Regulatory Plasticity of Earthworm wMT-2 Gene Expression
Abstract
:1. Introduction
2. Results
2.1. wMT-2 Gene Expression
2.2. DNase I Footprinting
2.3. Transcription Factor Prediction
2.4. Western Blot
2.5. wMT-2 Promotor Methylation
3. Discussion
4. Materials and Methods
4.1. Origin and Maintenance of Study Organisms
4.2. Experimental Design
4.3. Quantitative Real Time PCR
4.4. DNase I Footprinting
4.5. Transcription Factor Analysis
4.6. Western Blot
4.7. Bisulfite Conversion
4.8. Statistical Analyses
5. Conclusions
Acknowledgments
Author Contributions
Conflicts of Interest
Abbreviations
ATF | Activating transcription factor |
Ca | Calcium |
Cd | Cadmium |
CREB | cAMP responsive element |
MT | Metallothionein |
MTF-1 | Metal transcription factor 1 |
pATF | Phosphorylated ATF |
pCREB | Phosphorylated CREB |
ROI | Region of interest |
TF | Transcription factor |
wMT-2 | Earthworm metallothionein 2 |
Zn | Zinc |
Appendix A
Treatment | Quantitative Real Time PCR | WB | FP | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
0 h | 4 h | 8 h | 12 h | 16 h | 20 h | 3 d | 7 d | 14 d | ||||
L.t | L.t | L.r | L.t | L.r | ||||||||
C | 15 | 8 | 8 | 8 | 8 | 8 | 5 | 5 | 4 | 5 | 5 5 (Cd10) | 5 |
C_cut | 7 | 8 | 8 | 4 | 4 | |||||||
Cd | 8 | 8 | 8 | 8 | 8 | 6 | 7 | 7 5 (Cd10) | 5 | 5 5 (Cd10) | 5 | |
Cd_cut | 8 | 8 | 8 | 4 | 4 |
Representative, Bisulfite Converted Sequence: TTTTTTAAGAGTGTTTATTTTTGTATATGGTGAGTTATAGTTTGTTTTTATATATG AAGTTGTGTAAAAATGTGTGTAGATTAATTGGATTGTTTTGTTTGGAGGTGTAAT TAGGATAATTAATAGAAATGAATTGTGATGGGAATTATTTGATTAATAGAAA Location from TSS: −123–−285 | |
Individuals | No. of Sequenced Clones |
L. terrestris C_1 | 3 |
L. terrestris C_2 | 5 |
L. terrestris C_3 | 2 |
L. terrestris C_4 | 1 |
L. terrestris Cd_5 | 1 |
L. terrestris Cd_6 | 2 |
L. terrestris Cd_7 | 3 |
L. terrestris Cd_8 | 3 |
L. terrestris Cd_cut_9 | 3 |
L. terrestris Cd_cut_10 | 1 |
L. terrestris Cd_cut_11 | 1 |
L. terrestris Cd_cut_12 | 3 |
References
- Kimura, T.; Kambe, T. The functions of metallothionein and ZIP and ZnT transporters: An overview and perspective. Int. J. Mol. Sci. 2016, 17, 336. [Google Scholar] [CrossRef] [PubMed]
- Takahashi, S. Positive and negative regulators of the metallothionein gene (review). Mol. Med. Rep. 2015, 12, 795–799. [Google Scholar] [CrossRef] [PubMed]
- Isani, G.; Carpenè, E. Metallothioneins, unconventional proteins from unconventional animals: A long journey from nematodes to mammals. Biomolecules 2014, 4, 435–457. [Google Scholar] [CrossRef] [PubMed]
- Shi, Z.; Tang, Z.; Wang, C. A brief review and evaluation of earthworm biomarkers in soil pollution assessment. Environ. Sci. Pollut. Res. 2017, 24, 13284–13294. [Google Scholar] [CrossRef] [PubMed]
- Rochfort, S.J.; Ezernieks, V.; Yen, A.L. NMR-based metabolomics using earthworms as potential indicators for soil health. Metabolomics 2009, 5, 95–107. [Google Scholar] [CrossRef]
- Kille, P.; Andre, J.; Anderson, C.; Ang, H.N.; Bruford, M.W.; Bundy, J.G.; Donnelly, R.; Hodson, M.E.; Juma, G.; Lahive, E.; et al. DNA sequence variation and methylation in an arsenic tolerant earthworm population. Soil Biol. Biochem. 2013, 57, 524–532. [Google Scholar] [CrossRef]
