Transplantation of Menstrual Blood-Derived Mesenchymal Stem Cells Promotes the Repair of LPS-Induced Acute Lung Injury
Abstract
:1. Introduction
2. Results
2.1. Characterization of the MenSCs
2.2. Migration of MenSCs In Vivo and In Vitro
2.3. MenSCs Protect BEAS-2B Cells from LPS Injury
2.4. Differentiation of MenSCs into Lung Epithelial Cells
2.5. MenSCs Relieve Symptoms of ALI
2.6. MenSC Attenuate the Inflammation of ALI
2.7. MenSCs Promote the Repair of Damaged Lung Tissue
3. Discussion
4. Materials and Methods
4.1. Isolation and Culture of Cells
4.2. Characterization of the MenSCs
4.3. MenSC Migration
4.4. Co-Culture of MenSCs and BEAS-2B Cells
4.5. MenSC Differentiation into Lung Epithelial Cells
4.6. Animal Model of LPS-Induced ALI
4.7. Detection of BALF Protein and Myeloperoxidase (MPO) Activity
4.8. Real-Time PCR Analysis of Cytokines
4.9. Immunohistochemistry of PCNA and Caspase-3
4.10. Western Blot Analysis
4.11. Statistical Analysis
5. Conclusions
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Ware, L.B.; Matthay, M.A. The acute respiratory distress syndrome. N. Engl. J. Med. 2000, 342, 1334–1349. [Google Scholar] [CrossRef] [PubMed]
- Rubenfeld, G.D.; Caldwell, E.; Peabody, E.; Weaver, J.; Martin, D.P.; Neff, M.; Stern, E.J.; Hudson, L.D. Incidence and outcomes of acute lung injury. N. Engl. J. Med. 2005, 353, 1685–1693. [Google Scholar] [CrossRef] [PubMed]
- Matthay, M.A.; Ware, L.B.; Zimmerman, G.A. The acute respiratory distress syndrome. J. Clin. Investig. 2012, 122, 2731–2740. [Google Scholar] [CrossRef] [PubMed]
- Calfee, C.S.; Matthay, M.A. Nonventilatory treatments for acute lung injury and ARDS. Chest 2007, 131, 913–920. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.W.; Fang, X.; Gupta, N.; Serikov, V.; Matthay, M.A. Allogeneic human mesenchymal stem cells for treatment of E. coli endotoxin-induced acute lung injury in the ex vivo perfused human lung. Proc. Natl. Acad. Sci. USA 2009, 106, 16357–16362. [Google Scholar] [CrossRef] [PubMed]
- Friedenstein, A.J.; Chailakhyan, R.K.; Latsinik, N.V.; Panasyuk, A.F.; Keiliss-Borok, I.V. Stromal cells responsible for transferring the microenvironment of the hemopoietic tissues. Cloning in vitro and retransplantation in vivo. Transplantation 1974, 17, 331–340. [Google Scholar] [PubMed]
- Le Blanc, K.; Mougiakakos, D. Multipotent mesenchymal stromal cells and the innate immune system. Nat. Rev. Immunol. 2012, 12, 383–396. [Google Scholar] [PubMed]
- Salem, H.K.; Thiemermann, C. Mesenchymal stromal cells: Current understanding and clinical status. Stem Cells 2010, 28, 585–596. [Google Scholar] [CrossRef] [PubMed]
- Ma, S.; Xie, N.; Li, W.; Yuan, B.; Shi, Y.; Wang, Y. Immunobiology of mesenchymal stem cells. Cell Death Differ. 2014, 21, 216–225. [Google Scholar] [CrossRef] [PubMed]
- Yamada, M.; Kubo, H.; Kobayashi, S.; Ishizawa, K.; Numasaki, M.; Ueda, S.; Suzuki, T.; Sasaki, H. Bone marrow-derived progenitor cells are important for lung repair after lipopolysaccharide-induced lung injury. J. Immunol. 2004, 172, 1266–1272. [Google Scholar] [CrossRef] [PubMed]
