Melatonin MT1 and MT2 Receptors in the Ram Reproductive Tract
Abstract
:1. Introduction
2. Results
2.1. Melatonin Receptor Gene Expression in the Ram Reproductive Tract
2.2. Protein Expression by Western-Blot and Immunohistochemistry
2.3. Changes in Melatonin Receptor Distribution during Ram Sperm Maturation in the Testis and Epididymis
3. Discussion
4. Materials and Methods
4.1. RNA Isolation and Retrotranscription
4.2. Quantitative Real-Time PCR (qPCR)
4.3. Sodium Dodecyl Sulfate-Polyacrylamide Gel Electrophoresis (SDS-PAGE) and Western Blotting
4.4. Immunohistochemistry
4.5. Indirect Immunofluorescence Assays
4.6. Statistical Analyses
5. Conclusions
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Tan, D.X.; Hardeland, R.; Manchester, L.C.; Paredes, S.D.; Korkmaz, A.; Sainz, R.M.; Mayo, J.C.; Fuentes-Broto, L.; Reiter, R.J. The changing biological roles of melatonin during evolution: From an antioxidant to signals of darkness, sexual selection and fitness. Biol. Rev. Camb. Philos. Soc. 2010, 85, 607–623. [Google Scholar] [CrossRef] [PubMed]
- Tan, D.X.; Manchester, L.C.; Terron, M.P.; Flores, L.J.; Reiter, R.J. One molecule, many derivatives: A never-ending interaction of melatonin with reactive oxygen and nitrogen species? J. Pineal. Res. 2007, 42, 28–42. [Google Scholar] [CrossRef] [PubMed]
- Pandi-Perumal, S.R.; Srinivasan, V.; Maestroni, G.J.M.; Cardinali, D.P.; Poeggeler, B.; Hardeland, R. Melatonin. Nature’s most versatile biological signal? FEBS J. 2006, 273, 2813–2838. [Google Scholar] [CrossRef] [PubMed]
- Reiter, R.J.; Tan, D.X.; Osuna, C.; Gitto, E. Actions of melatonin in the reduction of oxidative stress. J. Biomed. Sci. 2000, 7, 444–458. [Google Scholar] [CrossRef] [PubMed]
- Benitez-King, G.; Huerto-Delgadillo, L.; Anton-Tay, F. Binding of 3H-melatonin to calmodulin. Life Sci. 1993, 53, 201–207. [Google Scholar] [CrossRef]
- Benitez-King, G. Melatonin as a cytoskeletal modulator: Implications for cell physiology and disease. J. Pineal. Res. 2006, 40, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Dubocovich, M.L.; Markowska, M. Functional MT1 and MT2 melatonin receptors in mammals. Endocrine 2005, 27, 101–110. [Google Scholar] [CrossRef]
- Jockers, R.; Maurice, P.; Boutin, J.A.; Delagrange, P. Melatonin receptors, heterodimerization, signal transduction and binding sites: What’s new? Br. J. Pharmacol. 2008, 154, 1182–1195. [Google Scholar] [CrossRef] [PubMed]
- Dubocovich, M.L.; Rivera-Bermudez, M.A.; Gerdin, M.J.; Masana, M.I. Molecular pharmacology, regulation and function of mammalian melatonin receptors. Front. Biosci. 2003, 8, D1093–D1108. [Google Scholar] [CrossRef] [PubMed]
- El-Raey, M.; Geshi, M.; Somfai, T.; Kaneda, M.; Hirako, M.; Abdel-Ghaffar, A.E.; Sosa, G.A.; El-Roos, M.E.A.A.; Nagai, T. Evidence of melatonin synthesis in the cumulus oocyte complexes and its role in enhancing oocyte maturation in vitro in cattle. Mol. Reprod. Dev. 2011, 78, 250–262. [Google Scholar] [CrossRef] [PubMed]
