Effect of Cross-Linking Density on the Structures and Properties of Carbodiimide-Treated Gelatin Matrices as Limbal Stem Cell Niches
Abstract
:1. Introduction
2. Results and Discussion
2.1. Cross-Linking of Gelatin Matrices
2.2. Structural Characterizations of Cross-Linked Gelatin Matrices
2.3. Biocompatibility Assessments of Cross-Linked Gelatin Matrices
2.4. Cell Culture Studies on Cross-Linked Gelatin Matrices
2.4.1. Biophysical Cues
2.4.2. Cell Adhesion
2.4.3. Cell Proliferation
2.4.4. Cell Stemness
3. Materials and Methods
3.1. Materials
3.2. Cross-Linking of Gelatin Matrices
3.3. Structural Characterizations of Cross-Linked Gelatin Matrices
3.4. Biocompatibility Assessments of Cross-Linked Gelatin Matrices
3.5. Cell Culture Studies on Cross-Linked Gelatin Matrices
3.6. Statistical Analyses
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Ma, D.H.-K.; Chen, H.-C.; Lai, J.-Y.; Sun, C.-C.; Wang, S.-F.; Lin, K.-K.; Chen, J.-K. Matrix revolution: Molecular mechanism for inflammatory corneal neovascularization and restoration of corneal avascularity by epithelial stem cell transplantation. Ocul. Surf. 2009, 7, 128–144. [Google Scholar] [PubMed]
- Davanger, M.; Evensen, A. Role of the pericorneal papillary structure in renewal of corneal epithelium. Nature 1971, 229, 560–561. [Google Scholar] [CrossRef] [PubMed]
- Cotsarelis, G.; Cheng, S.Z.; Dong, G.; Sun, T.T.; Lavker, R.M. Existence of slow-cycling limbal epithelial basal cells that can be preferentially stimulated to proliferate: Implications on epithelial stem cells. Cell 1989, 57, 201–209. [Google Scholar] [CrossRef]
- Pellegrini, G.; Golisano, O.; Paterna, P.; Lambiase, A.; Bonini, S.; Rama, P.; De Luca, M. Location and clonal analysis of stem cells and their differentiated progeny in the human ocular surface. J. Cell Biol. 1999, 145, 769–782. [Google Scholar] [CrossRef]
- Schlötzer-Schrehardt, U.; Kruse, F.E. Identification and characterization of limbal stem cells. Exp. Eye Res. 2005, 81, 247–264. [Google Scholar] [CrossRef] [PubMed]
- Tseng, S.C.G. Concept and application of limbal stem cells. Eye 1989, 3, 141–157. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pellegrini, G.; Traverso, C.E.; Franzi, A.T.; Zingirian, M.; Cancedda, R.; De Luca, M. Long-term restoration of damaged corneal surfaces with autologous cultivated corneal epithelium. Lancet 1997, 349, 990–993. [Google Scholar] [CrossRef]
- Tsubota, K.; Satake, Y.; Kaido, M.; Shinozaki, N.; Shimmura, S.; Bissen-Miyajima, H.; Shimazaki, J. Treatment of severe ocular-surface disorders with corneal epithelial stem-cell transplantation. N. Engl. J. Med. 1999, 340, 1697–1703. [Google Scholar] [CrossRef] [PubMed]
- Dua, H.S.; Gomes, J.A.P.; King, A.J.; Maharajan, V.S. The amniotic membrane in ophthalmology. Surv. Ophthalmol. 2004, 49, 51–77. [Google Scholar] [CrossRef] [PubMed]
- Riau, A.K.; Beuerman, R.W.; Lim, L.S.; Mehta, J.S. Preservation, sterilization and de-epithelialization of human amniotic membrane for use in ocular surface reconstruction. Biomaterials 2010, 31, 216–225. [Google Scholar] [CrossRef] [PubMed]
- Tsai, R.J.-F.; Li, L.-M.; Chen, J.-K. Reconstruction of damaged corneas by transplantation of autologous limbal epithelial cells. N. Engl. J. Med. 2000, 343, 86–93. [Google Scholar] [CrossRef] [PubMed]