- Kahler, C.M.; Wechselberger, J.; Hilbe, W.; Gschwendtner, A.; Colleselli, D.; Niederegger, H.; Boneberg, E.M.; Spizzo, G.; Wendel, A.; Gunsilius, E.; et al. Peripheral infusion of rat bone marrow derived endothelial progenitor cells leads to homing in acute lung injury. Respir. Res. 2007, 8, 50. [Google Scholar] [PubMed]
- Gupta, N.; Su, X.; Popov, B.; Lee, J.W.; Serikov, V.; Matthay, M.A. Intrapulmonary delivery of bone marrow-derived mesenchymal stem cells improves survival and attenuates endotoxin-induced acute lung injury in mice. J. Immunol. 2007, 179, 1855–1863. [Google Scholar] [PubMed]
- Moodley, Y.; Atienza, D.; Manuelpillai, U.; Samuel, C.S.; Tchongue, J.; Ilancheran, S.; Boyd, R.; Trounson, A. Human umbilical cord mesenchymal stem cells reduce fibrosis of bleomycin-induced lung injury. Am. J. Pathol. 2009, 175, 303–313. [Google Scholar] [CrossRef] [PubMed]
- Kumamoto, M.; Nishiwaki, T.; Matsuo, N.; Kimura, H.; Matsushima, K. Minimally cultured bone marrow mesenchymal stem cells ameliorate fibrotic lung injury. Eur. Respir. J. 2009, 34, 740–748. [Google Scholar] [CrossRef] [PubMed]
- Leblond, A.L.; Naud, P.; Forest, V.; Gourden, C.; Sagan, C.; Romefort, B.; Mathieu, E.; Delorme, B.; Collin, C.; Pages, J.C.; et al. Developing cell therapy techniques for respiratory disease: Intratracheal delivery of genetically engineered stem cells in a murine model of airway injury. Hum. Gene Ther. 2009, 20, 1329–1343. [Google Scholar] [PubMed]
- Xu, J.; Qu, J.; Cao, L.; Sai, Y.; Chen, C.; He, L.; Yu, L. Mesenchymal stem cell-based angiopoietin-1 gene therapy for acute lung injury induced by lipopolysaccharide in mice. J. Pathol. 2008, 214, 472–481. [Google Scholar] [PubMed]
- Lee, J.W.; Fang, X.; Krasnodembskaya, A.; Howard, J.P.; Matthay, M.A. Concise review: Mesenchymal stem cells for acute lung injury: Role of paracrine soluble factors. Stem Cells 2011, 29, 913–919. [Google Scholar] [CrossRef] [PubMed]
- Meng, X.; Ichim, T.E.; Zhong, J.; Rogers, A.; Yin, Z.; Jackson, J.; Wang, H.; Ge, W.; Bogin, V.; Chan, K.W.; et al. Endometrial regenerative cells: A novel stem cell population. J. Transl. Med. 2007, 5, 57. [Google Scholar] [PubMed]
- Sugawara, K.; Hamatani, T.; Yamada, M.; Ogawa, S.; Kamijo, S.; Kuji, N.; Akutsu, H.; Miyado, K.; Yoshimura, Y.; Umezawa, A. Derivation of human decidua-like cells from amnion and menstrual blood. Sci. Rep. 2014, 4, 4599. [Google Scholar] [PubMed]
- Alcayaga-Miranda, F.; Cuenca, J.; Luz-Crawford, P.; Aguila-Diaz, C.; Fernandez, A.; Figueroa, F.E.; Khoury, M. Characterization of menstrual stem cells: Angiogenic effect, migration and hematopoietic stem cell support in comparison with bone marrow mesenchymal stem cells. Stem Cell Res. Ther. 2015, 6, 32. [Google Scholar] [PubMed]
- Gargett, C.E.; Masuda, H. Adult stem cells in the endometrium. Mol. Hum. Reprod. 2010, 16, 818–834. [Google Scholar] [PubMed]