- Niles, L.P.; Wang, J.; Shen, L.; Lobb, D.K.; Younglai, E.V. Melatonin receptor mRNA expression in human granulosa cells. Mol. Cell. Endocrinol. 1999, 156, 107–110. [Google Scholar] [CrossRef]
- Soares, J.M.J.; Masana, M.I.; Ersahin, C.; Dubocovich, M.L. Functional melatonin receptors in rat ovaries at various stages of the estrous cycle. J. Pharmacol. Exp. Ther. 2003, 306, 694–702. [Google Scholar] [CrossRef] [PubMed]
- Schlabritz-Loutsevitch, N.; Hellner, N.; Middendorf, R.; Müller, D.; Olcese, J. The human myometrium as a target for melatonin. J. Clin. Endocrinol. Metab. 2003, 88, 908–913. [Google Scholar] [CrossRef] [PubMed]
- Dillon, D.C.; Easley, S.E.; Asch, B.B.; Cheney, R.T.; Brydon, L.; Jockers, R.; Winston, J.S.; Brooks, J.S.; Hurd, T.; Asch, H.L. Differential expression of high-affinity melatonin receptors (MT1) in normal and malignant human breast tissue. Am. J. Clin. Pathol. 2002, 118, 451–458. [Google Scholar] [CrossRef] [PubMed]
- Lanoix, D.; Beghdadi, H.; Lafond, J.; Vaillancourt, C. Human placental trophoblasts synthesize melatonin and express its receptors. J. Pineal. Res. 2008, 45, 50–60. [Google Scholar] [CrossRef] [PubMed]
- Izzo, G.; Francesco, A.; Ferrara, D.; Campitiello, M.R.; Serino, I.; Minucci, S.; d’Istria, M. Expression of melatonin (MT1, MT2) and melatonin-related receptors in the adult rat testes and during development. Zygote 2010, 18, 257–264. [Google Scholar] [CrossRef] [PubMed]
- Frungieri, M.B.; Mayerhofer, A.; Zitta, K.; Pignataro, O.P.; Calandra, R.S.; Gonzalez-Calvar, S.I. Direct effect of melatonin on Syrian hamster testes: Melatonin subtype 1a receptors, inhibition of androgen production, and interaction with the local corticotropin-releasing hormone system. Endocrinology 2005, 146, 1541–1552. [Google Scholar] [CrossRef] [PubMed]
- Shiu, S.Y.; Li, L.; Siu, S.W.; Xi, S.C.; Fong, S.W.; Pang, S.F. Biological basis and possible physiological implications of melatonin receptor-mediated signaling in the rat epididymis. Biol. Signals Recept. 2000, 9, 172–187. [Google Scholar] [CrossRef] [PubMed]
- Gilad, E.; Laudon, M.; Matzkin, H.; Pick, E.; Sofer, M.; Braf, Z.; Zisapel, N. Functional melatonin receptors in human prostate epithelial cells. Endocrinology 1996, 137, 1412–1417. [Google Scholar] [PubMed]
- Carneiro, R.C.; Markus, R.P.; Dubocovich, M.L. 2-[125I]iodomelatonin binding sites in the rat vas deferens. Biol. Signals 1993, 2, 194–198. [Google Scholar] [CrossRef] [PubMed]
- Rosa, H.J.D.; Bryant, M.J. Seasonality of reproduction in sheep. Small Rumin. Res. 2003, 48, 155–171. [Google Scholar] [CrossRef]
- Malpaux, B.; Viguie, C.; Skinner, D.C.; Thiery, J.C.; Pelletier, J.; Chemineau, P. Seasonal breeding in sheep: Mechanism of action of melatonin. Anim. Reprod. Sci. 1996, 42, 109–117. [Google Scholar] [CrossRef]