- Schwab, I.R.; Reyes, M.; Isseroff, R.R. Successful transplantation of bioengineered tissue replacements in patients with ocular surface disease. Cornea 2000, 19, 421–426. [Google Scholar] [CrossRef] [PubMed]
- Koizumi, N.; Inatomi, T.; Suzuki, T.; Sotozono, C.; Kinoshita, S. Cultivated corneal epithelial stem cell transplantation in ocular surface disorders. Ophthalmology 2001, 108, 1569–1574. [Google Scholar] [CrossRef]
- Schwab, I.R.; Johnson, N.T.; Harkin, D.G. Inherent risks associated with manufacture of bioengineered ocular surface tissue. Arch. Ophthalmol. 2006, 124, 1734–1740. [Google Scholar] [CrossRef] [PubMed]
- Dravida, S.; Gaddipati, S.; Griffith, M.; Merrett, K.; Lakshmi Madhira, S.; Sangwan, V.S.; Vemuganti, G.K. A biomimetic scaffold for culturing limbal stem cells: A promising alternative for clinical transplantation. J. Tissue Eng. Regen. Med. 2008, 2, 263–271. [Google Scholar] [CrossRef] [PubMed]
- Chirila, T.V.; Barnard, Z.; Zainuddin, D.G.; Harkin, Z.; Schwab, I.R.; Hirst, L.W. Bombyx mori silk fibroin membranes as potential substrata for epithelial constructs used in the management of ocular surface disorders. Tissue Eng. Part A 2008, 14, 1203–1211. [Google Scholar] [CrossRef] [PubMed]
- Rama, P.; Matuska, S.; Paganoni, G.; Spinelli, A.; De Luca, M.; Pellegrini, G. Limbal stem-cell therapy and long-term corneal regeneration. N. Engl. J. Med. 2010, 363, 147–155. [Google Scholar] [CrossRef] [PubMed]
- Reichl, S.; Borrelli, M.; Geerling, G. Keratin films for ocular surface reconstruction. Biomaterials 2011, 32, 3375–3386. [Google Scholar] [CrossRef] [PubMed]
- Lai, J.-Y. Hyaluronic acid concentration-mediated changes in structure and function of porous carriers for corneal endothelial cell sheet delivery. Mater. Sci. Eng. C 2016, 59, 411–419. [Google Scholar] [CrossRef] [PubMed]
- Chou, S.-F.; Lee, C.-H.; Lai, J.-Y. Bioengineered keratocyte spheroids fabricated on chitosan coatings enhance tissue repair in a rabbit corneal stromal defect model. J. Tissue Eng. Regen. Med. 2018, 12, 316–320. [Google Scholar] [CrossRef] [PubMed]
- Luo, L.-J.; Lai, J.-Y. The role of alkyl chain length of monothiol-terminated alkyl carboxylic acid in the synthesis, characterization, and application of gelatin-g-poly(N-isopropylacrylamide) carriers for antiglaucoma drug delivery. Acta Biomater. 2017, 49, 344–357. [Google Scholar] [CrossRef] [PubMed]
- Luo, L.-J.; Huang, C.-C.; Chen, H.-C.; Lai, J.-Y.; Matsusaki, M. Effect of deacetylation degree on controlled pilocarpine release from injectable chitosan-g-poly(N-isopropylacrylamide) carriers. Carbohydr. Polym. 2018, 197, 375–384. [Google Scholar] [CrossRef] [PubMed]
- Djagny, K.B.; Wang, Z.; Xu, S. Gelatin: A valuable protein for food and pharmaceutical industries: Review. Crit. Rev. Food Sci. Nutr. 2001, 41, 481–492. [Google Scholar] [CrossRef] [PubMed]
- Young, S.; Wong, M.; Tabata, Y.; Mikos, A.G. Gelatin as a delivery vehicle for the controlled release of bioactive molecules. J. Control. Release 2005, 109, 256–274. [Google Scholar] [CrossRef] [PubMed]
- Lai, J.-Y.; Chen, K.-H.; Hsiue, G.-H. Tissue-engineered human corneal endothelial cell sheet transplantation in a rabbit model using functional biomaterials. Transplantation 2007, 84, 1222–1232. [Google Scholar] [CrossRef] [PubMed]