- Parekkadan, B.; Milwid, J.M. Mesenchymal stem cells as therapeutics. Annu. Rev. Biomed. Eng. 2010, 12, 87–117. [Google Scholar] [PubMed]
- Wu, X.; Luo, Y.; Chen, J.; Pan, R.; Xiang, B.; Du, X.; Xiang, L.; Shao, J.; Xiang, C. Transplantation of human menstrual blood progenitor cells improves hyperglycemia by promoting endogenous progenitor differentiation in type 1 diabetic mice. Stem Cells Dev. 2014, 23, 1245–1257. [Google Scholar] [CrossRef] [PubMed]
- Lai, D.; Wang, F.; Yao, X.; Zhang, Q.; Wu, X.; Xiang, C. Human endometrial mesenchymal stem cells restore ovarian function through improving the renewal of germline stem cells in a mouse model of premature ovarian failure. J. Transl. Med. 2015, 13, 155. [Google Scholar] [PubMed]
- Mou, X.Z.; Lin, J.; Chen, J.Y.; Li, Y.F.; Wu, X.X.; Xiang, B.Y.; Li, C.Y.; Ma, J.M.; Xiang, C. Menstrual blood-derived mesenchymal stem cells differentiate into functional hepatocyte-like cells. J. Zhejiang Univ. Sci. B 2013, 14, 961–972. [Google Scholar] [CrossRef] [PubMed]
- Ryan, J.M.; Barry, F.P.; Murphy, J.M.; Mahon, B.P. Mesenchymal stem cells avoid allogeneic rejection. J. Inflamm. 2005, 2, 8. [Google Scholar] [CrossRef] [PubMed]
- Zhong, Z.; Patel, A.N.; Ichim, T.E.; Riordan, N.H.; Wang, H.; Min, W.P.; Woods, E.J.; Reid, M.; Mansilla, E.; Marin, G.H.; et al. Feasibility investigation of allogeneic endometrial regenerative cells. J. Transl. Med. 2009, 7, 15. [Google Scholar] [CrossRef] [PubMed]
- Khoury, M.; Alcayaga-Miranda, F.; Illanes, S.E.; Figueroa, F.E. The promising potential of menstrual stem cells for antenatal diagnosis and cell therapy. Front. Immunol. 2014, 5, 205. [Google Scholar] [CrossRef] [PubMed]
- Borlongan, C.V.; Kaneko, Y.; Maki, M.; Yu, S.J.; Ali, M.; Allickson, J.G.; Sanberg, C.D.; Kuzmin-Nichols, N.; Sanberg, P.R. Menstrual blood cells display stem cell-like phenotypic markers and exert neuroprotection following transplantation in experimental stroke. Stem Cells Dev. 2010, 19, 439–452. [Google Scholar] [CrossRef] [PubMed]
- Liu, T.; Huang, Y.; Zhang, J.; Qin, W.; Chi, H.; Chen, J.; Yu, Z.; Chen, C. Transplantation of human menstrual blood stem cells to treat premature ovarian failure in mouse model. Stem Cells Dev. 2014, 23, 1548–1557. [Google Scholar] [PubMed]
- Rodrigues, M.C.; Voltarelli, J.; Sanberg, P.R.; Allickson, J.G.; Kuzmin-Nichols, N.; Garbuzova-Davis, S.; Borlongan, C.V. Recent progress in cell therapy for basal ganglia disorders with emphasis on menstrual blood transplantation in stroke. Neurosci. Biobehav. Rev. 2012, 36, 177–190. [Google Scholar] [PubMed]
- Zhang, Z.; Wang, J.A.; Xu, Y.; Jiang, Z.; Wu, R.; Wang, L.; Chen, P.; Hu, X.; Yu, H. Menstrual blood derived mesenchymal cells ameliorate cardiac fibrosis via inhibition of endothelial to mesenchymal transition in myocardial infarction. Int. J. Cardiol. 2013, 168, 1711–1714. [Google Scholar] [PubMed]
- Santamaria, X.; Massasa, E.E.; Feng, Y.; Wolff, E.; Taylor, H.S. Derivation of insulin producing cells from human endometrial stromal stem cells and use in the treatment of murine diabetes. Mol. Ther. 2011, 19, 2065–2071. [Google Scholar] [PubMed]
