Toxicity Evaluation and Biomarker Selection with Validated Reference Gene in Embryonic Zebrafish Exposed to Mitoxantrone
Abstract
1. Introduction
2. Results
2.1. Transcript Abundance and Amplification Efficiency of Candidate Reference Genes
2.2. Stability Evaluation of Candidate Reference Genes—NormFinder, geNorm, and BestKeeper Analysis
2.3. Expression Normalization and Comparison of Target Genes Based on Gapdh Internal Control
2.4. The Expression Analysis of Toxicity Biomarkers in Embryonic Zebrafish to Mitoxantrone Exposure
2.5. Liver Histopathology Analysis
2.6. Spontaneous Embryo Movement
3. Discussion
3.1. The Parameters Related with Reference Gene Stability
3.2. Validation of Reference Genes Based on Three Independent Algorithm Programs
3.3. Evaluation of Toxicity and Biomarker of Embryonic Zebrafish to Mitoxantrone
4. Materials and Methods
4.1. Zebrafish Maintenance
4.2. Zebrafish Embryo Toxicity Test
4.3. RNA Extraction and Reverse Transcription
4.4. Primer Design and Quantitative Real-Time PCR
4.5. Stability Evaluation of Candidate Reference Geness
4.6. Expression Normalization of Target Genes Based on Gapdh as Internal Control
4.7. Expression Analysis of Toxicity Biomarkers in Embryonic Zebrafish Exposure to Mitoxantrone
4.8. Liver HE Staining
4.9. Microscopic Observation and Counting
4.10. Statistical Analysis
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Ethics Statement
Abbreviations
CZRC | China Zebrafish Resource Center |
OECD | Organization for Economic Co-operation and Development |
qPCR | Quantitative Real-time PCR |
References
- Howe, K.; Clark, M.D.; Torroja, C.F.; Torrance, J.; Berthelot, C.; Muffato, M.; Collins, J.E.; Humphray, S.; McLaren, K.; Matthews, L.; et al. The zebrafish reference genome sequence and its relationship to the human genome. Nature 2013, 496, 498–503. [Google Scholar] [CrossRef] [PubMed]
- Fishman, M.C. Zebrafish-the Canonical Vertebrate. Science 2001, 294, 1290–1291. [Google Scholar] [CrossRef] [PubMed]
- Schier, A.F. Zebrafish earns its stripes. Nature 2013, 496, 443–444. [Google Scholar] [CrossRef] [PubMed]
- Lam, S.H.; Wu, Y.L.; Vega, V.B.; Miller, L.D.; Spitsbergen, J.; Tong, Y.; Zhan, H.; Govindarajan, K.R.; Lee, S.; Mathavan, S.; et al. Conservation of gene expression signatures between zebrafish and human liver tumors and tumor progression. Nat. Biotechnol. 2005, 24, 73–75. [Google Scholar] [CrossRef] [PubMed]
- Leach, S. Modelling pancreatic cancer in mice and zebrafish. Pancreatology 2012, 12, e3. [Google Scholar] [CrossRef]
- Rubinstein, A.L. Zebrafish assays for drug toxicity screening. Expert Opin. Drug Metab. Toxicol. 2006, 2, 231–240. [Google Scholar] [CrossRef] [PubMed]
- Kizek, R.; Adam, V.; Hrabeta, J.; Eckschlager, T.; Smutny, S.; Burda, J.V.; Frei, E.; Stiborova, M. Anthracyclines and ellipticines as DNA-damaging anticancer drugs: Recent advances. Pharmacol. Therapeut. 2012, 133, 26–39. [Google Scholar] [CrossRef] [PubMed]
