I. Comparative lipid peroxidation, antioxidant defense systems and proline content in roots of two rice cultivars differing in salt tolerance. Environ. Exp. Bot. 2005, 53, 247–257. [Google Scholar] [CrossRef]
- Dhindsa, R.S.; Plumb-Dhindsa, P.; Thorpe, T.A. Leaf senescence: Correlated with increased levels of membrane permeability and lipid peroxidation, and decreased levels of superoxide dismutase and catalase. J. Exp. Bot. 1981, 32, 93–101. [Google Scholar] [CrossRef]
- Wang, X.; Huang, W.; Yang, Z.; Liu, J.; Huang, B. Transcriptional regulation of heat shock proteins and ascorbate peroxidase by CtHsfA2b from African bermudagrass conferring heat tolerance in Arabidopsis. Sci. Rep. 2016, 6, 28021. [Google Scholar] [CrossRef] [PubMed]
- Qin, F.; Sakuma, Y.; Tran, L.-S.P.; Maruyama, K.; Kidokoro, S.; Fujita, Y.; Fujita, M.; Umezawa, T.; Sawano, Y.; Miyazono, K.-I. Arabidopsis DREB2A-interacting proteins function as RING E3 ligases and negatively regulate plant drought stress–responsive gene expression. Plant Cell 2008, 20, 1693–1707. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]








| Primer | Sequence (5′–3′) | Size of DNA Sequence (bp) | Gene |
|---|---|---|---|
| epsC front-F | CCCAAGCTTCGTTGTCCTGAATGATCCGT | 539 | epsC front |
| epsC front-R | CGGGATCCGGAGAACCCGTCAAAATCGTC | …… | …… |
| epsC back-F | ACATGCATGCGATTTCCCGCGGAAGAAACG | 559 | epsC back |
| epsC back-R | CTAGTCTAGACCAATACGGGGTGTTCCACA | …… | …… |
| Chlor-F | CGGGATCCTAGAAGCTTATCGAATTCTCATG | 1250 | chlor |
| Chlor-R | ACATGCATGCAAGGAGATGGCGCCCAAC | …… | …… |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lu, X.; Liu, S.-F.; Yue, L.; Zhao, X.; Zhang, Y.-B.; Xie, Z.-K.; Wang, R.-Y. Epsc Involved in the Encoding of Exopolysaccharides Produced by Bacillus amyloliquefaciens FZB42 Act to Boost the Drought Tolerance of Arabidopsis thaliana. Int. J. Mol. Sci. 2018, 19, 3795. https://doi.org/10.3390/ijms19123795
Lu X, Liu S-F, Yue L, Zhao X, Zhang Y-B, Xie Z-K, Wang R-Y. Epsc Involved in the Encoding of Exopolysaccharides Produced by Bacillus amyloliquefaciens FZB42 Act to Boost the Drought Tolerance of Arabidopsis thaliana. International Journal of Molecular Sciences. 2018; 19(12):3795. https://doi.org/10.3390/ijms19123795
Chicago/Turabian StyleLu, Xiang, Shao-Fang Liu, Liang Yue, Xia Zhao, Yu-Bao Zhang, Zhong-Kui Xie, and Ruo-Yu Wang. 2018. "Epsc Involved in the Encoding of Exopolysaccharides Produced by Bacillus amyloliquefaciens FZB42 Act to Boost the Drought Tolerance of Arabidopsis thaliana" International Journal of Molecular Sciences 19, no. 12: 3795. https://doi.org/10.3390/ijms19123795
APA StyleLu, X., Liu, S.-F., Yue, L., Zhao, X., Zhang, Y.-B., Xie, Z.-K., & Wang, R.-Y. (2018). Epsc Involved in the Encoding of Exopolysaccharides Produced by Bacillus amyloliquefaciens FZB42 Act to Boost the Drought Tolerance of Arabidopsis thaliana. International Journal of Molecular Sciences, 19(12), 3795. https://doi.org/10.3390/ijms19123795