- Cui, C.H.; Uyama, T.; Miyado, K.; Terai, M.; Kyo, S.; Kiyono, T.; Umezawa, A. Menstrual blood-derived cells confer human dystrophin expression in the murine model of Duchenne muscular dystrophy via cell fusion and myogenic transdifferentiation. Mol. Biol. Cell 2007, 18, 1586–1594. [Google Scholar] [CrossRef] [PubMed]
- Xie, Y.; Wang, B.; Li, F.; Jiang, H.; Xiang, J. Molecular cloning and characterization of proliferating cell nuclear antigen (PCNA) from Chinese shrimp Fenneropenaeus chinensis. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2008, 151, 225–229. [Google Scholar] [CrossRef] [PubMed]
- Patel, A.N.; Park, E.; Kuzman, M.; Benetti, F.; Silva, F.J.; Allickson, J.G. Multipotent menstrual blood stromal stem cells: Isolation, characterization, and differentiation. Cell Transplant. 2008, 17, 303–311. [Google Scholar] [CrossRef] [PubMed]
- Huss, R.; Moosmann, S. The co-expression of CD117 (c-kit) and osteocalcin in activated bone marrow stem cells in different diseases. Br. J. Haematol. 2002, 118, 305–312. [Google Scholar] [CrossRef] [PubMed]
- Mei, S.H.; McCarter, S.D.; Deng, Y.; Parker, C.H.; Liles, W.C.; Stewart, D.J. Prevention of LPS-induced acute lung injury in mice by mesenchymal stem cells overexpressing angiopoietin 1. PLoS Med. 2007, 4, e269. [Google Scholar]
- Xu, J.; Woods, C.R.; Mora, A.L.; Joodi, R.; Brigham, K.L.; Iyer, S.; Rojas, M. Prevention of endotoxin-induced systemic response by bone marrow-derived mesenchymal stem cells in mice. Am. J. Physiol. Lung Cell Mol. Physiol. 2007, 293, L131–L141. [Google Scholar] [CrossRef] [PubMed]
- Ortiz, L.A.; Gambelli, F.; McBride, C.; Gaupp, D.; Baddoo, M.; Kaminski, N.; Phinney, D.G. Mesenchymal stem cell engraftment in lung is enhanced in response to bleomycin exposure and ameliorates its fibrotic effects. Proc. Natl. Acad. Sci. USA 2003, 100, 8407–8411. [Google Scholar] [PubMed]
- Rojas, M.; Xu, J.; Woods, C.R.; Mora, A.L.; Spears, W.; Roman, J.; Brigham, K.L. Bone marrow-derived mesenchymal stem cells in repair of the injured lung. Am. J. Respir. Cell Mol. Biol. 2005, 33, 145–152. [Google Scholar] [CrossRef] [PubMed]
- Psaltis, P.J.; Zannettino, A.C.; Worthley, S.G.; Gronthos, S. Concise review: Mesenchymal stromal cells: Potential for cardiovascular repair. Stem Cells 2008, 26, 2201–2210. [Google Scholar] [CrossRef] [PubMed]
- Hocking, A.M.; Gibran, N.S. Mesenchymal stem cells: Paracrine signaling and differentiation during cutaneous wound repair. Exp. Cell Res. 2010, 316, 2213–2219. [Google Scholar] [CrossRef] [PubMed]
- Casiraghi, F.; Noris, M.; Remuzzi, G. Immunomodulatory effects of mesenchymal stromal cells in solid organ transplantation. Curr. Opin. Organ Transplant. 2010, 15, 731–737. [Google Scholar] [CrossRef] [PubMed]
- Augello, A.; Tasso, R.; Negrini, S.M.; Amateis, A.; Indiveri, F.; Cancedda, R.; Pennesi, G. Bone marrow mesenchymal progenitor cells inhibit lymphocyte proliferation by activation of the programmed death 1 pathway. Eur. J. Immunol. 2005, 35, 1482–1490. [Google Scholar] [PubMed]