- Lai, J.-Y.; Lin, P.-K.; Hsiue, G.-H.; Cheng, H.-Y.; Huang, S.-J.; Li, Y.-T. Low Bloom strength gelatin as a carrier for potential use in retinal sheet encapsulation and transplantation. Biomacromolecules 2009, 10, 310–319. [Google Scholar] [CrossRef] [PubMed]
- Lai, J.-Y.; Li, Y.-T.; Cho, C.-H.; Yu, T.-C. Nanoscale modification of porous gelatin scaffolds with chondroitin sulfate for corneal stromal tissue engineering. Int. J. Nanomed. 2012, 7, 1101–1114. [Google Scholar] [CrossRef] [PubMed]
- McMurray, R.J.; Gadegaard, N.; Tsimbouri, P.M.; Burgess, K.V.; McNamara, L.E.; Tare, R.; Murawski, K.; Kingham, E.; Oreffo, R.O.C.; Dalby, M.J. Nanoscale surfaces for the long-term maintenance of mesenchymal stem cell phenotype and multipotency. Nat. Mater. 2011, 10, 637–644. [Google Scholar] [CrossRef] [PubMed]
- Raof, N.A.; Schiele, N.R.; Xie, Y.; Chrisey, D.B.; Corr, D.T. The maintenance of pluripotency following laser direct-write of mouse embryonic stem cells. Biomaterials 2011, 32, 1802–1808. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ovsianikov, A.; Deiwick, A.; Van Vlierberghe, S.; Dubruel, P.; Möller, L.; Dräger, G.; Chichkov, B. Laser fabrication of three-dimensional CAD scaffolds from photosensitive gelatin for applications in tissue engineering. Biomacromolecules 2011, 12, 851–858. [Google Scholar] [CrossRef] [PubMed]
- Bratt-Leal, A.M.; Carpenedo, R.L.; Ungrin, M.D.; Zandstra, P.W.; McDevitt, T.C. Incorporation of biomaterials in multicellular aggregates modulates pluripotent stem cell differentiation. Biomaterials 2011, 32, 48–56. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lutolf, M.P.; Blau, H.M. Artificial stem cell niches. Adv. Mater. 2009, 21, 3255–3268. [Google Scholar] [CrossRef] [PubMed]
- Lutolf, M.P.; Gilbert, P.M.; Blau, H.M. Designing materials to direct stem-cell fate. Nature 2009, 462, 433–441. [Google Scholar] [CrossRef] [PubMed]
- Mirzadeh, H.; Shokrolahi, F.; Daliri, M. Effect of silicon rubber crosslink density on fibroblast cell behavior in vitro. J. Biomed. Mater. Res. A 2003, 67, 727–732. [Google Scholar] [CrossRef] [PubMed]
- Lai, J.-Y.; Li, Y.-T. Evaluation of cross-linked gelatin membranes as delivery carriers for retinal sheets. Mater. Sci. Eng. C 2010, 30, 677–685. [Google Scholar] [CrossRef]
- Chou, S.-F.; Luo, L.-J.; Lai, J.-Y.; Ma, D.H.-K. Role of solvent-mediated carbodiimide cross-linking in fabrication of electrospun gelatin nanofibrous membranes as ophthalmic biomaterials. Mater. Sci. Eng. C 2017, 71, 1145–1155. [Google Scholar] [CrossRef] [PubMed]
- Benicewicz, B.C.; Hopper, P.K. Polymers for absorbable surgical sutures-Part I. J. Bioact. Compat. Polym. 1990, 5, 453–472. [Google Scholar] [CrossRef]
- Kevadiya, B.D.; Rajkumar, S.; Bajaj, H.C.; Chettiar, S.S.; Gosai, K.; Brahmbhatt, H.; Bhatt, A.S.; Barvaliya, Y.K.; Dave, G.S.; Kothari, R.K. Biodegradable gelatin-ciprofloxacin-montmorillonite composite hydrogels for controlled drug release and wound dressing application. Colloid Surf. B-Biointerfaces 2014, 122, 175–183. [Google Scholar] [CrossRef] [PubMed]
- Duan, X.; Sheardown, H. Crosslinking of collagen with dendrimers. J. Biomed. Mater. Res. A 2005, 75, 510–518. [Google Scholar] [CrossRef] [PubMed]