- Avdi, M.; Banos, G.; Stefos, K.; Chemineau, P. Seasonal variation in testicular volume and sexual behavior of Chios and Serres rams. Theriogenology 2004, 62, 275–282. [Google Scholar] [CrossRef] [PubMed]
- Mandiki, S.N.M.; Derycke, G.; Bister, J.L.; Paquay, R. Influence of season and age on sexual maturation parameters of Texel, Suffolk and Ile-de-France rams: 1. Testicular size, semen quality and reproductive capacity. Small Rumin. Res. 1998, 28, 67–79. [Google Scholar] [CrossRef]
- Lincoln, G.A.; Lincoln, C.E.; McNeilly, A.S. Seasonal cycles in the blood plasma concentration of fsh, inhibin and testosterone, and testicular size in rams of wild, feral and domesticated breeds of sheep. J Reprod. Fertil. 1990, 88, 623–633. [Google Scholar] [CrossRef] [PubMed]
- Egerszegi, I.; Sarlos, P.; Ratky, J.; Solti, L.; Faigl, V.; Kulcsar, M.; Cseh, S. Effect of melatonin treatment on semen parameters and endocrine function in black racka rams out of the breeding season. Small Rumin. Res. 2014, 116, 192–198. [Google Scholar] [CrossRef]
- Casao, A.; Vega, S.; Palacín, I.; Pérez-Pe, R.; Laviña, A.; Quintín, F.J.; Sevilla, E.; Abecia, J.A.; Cebrián-Pérez, J.A.; Forcada, F.; et al. Effects of melatonin implants during non-breeding season on sperm motility and reproductive parameters in Rasa Aragonesa rams. Reprod. Domest. Anim. 2010, 45, 425–432. [Google Scholar] [CrossRef] [PubMed]
- Rekik, M.; Taboubi, R.; Ben Salem, I.; Fehri, Y.; Sakly, C.; Lassoued, N.; Hilali, M.E. Melatonin administration enhances the reproductive capacity of young rams under a southern mediterranean environment. Anim. Sci. J. 2015, 86, 666–672. [Google Scholar] [CrossRef] [PubMed]
- Kokolis, N.; Theodosiadou, E.; Tsantarliotou, M.; Rekkas, C.; Goulas, P.; Smokovitis, A. The effect of melatonin implants on blood testosterone and acrosin activity in spermatozoa of the ram. Andrologia 2000, 32, 107–114. [Google Scholar] [CrossRef] [PubMed]
- Casao, A.; Gallego, M.; Abecia, J.A.; Forcada, F.; Pérez-Pé, R.; Muiño-Blanco, T.; Cebrián-Pérez, J.Á. Identification and immunolocalisation of melatonin MT1 and MT2 receptors in rasa aragonesa ram spermatozoa. Reprod. Fertil. Dev. 2012, 24, 953–961. [Google Scholar] [CrossRef] [PubMed]
- Casao, A.; Mendoza, N.; Pérez-Pé, R.; Grasa, A.; Abecia, J.A.; Forcada, F.; Cebrián-Pérez, J.A.; Muino-Blanco, T. Melatonin prevents capacitation and apoptotic-like changes of ram spermatozoa and increases fertility rate. J. Pineal. Res. 2010, 48, 39–46. [Google Scholar] [CrossRef] [PubMed]
- Gonzalez-Arto, M.; Luna, C.; Perez-Pe, R.; Muino-Blanco, T.; Cebrian-Perez, J.A.; Casao, A. New evidence of melatonin receptor contribution to ram sperm functionality. Reprod. Fertil. Dev. 2016, 28, 924–935. [Google Scholar] [CrossRef] [PubMed]