- Krampera, M.; Glennie, S.; Dyson, J.; Scott, D.; Laylor, R.; Simpson, E.; Dazzi, F. Bone marrow mesenchymal stem cells inhibit the response of naive and memory antigen-specific T cells to their cognate peptide. Blood 2003, 101, 3722–3729. [Google Scholar] [CrossRef] [PubMed]
- Islam, M.N.; Das, S.R.; Emin, M.T.; Wei, M.; Sun, L.; Westphalen, K.; Rowlands, D.J.; Quadri, S.K.; Bhattacharya, S.; Bhattacharya, J. Mitochondrial transfer from bone-marrow-derived stromal cells to pulmonary alveoli protects against acute lung injury. Nat. Med. 2012, 18, 759–765. [Google Scholar] [CrossRef] [PubMed]
- Sueblinvong, V.; Weiss, D.J. Cell therapy approaches for lung diseases: Current status. Curr. Opin. Pharmacol. 2009, 9, 268–273. [Google Scholar] [CrossRef] [PubMed]
- Gnecchi, M.; Zhang, Z.; Ni, A.; Dzau, V.J. Paracrine mechanisms in adult stem cell signaling and therapy. Circ. Res. 2008, 103, 1204–1219. [Google Scholar] [PubMed]
- Oh, J.Y.; Kim, M.K.; Shin, M.S.; Lee, H.J.; Ko, J.H.; Wee, W.R.; Lee, J.H. The anti-inflammatory and anti-angiogenic role of mesenchymal stem cells in corneal wound healing following chemical injury. Stem Cells 2008, 26, 1047–1055. [Google Scholar] [CrossRef] [PubMed]
- Geiser, T.; Atabai, K.; Jarreau, P.H.; Ware, L.B.; Pugin, J.; Matthay, M.A. Pulmonary edema fluid from patients with acute lung injury augments in vitro alveolar epithelial repair by an IL-1β-dependent mechanism. Am. J. Respir. Crit. Care Med. 2001, 163, 1384–1388. [Google Scholar] [PubMed]
- Gupta, S.; Feng, L.; Yoshimura, T.; Redick, J.; Fu, S.M.; Rose, C.E., Jr. Intra-alveolar macrophage-inflammatory peptide 2 induces rapid neutrophil localization in the lung. Am. J. Respir. Cell Mol. Biol. 1996, 15, 656–663. [Google Scholar] [CrossRef] [PubMed]
- Schweitzer, K.S.; Johnstone, B.H.; Garrison, J.; Rush, N.I.; Cooper, S.; Traktuev, D.O.; Feng, D.; Adamowicz, J.J.; van Demark, M.; Fisher, A.J.; et al. Adipose stem cell treatment in mice attenuates lung and systemic injury induced by cigarette smoking. Am. J. Respir. Crit. Care Med. 2011, 183, 215–225. [Google Scholar] [PubMed]
- Deterding, R.R.; Havill, A.M.; Yano, T.; Middleton, S.C.; Jacoby, C.R.; Shannon, J.M.; Simonet, W.S.; Mason, R.J. Prevention of bleomycin-induced lung injury in rats by keratinocyte growth factor. Proc. Assoc. Am. Phys. 1997, 109, 254–268. [Google Scholar] [PubMed]
- Sugahara, K.; Iyama, K.; Kuroda, M.J.; Sano, K. Double intratracheal instillation of keratinocyte growth factor prevents bleomycin-induced lung fibrosis in rats. J. Pathol. 1998, 186, 90–98. [Google Scholar] [PubMed]
- Baba, Y.; Yazawa, T.; Kanegae, Y.; Sakamoto, S.; Saito, I.; Morimura, N.; Goto, T.; Yamada, Y.; Kurahashi, K. Keratinocyte growth factor gene transduction ameliorates acute lung injury and mortality in mice. Hum. Gene Ther. 2007, 18, 130–141. [Google Scholar] [CrossRef] [PubMed]