- Blanz, J.; Mewes, K.; Ehninger, G.; Proksch, B.; Greger, B.; Waidelich, D.; Zeller, K.P. Isolation and structure elucidation of urinary metabolites of mitoxantrone. Cancer Res. 1991, 51, 3427–3433. [Google Scholar] [PubMed]
- Reis-Mendes, A.; Gomes, A.S.; Carvalho, R.A.; Carvalho, F.; Remião, F.; Pinto, M.; Bastos, M.L.; Sousa, E.; Costa, V.M. Naphthoquinoxaline metabolite of mitoxantrone is less cardiotoxic than the parent compound and it can be a more cardiosafe drug in anticancer therapy. Arch. Toxicol. 2017, 91, 1871–1890. [Google Scholar] [CrossRef] [PubMed]
- Richard, B.; Fabre, G.; Fabre, I.; Cano, J.P. Excretion and metabolism of mitoxantrone in rabbits. Cancer Res. 1989, 49, 833–837. [Google Scholar] [PubMed]
- Chiccarelli, F.S.; Morrison, J.A.; Cosulich, D.B.; Perkinson, N.A.; Ridge, D.N.; Sum, F.W.; Murdock, K.C.; Woodward, D.L.; Arnold, E.T. Identification of human urinary mitoxantrone metabolites. Cancer Res. 1986, 46, 4858–4861. [Google Scholar] [PubMed]
- Bhowmik, A.; Khan, R.; Ghosh, M.K. Blood brain barrier: A challenge for effectual therapy of brain tumors. BioMed Res. Int. 2015, 2015, 320941. [Google Scholar] [CrossRef] [PubMed]
- Damiani, R.M.; Moura, D.J.; Viau, C.M.; Caceres, R.A.; Henriques, J.A.P.; Saffi, J. Pathways of cardiac toxicity: Comparison between chemotherapeutic drugs doxorubicin and mitoxantrone. Arch. Toxicol. 2016, 90, 2063–2076. [Google Scholar] [CrossRef] [PubMed]
- Buerge, I.J.; Buser, H.; Poiger, T.; Mueller, M.D. Occurrence and fate of the cytostatic drugs cyclophosphamide and ifosfamide in wastewater and surface waters. Environ. Sci. Technol. 2006, 40, 7242–7250. [Google Scholar] [CrossRef] [PubMed]
- Rowney, N.C.; Johnson, A.C.; Williams, R.J. Cytotoxic drugs in drinking water: A prediction and risk assessment exercise for the thames catchment in the United Kingdom. Environ. Toxicol. Chem. 2009, 28, 2733–2743. [Google Scholar] [CrossRef] [PubMed]
- Gutierrez, L.; Mauriat, M.; Pelloux, J.; Bellini, C.; van Wuytswinkel, O. Towards a systematic validation of references in real-time RT-PCR. Plant Cell 2008, 20, 1734–1735. [Google Scholar] [CrossRef] [PubMed]
- Eriksen, A.H.M.; Andersen, R.F.; Pallisgaard, N.; Sorensen, F.B.; Jakobsen, A.; Hansen, T.F. MicroRNA Expression Profiling to Identify and Validate Reference Genes for the Relative Quantification of microRNA in Rectal Cancer. PLoS ONE 2016, 11, e0150593. [Google Scholar] [CrossRef] [PubMed]
- Ogawa, Y.; Shiraki, T.; Kojima, D.; Fukada, Y. Homeobox transcription factor Six7 governs expression of green opsin genes in zebrafish. Proc. R. Soc. B Biol. Sci. 2015, 282, 20150659. [Google Scholar] [CrossRef] [PubMed]
- Liu, C.; Su, G.; Giesy, J.P.; Letcher, R.J.; Li, G.; Agrawal, I.; Li, J.; Yu, L.; Wang, J.; Gong, Z. Acute Exposure to Tris(1,3-dichloro-2-propyl) Phosphate (TDCIPP) Causes Hepatic Inflammation and Leads to Hepatotoxicity in Zebrafish. Sci. Rep. 2016, 6, 19045. [Google Scholar] [CrossRef] [PubMed]