- Casao, A.; Cebrian, I.; Asumpcao, M.; Perez-Pe, R.; Abecia, J.; Forcada, F.; Cebrian-Perez, J.; Muino-Blanco, T. Seasonal variations of melatonin in ram seminal plasma are correlated to those of testosterone and antioxidant enzymes. Reprod. Biol. Endocrinol. 2010, 8. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gonzalez-Arto, M.; Hamilton, T.R.; Gallego, M.; Gaspar-Torrubia, E.; Aguilar, D.; Serrano-Blesa, E.; Abecia, J.A.; Perez-Pe, R.; Muino-Blanco, T.; Cebrian-Perez, J.A.; et al. Evidence of melatonin synthesis in the ram reproductive tract. Andrology 2016, 4, 163–171. [Google Scholar] [CrossRef] [PubMed]
- Bejarano, I.; Monllor, F.; Marchena, A.M.; Ortiz, A.; Lozano, G.; Jimenez, M.I.; Gaspar, P.; Garcia, J.F.; Pariente, J.A.; Rodriguez, A.B.; et al. Exogenous melatonin supplementation prevents oxidative stress-evoked DNA damage in human spermatozoa. J. Pineal. Res. 2014, 57, 333–339. [Google Scholar] [CrossRef] [PubMed]
- Espino, J.; Ortiz, Á.; Bejarano, I.; Lozano, G.M.; Monllor, F.; García, J.F.; Rodríguez, A.B.; Pariente, J.A. Melatonin protects human spermatozoa from apoptosis via melatonin receptor- and extracellular signal-regulated kinase-mediated pathways. Fertil. Steril. 2011, 95, 2290–2296. [Google Scholar] [CrossRef] [PubMed]
- Perez-Pe, R.; Barrios, B.; Muino-Blanco, T.; Cebrian-Perez, J.A. Seasonal differences in ram seminal plasma revealed by partition in an aqueous two-phase system. J. Chromatogr. B Biomed. Sci. Appl. 2001, 760, 113–121. [Google Scholar] [CrossRef]
- Casao, A.; Pérez-Pé, R.; Abecia, J.A.; Forcada, F.; Muiño-Blanco, T.; Cebrián-Pérez, J.A. The effect of exogenous melatonin during the non-reproductive season on the seminal plasma hormonal profile and the antioxidant defence system of rasa aragonesa rams. Anim. Reprod. Sci. 2013, 138, 168–174. [Google Scholar] [CrossRef] [PubMed]
- Mokhtar, D.M.; Abd-Elhafeez, H.H.; Abou-Elmagd, A.; Hassan, A.H. Melatonin administration induced reactivation in the seminal gland of the Soay rams during non-breeding season: An ultrastructural and morphometrical study. J. Morphol. 2016, 277, 231–243. [Google Scholar] [CrossRef] [PubMed]
- Santiago-Moreno, J.; Toledano-Diaz, A.; Castano, C.; Coloma, M.A.; Esteso, M.C.; Prieto, M.T.; Delgadillo, J.A.; Lopez-Sebastian, A. Photoperiod and melatonin treatments for controlling sperm parameters, testicular and accessory sex glands size in male iberian ibex: A model for captive mountain ruminants. Anim. Reprod. Sci. 2013, 139, 45–52. [Google Scholar] [CrossRef] [PubMed]
- Markus, R.P.; Zago, W.M.; Carneiro, R.C. Melatonin modulation of presynaptic nicotinic acetylcholine receptors in the rat vas deferens. J. Pharmacol. Exp. Ther. 1996, 279, 18–22. [Google Scholar] [PubMed]
- Itoh, M.T.; Ishizuka, B.; Kuribayashi, Y.; Amemiya, A.; Sumi, Y. Melatonin, its precursors, and synthesizing enzyme activities in the human ovary. Mol. Hum. Reprod. 1999, 5, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Tamura, H.; Nakamura, Y.; Korkmaz, A.; Manchester, L.C.; Tan, D.X.; Sugino, N.; Reiter, R.J. Melatonin and the ovary: Physiological and pathophysiological implications. Fertil. Steril. 2009, 92, 328–343. [Google Scholar] [CrossRef] [PubMed]