- Calisi, A.; Lionetto, M.G.; De Lorenzis, E.; Leomanni, A.; Schettino, T. Metallothionein induction in the coelomic fluid of the earthworm Lumbricus terrestris following heavy metal exposure: A short report. BioMed Res. Int. 2014, 2014. [Google Scholar] [CrossRef] [PubMed]
- Šrut, M.; Drechsel, V.; Höckner, M. Low levels of Cd induce persisting epigenetic modifications and acclimation mechanisms in the earthworm Lumbricus terrestris. PLoS ONE 2017, 12, e0176047. [Google Scholar] [CrossRef] [PubMed]
- Günther, V.; Lindert, U.; Schaffner, W. The taste of heavy metals: Gene regulation by MTF-1. Biochim. Biophys. Acta 2012, 1823, 1416–1425. [Google Scholar] [CrossRef] [PubMed]
- Höckner, M.; Stefanon, K.; Schuler, D.; Fantur, R.; de Vaufleury, A.; Dallinger, R. Coping with cadmium exposure in various ways: The two helicid snails Helix pomatia and Cantareus aspersus share the metal transcription factor-2, but differ in promoter organization and transcription of their Cd-metallothionein genes. J. Exp. Zool. A Ecol. Genet. Physiol. 2009, 311, 776–787. [Google Scholar] [CrossRef] [PubMed]
- Stürzenbaum, S.R.; Georgiev, O.; Morgan, A.J.; Kille, P. Cadmium detoxification in earthworms: From genes to cells. Environ. Sci. Technol. 2004, 38, 6283–6289. [Google Scholar] [CrossRef] [PubMed]
- Höckner, M.; Dallinger, R.; Stürzenbaum, S.R. Metallothionein gene activation in the earthworm (Lumbricus rubellus). Biochem. Biophys. Res. Commun. 2015, 460, 537–542. [Google Scholar] [CrossRef] [PubMed]
- Persengiev, S.P.; Green, M.R. The role of ATF/CREB family members in cell growth, survival, and apoptosis. Apoptosis 2003, 8, 225–228. [Google Scholar] [CrossRef] [PubMed]
- Takiguchi, M.; Achanzar, W.E.; Qu, W.; Li, G.; Waalkes, M.P. Effects of cadmium on DNA-(Cytosine-5) methyltransferase activity and DNA methylation status during cadmium-induced cellular transformation. Exp. Cell Res. 2003, 286, 355–365. [Google Scholar] [CrossRef]
- Baccarelli, A.; Bollati, V. Epigenetics and environmental chemicals. Curr. Opin. Pediatr. 2009, 21, 243–251. [Google Scholar] [CrossRef] [PubMed]
- Vandegehuchte, M.B.; Janssen, C.R. Epigenetics in an ecotoxicological context. Mutat. Res. Toxicol. Environ. Mutagen. 2014, 764–765, 36–45. [Google Scholar] [CrossRef] [PubMed]
- Cikutovic, M.A.; Fitzpatrick, L.C.; Goven, A.J.; Venables, B.J.; Giggleman, M.A.; Cooper, E.L. Wound healing in earthworms Lumbricus terrestris: A cellular-based biomarker for assessing sublethal chemical toxicity. Bull. Environ. Contam. Toxicol. 1999, 62, 508–514. [Google Scholar] [CrossRef] [PubMed]
- Polykretis, P.; Delfino, G.; Petrocelli, I.; Cervo, R.; Tanteri, G.; Montori, G.; Perito, B.; Branca, J.J.V.; Morucci, G.; Gulisano, M. Evidence of immunocompetence reduction induced by cadmium exposure in honey bees (Apis mellifera). Environ. Pollut. 2016, 218, 826–834. [Google Scholar] [CrossRef] [PubMed]
- Massadeh, A.M.; Al-Safi, S. Analysis of cadmium and lead: Their immunosuppressive effects and distribution in various organs of mice. Biol. Trace Elem. Res. 2005, 108, 279–286. [Google Scholar] [CrossRef]