- Ulloa, P.; Solís, C.J.; De la Paz, J.F.; Alaurent, T.G.; Caruffo, M.; Hernández, A.J.; Dantagnan, P.; Feijóo, C.G. Lactoferrin Decreases the Intestinal Inflammation Triggered by a Soybean Meal-Based Diet in Zebrafish. J. Immunol. Res. 2016, 2, 1639720. [Google Scholar] [CrossRef] [PubMed]
- Johnston, I.A.; Lee, H.T.; Macqueen, D.J.; Paranthaman, K.; Kawashima, C.; Anwar, A.; Kinghorn, J.R.; Dalmay, T. Embryonic temperature affects muscle fibre recruitment in adult zebrafish: Genome-wide changes in gene and microRNA expression associated with the transition from hyperplastic to hypertrophic growth phenotypes. J. Exp. Biol. 2009, 212, 1781–1793. [Google Scholar] [CrossRef] [PubMed]
- Tang, R.; Dodd, A.; Lai, D.; McNabb, W.C.; Love, D.R. Validation of Zebrafish (Danio rerio) Reference Genes for Quantitative Real-time RT-PCR Normalization. Acta Biochim. Biophys. Sin. 2007, 39, 384–390. [Google Scholar] [CrossRef] [PubMed]
- Andersen, C.L.; Jensen, J.L.; Orntoft, T.F. Normalization of real-time quantitative reverse transcription-PCR data: A model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res. 2004, 64, 5245–5250. [Google Scholar] [CrossRef] [PubMed]
- Vandesompele, J.; De Preter, K.; Pattyn, F.; Poppe, B.; Van Roy, N.; De Paepe, A.; Speleman, F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002, 7, 31–34. [Google Scholar]
- Pfaffl, M.W.; Tichopad, A.; Prgomet, C.; Neuvians, T.P. Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: BestKeeper—Excel-based tool using pair-wise correlations. Biotechnol. Lett. 2004, 26, 509–515. [Google Scholar] [CrossRef] [PubMed]
- Cui, X.; Yu, S.; Tamhane, A.; Causey, Z.L.; Steg, A.; Danila, M.I.; Reynolds, R.J.; Wang, J.; Wanzeck, K.C.; Tang, Q.; et al. Simple regression for correcting ΔCt bias in RT-qPCR low-density array data normalization. BMC Genom. 2015, 16, 82. [Google Scholar] [CrossRef] [PubMed]
- Pei, D.; Sun, Y.; Chen, S.; Wang, Y.; Hu, W.; Zhu, Z. Zebrafish GAPDH can be used as a reference gene for expression analysis in cross-subfamily cloned embryos. Anal. Biochem. 2007, 363, 291–293. [Google Scholar] [CrossRef] [PubMed]
- Li, G.; Chen, J.; Xie, P.; Jiang, Y.; Wu, L.; Zhang, X. Protein expression profiling in the zebrafish (Danio rerio) embryos exposed to the microcystin-LR. Proteomics 2011, 11, 2003–2018. [Google Scholar] [CrossRef] [PubMed]
- Bai, J.; Gong, W.; Wang, C.; Gao, Y.; Hong, W.; Chen, S.X. Dynamic methylation pattern of cyp19a1a core promoter during zebrafish ovarian folliculogenesis. Fish Physiol. Biochem. 2016, 42, 947–954. [Google Scholar] [CrossRef] [PubMed]
- Benini, A.; Cignarella, F.; Calvarini, L.; Mantovanelli, S.; Giacopuzzi, E.; Zizioli, D.; Borsani, G. slc7a6os Gene Plays a Critical Role in Defined Areas of the Developing CNS in Zebrafish. PLoS ONE 2015, 10, e119696. [Google Scholar] [CrossRef] [PubMed]