- Brammer, K.S.; Choi, C.; Frandsen, C.J.; Oh, S.; Johnston, G.; Jin, S. Comparative cell behavior on carbon-coated TiO2 nanotube surfaces for osteoblasts vs. osteo-progenitor cells. Acta Biomater. 2011, 7, 2697–2703. [Google Scholar] [CrossRef] [PubMed]
- Ki, C.S.; Baek, D.H.; Gang, K.D.; Lee, K.H.; Um, I.C.; Park, Y.H. Characterization of gelatin nanofiber prepared from gelatin-formic acid solution. Polymer 2005, 46, 5094–5102. [Google Scholar] [CrossRef]
- Manna, P.J.; Mitra, T.; Pramanik, N.; Kavitha, V.; Gnanamani, A.; Kundu, P.P. Potential use of curcumin loaded carboxymethylated guar gum grafted gelatin film for biomedical applications. Int. J. Biol. Macromol. 2015, 75, 437–446. [Google Scholar] [CrossRef] [PubMed]
- Luo, J.; Li, L.; Luo, J.; Li, X.; Li, K.; Gao, Q. A high solid content bioadhesive derived from soybean meal and egg white: Preparation and properties. J. Polym. Environ. 2017, 25, 948–959. [Google Scholar] [CrossRef]
- Olde Damink, L.H.H.; Dijkstra, P.J.; van Luyn, M.J.A.; van Wachem, P.B.; Nieuwenhuis, P.; Feijen, J. Cross-linking of dermal sheep collagen using a water-soluble carbodiimide. Biomaterials 1996, 17, 765–773. [Google Scholar] [CrossRef] [Green Version]
- Lai, J.-Y.; Hsieh, A.-C. A gelatin-g-poly(N-isopropylacrylamide) biodegradable in situ gelling delivery system for the intracameral administration of pilocarpine. Biomaterials 2012, 33, 2372–2387. [Google Scholar] [CrossRef] [PubMed]
- Kuo, J.-W.; Swann, D.A.; Prestwich, G.D. Chemical modification of hyaluronic acid by carbodiimides. Bioconjugate Chem. 1991, 2, 232–241. [Google Scholar] [CrossRef]
- Dong, Z.; Ran, J.; Zhou, H.; Chen, J.; Lei, T.; Wang, W.; Sun, Y.; Lin, G.; Bankir, L.; Yang, B. Urea transporter UT-B deletion induces DNA damage and apoptosis in mouse bladder urothelium. PLoS ONE 2013, 8, e76952. [Google Scholar] [CrossRef] [PubMed]
- Gilles, M.A.; Hudson, A.Q.; Borders, C.L., Jr. Stability of water-soluble carbodiimides in aqueous solution. Anal. Biochem. 1990, 184, 244–248. [Google Scholar] [CrossRef]
- Joyce, N.C. Proliferative capacity of the corneal endothelium. Prog. Retin. Eye Res. 2003, 22, 359–389. [Google Scholar] [CrossRef]
- Tomihata, K.; Ikada, Y. Cross-linking of gelatin with carbodiimides. Tissue Eng. 1996, 2, 307–313. [Google Scholar] [CrossRef] [PubMed]
- Kuijpers, A.J.; Engbers, G.H.M.; Krijgsveld, J.; Zaat, S.A.J.; Dankert, J.; Feijen, J. Cross-linking and characterisation of gelatin matrices for biomedical applications. J. Biomater. Sci. Polym. Ed. 2000, 11, 225–243. [Google Scholar] [CrossRef] [PubMed]
- Zhang, S.; Huang, Y.; Yang, X.; Mei, F.; Ma, Q.; Chen, G.; Ryu, S.; Deng, X. Gelatin nanofibrous membrane fabricated by electrospinning of aqueous gelatin solution for guided tissue regeneration. J. Biomed. Mater. Res. A 2009, 90, 671–679. [Google Scholar] [CrossRef] [PubMed]
- Lai, J.-Y.; Tu, I.-H. Adhesion, phenotypic expression, and biosynthetic capacity of corneal keratocytes on surfaces coated with hyaluronic acid of different molecular weights. Acta Biomater. 2012, 8, 1068–1079. [Google Scholar] [CrossRef] [PubMed]
- Lai, J.-Y.; Li, Y.-T. Functional assessment of cross-linked porous gelatin hydrogels for bioengineered cell sheet carriers. Biomacromolecules 2010, 11, 1387–1397. [Google Scholar] [CrossRef] [PubMed]