- Sauvé, S.; Hendawi, M.; Brousseau, P.; Fournier, M. Phagocytic response of terrestrial and aquatic invertebrates following in vitro exposure to trace elements. Ecotoxicol. Environ. Saf. 2002, 52, 21–29. [Google Scholar] [CrossRef] [PubMed]
- Hinrichsen, R.D.; Tran, J.R. A circadian clock regulates sensitivity to cadmium in Paramecium tetraurelia. Cell Biol. Toxicol. 2010, 26, 379–389. [Google Scholar] [CrossRef] [PubMed]
- Cahill, A.L.; Nyberg, D.; Ehret, C.F. Tissue distribution of cadmium and metallothionein as a function of time of day and dosage. Environ. Res. 1983, 31, 54–65. [Google Scholar] [CrossRef]
- Xu, Y.-Q.; Zhang, D.; Jin, T.; Cai, D.J.; Wu, Q.; Lu, Y.; Liu, J.; Klaassen, C.D. Diurnal variation of hepatic antioxidant gene expression in mice. PLoS ONE 2012, 7, e44237. [Google Scholar] [CrossRef] [PubMed]
- Miura, N.; Ashimori, A.; Takeuchi, A.; Ohtani, K.; Takada, N.; Yanagiba, Y.; Mita, M.; Togawa, M.; Hasegawa, T. Mechanisms of cadmium-induced chronotoxicity in mice. J. Toxicol. Sci. 2013, 38, 947–957. [Google Scholar] [CrossRef] [PubMed]
- Zhang, D.; Jin, T.; Xu, Y.; Lu, Y.; Wu, Q.; Zhang, Y.K.J.; Liu, J. Diurnal-and sex-related difference of metallothionein expression in mice. J. Circadian Rhythms 2012, 10. [Google Scholar] [CrossRef] [PubMed]
- Pedrini-Martha, V.; Niederwanger, M.; Kopp, R.; Schnegg, R.; Dallinger, R. Physiological, diurnal and stress-related variability of cadmium-metallothionein gene expression in land snails. PLoS ONE 2016, 11. [Google Scholar] [CrossRef] [PubMed]
- Beale, A.D.; Whitmore, D.; Moran, D. Life in a dark biosphere: A review of circadian physiology in “arrhythmic” environments. J. Comp. Physiol. B 2016, 186, 947–968. [Google Scholar] [CrossRef] [PubMed]
- Hayashi, Y.; Heckmann, L.-H.; Simonsen, V.; Scott-Fordsmand, J.J. Time-course profiling of molecular stress responses to silver nanoparticles in the earthworm Eisenia fetida. Ecotoxicol. Environ. Saf. 2013, 98, 219–226. [Google Scholar] [CrossRef] [PubMed]
- Van Der Ploeg, M.J.C.; Handy, R.D.; Heckmann, L.-H.; Van Der Hout, A.; Van Den Brink, N.W. C60 exposure induced tissue damage and gene expression alterations in the earthworm Lumbricus rubellus. Nanotoxicology 2013, 7, 432–440. [Google Scholar] [CrossRef] [PubMed]
- Iwata, M.; Takebayashi, T.; Ohta, H.; Alcalde, R.E.; Itano, Y.; Matsumura, T. Zinc accumulation and metallothionein gene expression in the proliferating epidermis during wound healing in mouse skin. Histochem. Cell Biol. 1999, 112, 283–290. [Google Scholar] [CrossRef] [PubMed]
- Lansdown, A.B.G.; Mirastschijski, U.; Stubbs, N.; Scanlon, E.; Agren, M.S. Zinc in wound healing: Theoretical, experimental, and clinical aspects. Wound Repair Regen. 2007, 15, 2–16. [Google Scholar] [CrossRef] [PubMed]
- Carpenè, E.; Andreani, G.; Monari, M.; Castellani, G.; Isani, G. Distribution of Cd, Zn, Cu and Fe among selected tissues of the earthworm (Allolobophora caliginosa) and Eurasian woodcock (Scolopax rusticola). Sci. Total Environ. 2006, 363, 126–135. [Google Scholar] [CrossRef] [PubMed]