- Bao, S.; Wang, Y.; Sweeney, P.; Chaudhuri, A.; Doseff, A.I.; Marsh, C.B.; Knoell, D.L. Keratinocyte growth factor induces Akt kinase activity and inhibits Fas-mediated apoptosis in A549 lung epithelial cells. Am. J. Physiol. Lung Cell. Mol. Physiol. 2005, 288, L36–L42. [Google Scholar] [CrossRef] [PubMed]
- Chao, M.V. Neurotrophins and their receptors: A convergence point for many signalling pathways. Nat. Rev. Neurosci. 2003, 4, 299–309. [Google Scholar] [CrossRef] [PubMed]
- Curley, G.F.; Ansari, B.; Hayes, M.; Devaney, J.; Masterson, C.; Ryan, A.; Barry, F.; O’Brien, T.; Toole, D.O.; Laffey, J.G. Effects of intratracheal mesenchymal stromal cell therapy during recovery and resolution after ventilator-induced lung injury. Anesthesiology 2013, 118, 924–932. [Google Scholar] [PubMed]
- Curley, G.F.; Hayes, M.; Ansari, B.; Shaw, G.; Ryan, A.; Barry, F.; O’Brien, T.; O’Toole, D.; Laffey, J.G. Mesenchymal stem cells enhance recovery and repair following ventilator-induced lung injury in the rat. Thorax 2012, 67, 496–501. [Google Scholar] [PubMed]







| Primer Name | Sequence (5′–3′) | Species |
|---|---|---|
| β-actin-Forward | GATGACCCAGATCATGTTTGA | Mouse |
| β-actin-Reverse | GGAGAGCATAGCCCTCGTAG | |
| IL-6-Forward | GGCGGATCGGATGTTGTGAT | Mouse |
| IL-6-R | GGACCCCAGACAATCGGTTG | |
| IL-1β-Forward | GACCTTCCAGGATGAGGACA | Mouse |
| IL-1β-Reverse | AGCTCATATGGGTCCGACAG | |
| TGF-β1-Forward | AATACGTCAGACATTCGGGAAGCA | Mouse |
| TGF-β1-Reverse | GTCAATGTACAGCTGCCGCACACA | |
| IL-10-Forward | CACTGCTATGTTGCCTGCTC | Mouse |
| IL-10-Reverse | TTCATGGCCTTGTAGACACC | |
| Caspase-3-Forward | TACCGGTGGAGGCTGACT | Mouse |
| Caspase-3-Reverse | GCTGCAAAGGGACTGGAT | |
| KGF-Forward | TGGTACCTGAGGATTGACAAACGA | Mouse |
| KGF-Reverse | CCTTTGATTGCCACAATTCCAAC | |
| PCNA-Forward | TTGCACGTATATGCCGAGACC | Mouse |
| PCNA-Reverse | GGTGAACAGGCTCATTCATCTCT |
© 2017 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xiang, B.; Chen, L.; Wang, X.; Zhao, Y.; Wang, Y.; Xiang, C. Transplantation of Menstrual Blood-Derived Mesenchymal Stem Cells Promotes the Repair of LPS-Induced Acute Lung Injury. Int. J. Mol. Sci. 2017, 18, 689. https://doi.org/10.3390/ijms18040689
Xiang B, Chen L, Wang X, Zhao Y, Wang Y, Xiang C. Transplantation of Menstrual Blood-Derived Mesenchymal Stem Cells Promotes the Repair of LPS-Induced Acute Lung Injury. International Journal of Molecular Sciences. 2017; 18(4):689. https://doi.org/10.3390/ijms18040689
Chicago/Turabian StyleXiang, Bingyu, Lu Chen, Xiaojun Wang, Yongjia Zhao, Yanling Wang, and Charlie Xiang. 2017. "Transplantation of Menstrual Blood-Derived Mesenchymal Stem Cells Promotes the Repair of LPS-Induced Acute Lung Injury" International Journal of Molecular Sciences 18, no. 4: 689. https://doi.org/10.3390/ijms18040689
APA StyleXiang, B., Chen, L., Wang, X., Zhao, Y., Wang, Y., & Xiang, C. (2017). Transplantation of Menstrual Blood-Derived Mesenchymal Stem Cells Promotes the Repair of LPS-Induced Acute Lung Injury. International Journal of Molecular Sciences, 18(4), 689. https://doi.org/10.3390/ijms18040689