- Cano-Nicolau, J.; Vaillant, C.; Pellegrini, E.; Charlier, T.D.; Kah, O.; Coumailleau, P. Estrogenic Effects of Several BPA Analogs in the Developing Zebrafish Brain. Front. Neurosci. 2016, 10, 112. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Z.; Sun, H.; Chen, Y.; Cao, T.; Zhou, S.; Huang, J.; Huang, Y. Analysis of hpf1 expression and function in early embryonic development of zebrafish. Dev. Genes Evol. 2018, 228, 141–147. [Google Scholar] [CrossRef] [PubMed]
- Lutte, A.H.; Capiotti, K.M.; Garcia Da Silva, N.L.; de Oliveira Da Silva, C.S.; Kist, L.W.; Bogo, M.R.; Da Silva, R.S. Contributions from extracellular sources of adenosine to the ethanol toxicity in zebrafish larvae. Reprod. Toxicol. 2015, 53, 82–91. [Google Scholar] [CrossRef] [PubMed]
- Baatrup, E.; Henriksen, P.G. Disrupted reproductive behavior in unexposed female zebrafish (Danio rerio) paired with males exposed to low concentrations of 17α-ethinylestradiol (EE2). Aquat. Toxicol. 2015, 160, 197–204. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Y.; Huang, X.; Ding, T.W.; Gong, Z. Enhanced angiogenesis, hypoxia and neutrophil recruitment during Myc-induced liver tumorigenesis in zebrafish. Sci. Rep. 2016, 6, 31952. [Google Scholar] [CrossRef] [PubMed]
- Du, Z.; Wang, G.; Gao, S.; Wang, Z. Aryl organophosphate flame retardants induced cardiotoxicity during zebrafish embryogenesis: By disturbing expression of the transcriptional regulators. Aquat. Toxicol. 2015, 161, 25–32. [Google Scholar] [CrossRef] [PubMed]
- Cui, Y.; Liu, W.; Xie, W.; Yu, W.; Wang, C.; Chen, H. Investigation of the Effects of Perfluorooctanoic Acid (PFOA) and Perfluorooctane Sulfonate (PFOS) on Apoptosis and Cell Cycle in a Zebrafish (Danio rerio) Liver Cell Line. Int. J. Environ. Res. Public Health 2015, 12, 15673–15682. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Wang, Y.; Hui, C.; Chen, J. Transcriptome analysis of the effect of Vibrio alginolyticus infection on the innate immunity-related TLR5-mediated induction of cytokines in Epinephelus lanceolatus. Fish Shellfish Immun. 2016, 52, 31–43. [Google Scholar] [CrossRef] [PubMed]
- Soyalan, B.; Minn, J.; Schmitz, H.J.; Schrenk, D.; Will, F.; Dietrich, H.; Baum, M.; Eisenbrand, G.; Janzowski, C. Apple juice intervention modulates expression of ARE-dependent genes in rat colon and liver. Eur. J. Nutr. 2011, 50, 135–143. [Google Scholar] [CrossRef] [PubMed]
- Ren, X.; Gaile, D.P.; Gong, Z.; Qiu, W.; Ge, Y. Arsenic responsive microRNAs in vivo and their potential involvement in arsenic-induced oxidative stress. Toxicol. Appl. Pharmacol. 2015, 283, 198–209. [Google Scholar] [CrossRef] [PubMed]
- Deponte, M. Glutathione catalysis and the reaction mechanisms of glutathione-dependent enzymes. Biochim. Biophys. Acta 2013, 1830, 3217–3266. [Google Scholar] [CrossRef] [PubMed]
- Asher, G.; Lotem, J.; Cohen, B.; Sachs, L.; Shaul, Y. Regulation of p53 stability and p53-dependent apoptosis by NADH quinone oxidoreductase 1. Proc. Natl. Acad. Sci. USA 2001, 98, 1188–1193. [Google Scholar] [CrossRef] [PubMed]
- Kohar, I.; Baca, M.; Suarna, C.; Stocker, R.; Southwell-Keely, P.T. Is α-tocopherol a reservoir for α-tocopheryl hydroquinone? Free Radic. Biol. Med. 1995, 19, 197–207. [Google Scholar] [CrossRef]