- Engler, A.J.; Sen, S.; Sweeney, H.L.; Discher, D.E. Matrix elasticity directs stem cell lineage specification. Cell 2006, 126, 677–689. [Google Scholar] [CrossRef] [PubMed]
- Gupta, D.; Venugopal, J.; Mitra, S.; Giri Dev, V.R.; Ramakrishna, S. Nanostructured biocomposite substrates by electrospinning and electrospraying for the mineralization of osteoblasts. Biomaterials 2009, 30, 2085–2094. [Google Scholar] [CrossRef] [PubMed]
- Fusco, S.; Panzetta, V.; Embrione, V.; Netti, P.A. Crosstalk between focal adhesions and material mechanical properties governs cell mechanics and functions. Acta Biomater. 2015, 23, 63–71. [Google Scholar] [CrossRef] [PubMed]
- Koegler, W.S.; Griffith, L.G. Osteoblast response to PLGA tissue engineering scaffolds with PEO modified surface chemistries and demonstration of patterned cell response. Biomaterials 2004, 25, 2819–2830. [Google Scholar] [CrossRef] [PubMed]
- Uygun, B.E.; Bou-Akl, T.; Albanna, M.; Matthew, H.W. Membrane thickness is an important variable in membrane scaffolds: Influence of chitosan membrane structure on the behavior of cells. Acta Biomater. 2010, 6, 2126–2131. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yu, B.-Y.; Chen, P.-Y.; Sun, Y.-M.; Lee, Y.-T.; Young, T.-H. Effects of the surface characteristics of polyhydroxyalkanoates on the metabolic activities and morphology of human mesenchymal stem cells. J. Biomater. Sci. Polym. Ed. 2010, 21, 17–36. [Google Scholar] [CrossRef] [PubMed]
- Gentile, F.; Tirinato, L.; Battista, E.; Causa, F.; Liberale, C.; di Fabrizio, E.M.; Decuzzi, P. Cells preferentially grow on rough substrates. Biomaterials 2010, 31, 7205–7212. [Google Scholar] [CrossRef] [PubMed]
- Peyton, S.R.; Raub, C.B.; Keschrumrus, V.P.; Putnam, A.J. The use of poly(ethylene glycol) hydrogels to investigate the impact of ECM chemistry and mechanics on smooth muscle cells. Biomaterials 2006, 27, 4881–4893. [Google Scholar] [CrossRef] [PubMed]
- Rowlands, A.S.; George, P.A.; Cooper-White, J.J. Directing osteogenic and myogenic differentiation of MSCs: Interplay of stiffness and adhesive ligand presentation. Am. J. Physiol. Cell Physiol. 2008, 295, C1037–C1044. [Google Scholar] [CrossRef] [PubMed]
- Kiger, A.A.; Jones, D.L.; Schulz, C.; Rogers, M.B.; Fuller, M.T. Stem cell self-renewal specified by JAK-STAT activation in response to a support cell cue. Science 2001, 294, 2542–2545. [Google Scholar] [CrossRef] [PubMed]
- Grueterich, M.; Espana, E.M.; Tseng, S.C.G. Ex vivo expansion of limbal epithelial stem cells: Amniotic membrane serving as a stem cell niche. Surv. Ophthalmol. 2003, 48, 631–646. [Google Scholar] [CrossRef] [PubMed]
- Ma, D.H.-K.; Lai, J.-Y.; Cheng, H.-Y.; Tsai, C.-C.; Yeh, L.-K. Carbodiimide cross-linked amniotic membranes for cultivation of limbal epithelial cells. Biomaterials 2010, 31, 6647–6658. [Google Scholar] [CrossRef] [PubMed]
- ter Brugge, P.J.; Jansen, J.A. Initial interaction of rat bone marrow cells with non-coated and calcium phosphate coated titanium substrates. Biomaterials 2002, 23, 3269–3277. [Google Scholar] [CrossRef]
- Marletta, G.; Ciapetti, G.; Satriano, C.; Perut, F.; Salerno, M.; Baldini, N. Improved osteogenic differentiation of human marrow stromal cells cultured on ion-induced chemically structured poly-ε-caprolactone. Biomaterials 2007, 28, 1132–1140. [Google Scholar] [CrossRef] [PubMed]