- Homa, J.; Olchawa, E.; Stürzenbaum, S.R.; John Morgan, A.; Plytycz, B. Early-phase immunodetection of metallothionein and heat shock proteins in extruded earthworm coelomocytes after dermal exposure to metal ions. Environ. Pollut. 2005, 135, 275–280. [Google Scholar] [CrossRef] [PubMed]
- Lansdown, A.B.; Sampson, B.; Rowe, A. Experimental observations in the rat on the influence of cadmium on skin wound repair. Int. J. Exp. Pathol. 2001, 82, 35–41. [Google Scholar] [CrossRef] [PubMed]
- Park, S.-Y.; Gomes, C.; Oh, S.-D.; Soh, J. Cadmium up-regulates transcription of the steroidogenic acute regulatory protein (StAR) gene through phosphorylated CREB rather than SF-1 in K28 cells. J. Toxicol. Sci. 2015, 40, 151–161. [Google Scholar] [CrossRef] [PubMed]
- Kondo, M.; Inamura, H.; Matsumura, K.; Matsuoka, M. Cadmium activates extracellular signal-regulated kinase 5 in HK-2 human renal proximal tubular cells. Biochem. Biophys. Res. Commun. 2012, 421, 490–493. [Google Scholar] [CrossRef] [PubMed]
- Xin, L.; Zhang, H.; Zhang, R.; Li, H.; Wang, W.; Wang, L.; Wang, H.; Qiu, L.; Song, L. CgIL17–5, an ancient inflammatory cytokine in Crassostrea gigas exhibiting the heterogeneity functions compared with vertebrate interleukin 17 molecules. Dev. Comp. Immunol. 2015, 53, 339–348. [Google Scholar] [CrossRef] [PubMed]
- Kim, H.S.; Park, H.C.; Kim, K.E.; Jung, M.S.; Han, H.J.; Kim, S.H.; Kwon, Y.S.; Bahk, S.; An, J.; Bae, D.W.; et al. A NAC transcription factor and SNI1 cooperatively suppress basal pathogen resistance in Arabidopsis thaliana. Nucleic Acids Res. 2012, 40, 9182–9192. [Google Scholar] [CrossRef] [PubMed]
- Murakami, R.; Okumura, T.; Uchiyama, H. GATA factors as key regulatory molecules in the development of Drosophila endoderm. Dev. Growth Differ. 2005, 47, 581–589. [Google Scholar] [CrossRef] [PubMed]
- Moilanen, L.H.; Fukushige, T.; Freedman, J.H. Regulation of metallothionein gene transcription. Identification of upstream regulatory elements and transcription factors responsible for cell-specific expression of the metallothionein genes from Caenorhabditis elegans. J. Biol. Chem. 1999, 274, 29655–29665. [Google Scholar] [CrossRef] [PubMed]
- Yang, W.; Dierking, K.; Rosenstiel, P.C.; Schulenburg, H. GATA transcription factor as a likely key regulator of the Caenorhabditis elegans innate immune response against gut pathogens. Zoology 2016, 119, 244–253. [Google Scholar] [CrossRef] [PubMed]
- Lim, J.H.; Won, J.H.; Ahn, K.H.; Back, M.J.; Fu, Z.; Jang, J.M.; Ha, H.C.; Jang, Y.J.; Kim, D.K. Paraquat reduces natural killer cell activity via metallothionein induction. J. Imunotoxicol. 2015, 12, 342–349. [Google Scholar] [CrossRef] [PubMed]
- Daniels, P.J.; Andrews, G.K. Dynamics of the metal-dependent transcription factor complex in vivo at the mouse metallothionein-I promoter. Nucleic Acids Res. 2003, 31, 6710–6721. [Google Scholar] [CrossRef] [PubMed]
- Andrews, G.K.; Lee, D.K.; Ravindra, R.; Lichtlen, P.; Sirito, M.; Sawadogo, M.; Schaffner, W. The transcription factors MTF-1 and USF1 cooperate to regulate mouse metallothionein-I expression in response to the essential metal zinc in visceral endoderm cells during early development. EMBO J. 2001, 20, 1114–1122. [Google Scholar] [CrossRef] [PubMed]