- Venkatachalam, A.B.; Thisse, C.; Thisse, B.; Wright, J.M. Differential tissue-specific distribution of transcripts for the duplicated fatty acid-binding protein 10 (fabp10) genes in embryos, larvae and adult zebrafish (Danio rerio). FEBS J. 2009, 276, 6787–6797. [Google Scholar] [CrossRef] [PubMed]
- Laprairie, R.B.; Denovan-Wright, E.M.; Wright, J.M. Differential regulation of the duplicated fabp7, fabp10 and fabp11 genes of zebrafish by peroxisome proliferator activated receptors. Comp. Biochem. Physiol. B. 2017, 213, 81–90. [Google Scholar] [CrossRef] [PubMed]
- Xuan-Bac, N.; Kislyuk, S.; Duc-Hung, P.; Kecskes, A.; Maes, J.; Cabooter, D.; Annaert, P.; De Witte, P.; Ny, A. Cell Imaging Counting as a Novel Ex Vivo Approach for Investigating Drug-Induced Hepatotoxicity in Zebrafish Larvae. Int. J. Mol. Sci. 2017, 18, 356. [Google Scholar]
- Liu, L.Y.; Fox, C.S.; North, T.E.; Goessling, W. Functional validation of GWAS gene candidates for abnormal liver function during zebrafish liver development. Dis. Model Mech. 2013, 6, 1271–1278. [Google Scholar] [CrossRef] [PubMed]
- Rossato, L.G.; Costa, V.M.; Dallegrave, E.; Arbo, M.; Dinis-Oliveira, R.J.; Santos-Silva, A.; Duarte, J.A.; Bastos, M.D.L.; Palmeira, C.; Remiao, F. Cumulative Mitoxantrone-Induced Haematological and Hepatic Adverse Effects in a Subchronic In vivo Study. Basic Clin. Pharmacol. 2014, 114, 254–262. [Google Scholar] [CrossRef] [PubMed]
- Rossato, L.G.; Costa, V.M.; Vilas-Boas, V.; de Lourdes Bastos, M.; Rolo, A.; Palmeira, C.; Remião, F. Therapeutic Concentrations of Mitoxantrone Elicit Energetic Imbalance in H9c2 Cells as an Earlier Event. Cardiovasc. Toxicol. 2013, 13, 413–425. [Google Scholar] [CrossRef] [PubMed]
- Langheinrich, U.; Vacun, G.; Wagner, T. Zebrafish embryos express an orthologue of HERG and are sensitive toward a range and are of QT-prolonging drugs inducing severe arrhythmia. Toxicol. Appl. Pharmacol. 2003, 193, 370–382. [Google Scholar] [CrossRef] [PubMed]
- Vijayaraj, P.; Le Bras, A.; Mitchell, N.; Kondo, M.; Juliao, S.; Wasserman, M.; Beeler, D.; Spokes, K.; Aird, W.C.; Baldwin, H.S.; et al. Erg is a crucial regulator of endocardial-mesenchymal transformation during cardiac valve morphogenesis. Development 2012, 139, 3973–3985. [Google Scholar] [CrossRef] [PubMed]
- Rossato, L.G.; Costa, V.M.; de Pinho, P.G.; Arbo, M.D.; de Freitas, V.; Vilain, L.; Bastos, M.D.L.; Palmeira, C.; Remiao, F. The metabolic profile of mitoxantrone and its relation with mitoxantrone-induced cardiotoxicity. Arch. Toxicol. 2013, 87, 1809–1820. [Google Scholar] [CrossRef] [PubMed]
- Cassiman, D.; Libbrecht, L.; Desmet, V.; Denef, C.; Roskams, T. Hepatic stellate cell/myofibroblast subpopulations in fibrotic human and rat livers. J. Hepatol. 2002, 36, 200–209. [Google Scholar] [CrossRef]
- McGrath, P.; Li, C. Zebrafish: A predictive model for assessing drug-induced toxicity. Drug Discov. Today 2008, 13, 394–401. [Google Scholar] [CrossRef] [PubMed]