- Lai, J.-Y.; Wang, P.-R.; Luo, L.-J.; Chen, S.-T. Stabilization of collagen nanofibers with l-lysine improves the ability of carbodiimide cross-linked amniotic membranes to preserve limbal epithelial progenitor cells. Int. J. Nanomed. 2014, 9, 5117–5130. [Google Scholar] [CrossRef] [PubMed]
- Charulatha, V.; Rajaram, A. Crosslinking density and resorption of dimethyl suberimidate-treated collagen. J. Biomed. Mater. Res. 1997, 36, 478–486. [Google Scholar] [CrossRef]
- Li, F.; Griffith, M.; Li, Z.; Tanodekaew, S.; Sheardown, H.; Hakim, M.; Carlsson, D.J. Recruitment of multiple cell lines by collagen-synthetic copolymer matrices in corneal regeneration. Biomaterials 2005, 26, 3093–3104. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.S.; Du, C.; Chung, J.E.; Kurisawa, M. Enzymatically cross-linked gelatin-phenol hydrogels with a broader stiffness range for osteogenic differentiation of human mesenchymal stem cells. Acta Biomater. 2012, 8, 1826–1837. [Google Scholar] [CrossRef] [PubMed]
- Baiguera, S.; Del Gaudio, C.; Lucatelli, E.; Kuevda, E.; Boieri, M.; Mazzanti, B.; Bianco, A.; Macchiarini, P. Electrospun gelatin scaffolds incorporating rat decellularized brain extracellular matrix for neural tissue engineering. Biomaterials 2014, 35, 1205–1214. [Google Scholar] [CrossRef] [PubMed]
- Park, Y.S.; Lee, Y.; Jin, Y.M.; Kim, G.; Jung, S.C.; Park, Y.J.; Park, K.D.; Jo, I. Sustained release of parathyroid hormone via in situ cross-linking gelatin hydrogels improves the therapeutic potential of tonsil-derived mesenchymal stem cells for hypoparathyroidism. J. Tissue Eng. Regen. Med. 2018, 12, e1747–e1756. [Google Scholar] [CrossRef] [PubMed]
Parameter | Ocular Score | ||||
---|---|---|---|---|---|
0 | 1 | 2 | 3 | 4 | |
Aqueous flare | Normal | Mild | Moderate | Severe | N/A 1 |
Anterior chamber fibrin | None | Mild | Moderate | Severe | N/A 1 |
Corneal cloudiness severity | Normal | Mild | Moderate | Severe | N/A 1 |
Corneal neovascularization | None | Mild | <180° | 180°–360° | N/A 1 |
Iris neovascularization | None | Mild | <180° | 180°–360° | N/A 1 |
Lens opacity | None | Mild | Moderate | Severe | N/A 1 |
Genes 1 | Forward (5′-3′) | Reverse (5′-3′) |
---|---|---|
Integrin β1 | AGGAGAAAATGAATGCCAAATGG | GGGTGCTCATTTTCCCTCATACTT |
ABCG2 | GAGAGCTGGGTCTGGAAAAAGT | ATTCTTTTCAGGAGCAGAAGGA |
GAPDH | TTGCCCTCAATGACCACTTTG | TTACTCCTTGGAGGCCATGTG |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lai, J.-Y.; Luo, L.-J.; Ma, D.H.-K. Effect of Cross-Linking Density on the Structures and Properties of Carbodiimide-Treated Gelatin Matrices as Limbal Stem Cell Niches. Int. J. Mol. Sci. 2018, 19, 3294. https://doi.org/10.3390/ijms19113294
Lai J-Y, Luo L-J, Ma DH-K. Effect of Cross-Linking Density on the Structures and Properties of Carbodiimide-Treated Gelatin Matrices as Limbal Stem Cell Niches. International Journal of Molecular Sciences. 2018; 19(11):3294. https://doi.org/10.3390/ijms19113294
Chicago/Turabian StyleLai, Jui-Yang, Li-Jyuan Luo, and David Hui-Kang Ma. 2018. "Effect of Cross-Linking Density on the Structures and Properties of Carbodiimide-Treated Gelatin Matrices as Limbal Stem Cell Niches" International Journal of Molecular Sciences 19, no. 11: 3294. https://doi.org/10.3390/ijms19113294