- Yin, H.; Smith, M.; Glass, J. Stable expression of C/EBPalpha in prostate cancer cells down-regulates metallothionein and increases zinc-induced toxicity. Prostate 2005, 62, 209–216. [Google Scholar] [CrossRef] [PubMed]
- Datta, J.; Majumder, S.; Kutay, H.; Motiwala, T.; Frankel, W.; Costa, R.; Cha, H.C.; MacDougald, O.A.; Jacob, S.T.; Ghoshal, K. Metallothionein expression is suppressed in primary human hepatocellular carcinomas and is mediated through inactivation of CCAAT/enhancer binding protein alpha by phosphatidylinositol 3-kinase signaling cascade. Cancer Res. 2007, 67, 2736–2746. [Google Scholar] [CrossRef] [PubMed]
- Jacob, S.T.; Majumder, S.; Ghoshal, K. Suppression of metallothionein-I/II expression and its probable molecular mechanisms. Environ. Health Perspect. 2002, 110, 827–830. [Google Scholar] [CrossRef] [PubMed]
- Majumder, S.; Ghoshal, K.; Gronostajski, R.M.; Jacob, S.T. Downregulation of constitutive and heavy metal-induced metallothionein-I expression by nuclear factor I. Gene Expr. 2001, 9, 203–215. [Google Scholar] [CrossRef] [PubMed]
- LaRochelle, O.; Labbé, S.; Harrisson, J.F.; Simard, C.; Tremblay, V.; St-Gelais, G.; Govindan, M.V.; Séguin, C. Nuclear factor-1 and metal transcription factor-1 synergistically activate the mouse metallothionein-1 gene in response to metal ions. J. Biol. Chem. 2008, 283, 8190–8201. [Google Scholar] [CrossRef] [PubMed]
- Gu, Y.Z.; Hogenesch, J.B.; Bradfield, C.A. The PAS superfamily: Sensors of environmental and developmental signals. Annu. Rev. Pharmacol. Toxicol. 2000, 40, 519–561. [Google Scholar] [CrossRef] [PubMed]
- Cao, C.; Wang, Z.; Niu, C.; Desneux, N.; Gao, X. Transcriptome profiling of Chironomus kiinensis under phenol stress using Solexa sequencing technology. PLoS ONE 2013, 8. [Google Scholar] [CrossRef] [PubMed]
- Sato, S.; Shirakawa, H.; Tomita, S.; Tohkin, M.; Gonzalez, F.J.; Komai, M. The aryl hydrocarbon receptor and glucocorticoid receptor interact to activate human metallothionein 2A. Toxicol. Appl. Pharmacol. 2013, 273, 90–99. [Google Scholar] [CrossRef] [PubMed]
- Okumura, F.; Li, Y.; Itoh, N.; Nakanishi, T.; Isobe, M.; Andrews, G.K.; Kimura, T. The zinc-sensing transcription factor MTF-1 mediates zinc-induced epigenetic changes in chromatin of the mouse metallothionein-I promoter. Biochim. Biophys. Acta 2011, 1809, 56–62. [Google Scholar] [CrossRef] [PubMed]
- Tao, Y.F.; Xu, L.X.; Lu, J.; Cao, L.; Li, Z.H.; Hu, S.Y.; Wang, N.N.; Du, X.J.; Sun, L.C.; Zhao, W.L.; et al. Metallothionein III (MT3) is a putative tumor suppressor gene that is frequently inactivated in pediatric acute myeloid leukemia by promoter hypermethylation. J. Transl. Med. 2014, 12, 182. [Google Scholar] [CrossRef] [PubMed]
- Majumder, S.; Ghoshal, K.; Li, Z.; Jacob, S.T. Hypermethylation of metallothionein-I promoter and suppression of its induction in cell lines overexpressing the large subunit of Ku protein. J. Biol. Chem. 1999, 274, 28584–28589. [Google Scholar] [CrossRef] [PubMed]