- OECD. Test No. 236: Fish Embryo Acute Toxicity (FET) Test; OECD Publishing: Paris, France, 2013. [Google Scholar]
- Cao, F.; Liu, X.; Wang, C.; Zheng, M.; Li, X.; Qiu, L. Acute and short-term developmental toxicity of cyhalofop-butyl to zebrafish (Danio rerio). Environ. Sci. Pollut. Int. Res. 2016, 23, 10080–10089. [Google Scholar] [CrossRef] [PubMed]
- Mu, X.; Pang, S.; Sun, X.; Gao, J.; Chen, J.; Chen, X.; Li, X.; Wang, C. Evaluation of acute and developmental effects of difenoconazole via multiple stage zebrafish assays. Environ. Pollut. 2013, 175, 147–157. [Google Scholar] [CrossRef] [PubMed]
- Fraysse, B.; Mons, R.; Garric, J. Development of a zebrafish 4-day embryo-larval bioassay to assess toxicity of chemicals. Ecotox Environ. Safe 2006, 253–267. [Google Scholar] [CrossRef] [PubMed]
- Wang, D.W.; Mistry, A.M.; Kahlig, K.M.; Kearney, J.A.; Xiang, J.; George, A.L., Jr. Propranolol blocks cardiac and neuronal voltage-gated sodium channels. Front Pharmacol. 2010, 1, 144. [Google Scholar] [CrossRef] [PubMed]
- Jin, M.; Zhang, X.; Wang, L.; Huang, C.; Zhang, Y.; Zhao, M. Developmental toxicity of bifenthrin in embryo-larval stages of zebrafish. Aquat. Toxicol. 2009, 95, 347–354. [Google Scholar] [CrossRef] [PubMed]
- Westerfield, M. The Zebrafish Book: A Guide for the Laboratory Use of Zebrafish (Danio rerio), 5th ed.; Institute of Neuroscience University of Oregon Press: Eugene, OR, USA, 2007. [Google Scholar]
- Liu, L.; Yan, Y.; Wang, J.; Wu, W.; Xu, L. Generation of mt:egfp transgenic zebrafish biosensor for the detection of aquatic zinc and cadmium. Environ. Toxicol. Chem. 2016, 35, 2066–2073. [Google Scholar] [CrossRef] [PubMed]
- Santangeli, S.; Maradonna, F.; Gioacchini, G.; Cobellis, G.; Piccinetti, C.C.; Dalla Valle, L.; Carnevali, O. BPA-Induced Deregulation of Epigenetic Patterns: Effects on Female Zebrafish Reproduction. Sci. Rep. 2016, 6, 21982. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Q.Y.; Ma, X.Y.; Wang, X.C.; Ngo, H.H. Assessment of multiple hormone activities of a UV-filter (octocrylene) in zebrafish (Danio rerio). Chemosphere 2016, 159, 433–441. [Google Scholar] [CrossRef] [PubMed]
- Bebianno, M.J.; Gonzalez-Rey, M.; Gomes, T.; Mattos, J.J.; Flores-Nunes, F.; Bainy, A.C.D. Is gene transcription in mussel gills altered after exposure to Ag nanoparticles? Environ. Sci. Pollut. Int. Res. 2015, 22, 17425–17433. [Google Scholar] [CrossRef] [PubMed]
- Pashay Ahi, E.; Walker, B.S.; Lassiter, C.S.; Jónsson, Z.O. Investigation of the effects of estrogen on skeletal gene expression during zebrafish larval head development. PeerJ 2016, 4, e1878. [Google Scholar] [CrossRef] [PubMed]
- Campos, C.; Valente, L.M.P.; Fernandes, J.M.O. Molecular evolution of zebrafish dnmt3 genes and thermal plasticity of their expression during embryonic development. Gene 2012, 500, 93–100. [Google Scholar] [CrossRef] [PubMed]
- Fischer, A.H.; Jacobson, K.A.; Rose, J.; Zeller, R. Hematoxylin and eosin staining of tissue and cell sections. CSH Protoc. 2008, 2008, 4986. [Google Scholar] [CrossRef] [PubMed]
- Kilkenny, C.; Browne, W.; Cuthill, I.C.; Emerson, M.; Altman, D.G. Animal research: Reporting in vivo experiments-The ARRIVE Guidelines. J. Cereb. Blood Flow Metab. 2011, 31, 991–993. [Google Scholar] [CrossRef] [PubMed]
- Hooijmans, C.; de Vries, R.; Leenaars, M.; Ritskes-Hoitinga, M. The Gold Standard Publication Checklist (GSPC) for improved design, reporting and scientific quality of animal studies GSPC versus ARRIVE guidelines. Lab Anim. 2011, 45, 61. [Google Scholar] [CrossRef] [PubMed]
- Strähle, U.; Scholz, S.; Geisler, R.; Greiner, P.; Hollert, H.; Rastegar, S.; Schumacher, A.; Selderslaghs, I.; Weiss, C.; Witters, H.; et al. Zebrafish embryos as an alternative to animal experiments—A commentary on the definition of the onset of protected life stages in animal welfare regulations. Reprod. Toxicol. 2012, 33, 128–132. [Google Scholar] [CrossRef] [PubMed]
Gene Name | E | R2 | Mean Cq Value | Transcript Abundance |
---|---|---|---|---|
18S rRNA | 0.941 | 0.999 | 9.44 | High transcript abundance |
eef1a1l1 | 0.946 | 0.999 | 19.46 | Medium transcript abundance |
rpl13α | 1.016 | 0.998 | 20.53 | |
actβ2 | 0.957 | 0.999 | 21.58 | |
gapdh | 1.016 | 0.993 | 22.69 | |
polr2d | 0.922 | 0.994 | 25.4 | |
tubα1b | 1.001 | 0.993 | 25.86 | |
sdha | 0.963 | 0.997 | 27.92 | Low transcript abundance |
tbp | 0.972 | 0.996 | 27.97 | |
hmbsb | 0.901 | 0.987 | 29.56 | |
β2m | 0.959 | 0.984 | 31.7 |
M Value * | NormFinder | geNorm | BestKeeper |
---|---|---|---|
rpl13α | 0.021 | 0.678 | 1.70 |
actb2 | 0.013 | 0.668 | 1.22 |
polr2d | 0.020 | 0.842 | 2.00 |
18sRNA | 0.034 | 1.517 | 0.37 |
hmbsb | 0.026 | 1.266 | 2.37 |
sdha | 0.012 | 0.589 | 1.48 |
tbp | 0.012 | 0.814 | 2.00 |
β2m | 0.029 | 0.790 | 1.31 |
eef1a1l1 | 0.009 | 0.667 | 1.35 |
gapdh | 0.007 | 0.574 | 1.45 |
tubα1b | 0.010 | 0.613 | 1.46 |
M Value * | NormFinder | geNorm | BestKeeper |
---|---|---|---|
gapdh | 0.083 | 3.910 | 1.93 |
sdha | 0.008 | 1.731 | 2.05 |
eef1a1l1 | 0.002 | 1.578 | 1.17 |
rpl13α | 0.004 | 1.478 | 1.43 |
actβ2 | 0.004 | 1.529 | 1.56 |
tubα1b | 0.034 | 2.139 | 2.62 |
tbp | 0.001 | 1.514 | 1.61 |
polr2d | 0.002 | 1.539 | 1.56 |
β2m | 0.005 | 1.666 | 1.93 |
hmbsb | 0.009 | 1.761 | 1.74 |
18S rRNA | 0.080 | 2.948 | 0.74 |
Gene Symbol | Gene Name | Accession | Function | Primer Sequence (5′–3′) |
---|---|---|---|---|
18S rRNA [63,64] | 18S ribosomal RNA | Generic | 18S ribosomal RNA | F: cacttgtccctctaagaagttgca R: ggttgattccgataacgaacga |
eef1a1l1 [29,30,31] | eukaryotic translation elongation factor 1 alpha 1, like 1 | NM_131263.1 | Factor for protein translation | F: CTGGAGGCCAGCTCAAACAT R: ATCAAGAAGAGTAGTACCGCTAGCATTAC |
rpl13α [58,61] | ribosomal protein L13a | NM_212784 | Genetic Information Processing | F: TCTGGAGGACTGTAAGAGGTATGC R: AGACGCACAATCTTGAGAGCAG |
actβ2 [18] | actin, beta 2 | NM_181601.4 | Cytoskeletal structural protein | F: TCTGGTGATGGTGTGACCCA R: GGTGAAGCTGTAGCCACGCT |