- Radtke, F.; Hug, M.; Georgiev, O.; Matsuo, K.; Schaffner, W. Differential sensitivity of zinc finger transcription factors MTF-1, Sp1 and Krox-20 to CpG methylation of their binding sites. Biol. Chem. Hoppe Seyler 1996, 377, 47–56. [Google Scholar] [CrossRef] [PubMed]
- Keller, T.E.; Han, P.; Yi, S.V. Evolutionary transition of promoter and gene body DNA methylation across invertebrate-vertebrate boundary. Mol. Biol. Evol. 2016, 33, 1019–1028. [Google Scholar] [CrossRef] [PubMed]
- Gavery, M.R.; Roberts, S.B. DNA methylation patterns provide insight into epigenetic regulation in the Pacific oyster (Crassostrea gigas). BMC Genom. 2010, 11, 483. [Google Scholar] [CrossRef] [PubMed]
- Olson, C.E.; Roberts, S.B. Genome-wide profiling of DNA methylation and gene expression in Crassostrea gigas male gametes. Front. Physiol. 2014, 5, 1–7. [Google Scholar] [CrossRef] [PubMed]
- Sung, M.H.; Guertin, M.J.; Baek, S.; Hager, G.L. DNase footprint signatures are dictated by factor dynamics and DNA sequence. Mol. Cell 2014, 56, 275–285. [Google Scholar] [CrossRef] [PubMed]
- Zianni, M.; Tessanne, K.; Merighi, M.; Laguna, R.; Tabita, F.R. Identification of the DNA bases of a DNase I footprint by the use of dye primer sequencing on an automated capillary DNA analysis instrument. J. Biomol. Tech. 2006, 17, 103–113. [Google Scholar] [PubMed]
- Matys, V.; Kel-Margoulis, O.V.; Fricke, E.; Liebich, I.; Land, S.; Barre-Dirrie, A.; Reuter, I.; Chekmenev, D.; Krull, M.; Hornischer, K.; et al. Transfac and its module TRANSCompel: Transcriptional gene regulation in eukaryotes. Nucleic Acids Res. 2006, 34, D108–D110. [Google Scholar] [CrossRef] [PubMed]
- Rajasethupathy, P.; Fiumara, F.; Sheridan, R.; Betel, D.; Puthanveettil, S.V.; Russo, J.J.; Sander, C.; Tuschl, T.; Kandel, E. Characterization of small RNAs in Aplysia reveals a role for miR-124 in constraining synaptic plasticity through CREB. Neuron 2009, 63, 803–817. [Google Scholar] [CrossRef] [PubMed]
- Canesi, L.; Ciacci, C.; Lorusso, L.C.; Betti, M.; Guarnieri, T.; Tavolari, S.; Gallo, G. Immunomodulation by 17β-estradiol in bivalve hemocytes. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2006, 291, R664–R673. [Google Scholar] [CrossRef] [PubMed]
© 2017 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Drechsel, V.; Schauer, K.; Šrut, M.; Höckner, M. Regulatory Plasticity of Earthworm wMT-2 Gene Expression. Int. J. Mol. Sci. 2017, 18, 1113. https://doi.org/10.3390/ijms18061113
Drechsel V, Schauer K, Šrut M, Höckner M. Regulatory Plasticity of Earthworm wMT-2 Gene Expression. International Journal of Molecular Sciences. 2017; 18(6):1113. https://doi.org/10.3390/ijms18061113
Chicago/Turabian StyleDrechsel, Victoria, Karl Schauer, Maja Šrut, and Martina Höckner. 2017. "Regulatory Plasticity of Earthworm wMT-2 Gene Expression" International Journal of Molecular Sciences 18, no. 6: 1113. https://doi.org/10.3390/ijms18061113
APA StyleDrechsel, V., Schauer, K., Šrut, M., & Höckner, M. (2017). Regulatory Plasticity of Earthworm wMT-2 Gene Expression. International Journal of Molecular Sciences, 18(6), 1113. https://doi.org/10.3390/ijms18061113