Gapdh [19,27] | glyceraldehyde-3-phosphate dehydrogenase | NM_001115114.1 | Catalytic enzyme in glycolytic pathway | F: GATACACGGAGCACCAGGTT R: CAGGTCACATACACGGTTGC |
polr2d [27] | polymerase (RNA) II (DNA directed) polypeptide D | NM_001002317.2 | Enzyme for transcription | F: CCAGATTCAGCCGCTTCAAG R: CAAACTGGGAATGAGGGCTT |
tubα1b [65] | tubulin, alpha 1b | NM_194388 | Cytoskeletal structural protein | F: TGGAGCCCACTGTCATTGATG R: CAGACAGTTTGCGAACCCTATCT |
Sdha [22] | succinate dehydrogenase complex, subunit A, flavoprotein (Fp) | NM_200910 | Enzyme in tricarboxylic acid cycle | F: GAGTCTCCAATCAGTATCCAGTAGTAGA R: CACTGTGTGCGAGCGTGTTG |
Tbp [66] | TATA box binding protein | NM_200096.1 | Transcription factor | F: CTTACCCACCAGCAGTTTAGCAG R: CCTTGGCACCTGTGAGTACGACTTTG |
hmbsb [22] | hydroxymethylbilane synthase, b | NM_001024388.1 | Enzyme in heme synthesis | F: AAGAGCGTAATAGGCACCAGTTC R: GTTCTCCCAGCCCATTCTCTTC |
β2m [67] | beta-2-microglobulin | NM_131163 | Beta chain of a major histocompatibility complex I molecular | F: AGGATTGTCTGCTTGGCTCTCT R: GGAGTGGAGACTTTCCCCTGTAC |
Gene Symbol | Gene Name | Accession | Primer Sequence (5′–3′) |
---|---|---|---|
fabp10a | fatty acid binding protein 10a, liver basic | NM_152960.1 | F: CCAGTGACAGAAATCCAGCA R: GTTCTGCAGACCAGCTTTCC |
gclc | glutamate-cysteine ligase, catalytic subunit | NM_199277.2 | F: AAAATGTCCGGAACTGATCG R: AACGTTTCCATTTTCGTTGC |
gsr | glutathione reductase | NM_001020554.1 | F: CAACCTTGAAAAGGGCAAAA R: AAACTGGATCCTGGCACATC |
nqo1 | NAD(P)H dehydrogenase, quinone 1 | BC065622.1 | F: CTCAAGGATTTGCCTTCAGC R: CGCAGCACTCCATTCTGTAA |
gfap | glial fibrillary acidic protein | NM_131373.2 | F: CCTGACCTGTGACCTGGAAT R: TCCAGCAGCTTCCTGTAGGT |
erg | potassium voltage-gated channel, subfamily H (eag-related), member 6a | NM_212837.1 | F: CAGATGCTCCGTGTGAAAGA R: TGCGGTTCAGATGAAGACAG |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, L.; Zhu, H.; Yan, Y.; Lv, P.; Wu, W. Toxicity Evaluation and Biomarker Selection with Validated Reference Gene in Embryonic Zebrafish Exposed to Mitoxantrone. Int. J. Mol. Sci. 2018, 19, 3516. https://doi.org/10.3390/ijms19113516
Liu L, Zhu H, Yan Y, Lv P, Wu W. Toxicity Evaluation and Biomarker Selection with Validated Reference Gene in Embryonic Zebrafish Exposed to Mitoxantrone. International Journal of Molecular Sciences. 2018; 19(11):3516. https://doi.org/10.3390/ijms19113516
Chicago/Turabian StyleLiu, Lili, Hua Zhu, Yanchun Yan, Peng Lv, and Wei Wu. 2018. "Toxicity Evaluation and Biomarker Selection with Validated Reference Gene in Embryonic Zebrafish Exposed to Mitoxantrone" International Journal of Molecular Sciences 19, no. 11: 3516. https://doi.org/10.3390/ijms19113516
APA StyleLiu, L., Zhu, H., Yan, Y., Lv, P., & Wu, W. (2018). Toxicity Evaluation and Biomarker Selection with Validated Reference Gene in Embryonic Zebrafish Exposed to Mitoxantrone. International Journal of Molecular Sciences, 19(11), 3516. https://doi.org/10.3390/ijms19113516