- Zhao, H.; Pang, S.F.; Poon, A.M.S. Variations of MT1 melatonin receptor density in the rat uterus during decidualization, the estrous cycle and in response to exogenous steroid treatment. J. Pineal. Res. 2002, 33, 140–145. [Google Scholar] [CrossRef] [PubMed]
- Tijmes, M.; Pedraza, R.; Valladares, L. Melatonin in the rat testis: Evidence for local synthesis. Steroids 1996, 61, 65–68. [Google Scholar] [CrossRef]
- Reppert, S.M.; Weaver, D.R.; Ebisawa, T. Cloning and characterization of a mammalian melatonin receptor that mediates reproductive and circadian responses. Neuron 1994, 13, 1177–1185. [Google Scholar] [CrossRef]
- Ayoub, M.A.; Levoye, A.; Delagrange, P.; Jockers, R. Preferential formation of MT1/MT2 melatonin receptor heterodimers with distinct ligand interaction properties compared with MT2 homodimers. Mol. Pharmacol. 2004, 66, 312–321. [Google Scholar] [CrossRef] [PubMed]
- Levoye, A.; Dam, J.; Ayoub, M.A.; Guilllaume, J.L.; Couturier, C.; Delagrange, P.; Jockers, R. The orphan GPR50 receptor specifically inhibits MT1 melatonin receptor function through heterodimerization. Embo J. 2006, 25, 3012–3023. [Google Scholar] [CrossRef] [PubMed]
- Tan, D.X.; Manchester, L.C.; Hardeland, R.; Lopez-Burillo, S.; Mayo, J.C.; Sainz, R.M.; Reiter, R.J. Melatonin: A hormone, a tissue factor, an autocoid, a paracoid, and an antioxidant vitamin. J. Pineal. Res. 2003, 34, 75–78. [Google Scholar] [CrossRef] [PubMed]
- Reiter, R.J.; Rosales-Corral, S.A.; Manchester, L.C.; Tan, D.X. Peripheral reproductive organ health and melatonin: Ready for prime time. Int. J. Mol. Sci. 2013, 14, 7231–7272. [Google Scholar] [CrossRef] [PubMed]
- Agarwal, A.; Saleh, R.A.; Bedaiwy, M.A. Role of reactive oxygen species in the pathophysiology of human reproduction. Fertil. Steril. 2003, 79, 829–843. [Google Scholar] [CrossRef]
- Yang, W.-C.; Tang, K.-Q.; Fu, C.-Z.; Riaz, H.; Zhang, Q.; Zan, L.-S. Melatonin regulates the development and function of bovine sertoli cells via its receptors MT1 and MT2. Anim. Reprod. Sci. 2014, 147, 10–16. [Google Scholar] [CrossRef] [PubMed]
- Gonzalez-Arto, M.; Vicente-Carrillo, A.; Martinez-Pastor, F.; Fernandez-Alegre, E.; Roca, J.; Miro, J.; Rigau, T.; Rodriguez-Gil, J.E.; Perez-Pe, R.; Muino-Blanco, T.; et al. Melatonin receptors MT1 and MT2 are expressed in spermatozoa from several seasonal and nonseasonal breeder species. Theriogenology 2016, 86, 1958–1968. [Google Scholar] [CrossRef] [PubMed]
- Scott, T.W.; Voglmayr, J.K.; Setchell, B.P. Lipid composition and metabolism in testicular and ejaculated ram spermatozoa. Biochem. J. 1967, 102, 456–461. [Google Scholar] [CrossRef] [PubMed]
- Dacheux, J.L.; Voglmayr, J.K. Sequence of sperm cell surface differentiation and its relationship to exogenous fluid proteins in the ram epididymis. Biol. Reprod. 1983, 29, 1033–1046. [Google Scholar] [CrossRef] [PubMed]
- Dacheux, J.-L.; Dacheux, F.; Druart, X. Epididymal protein markers and fertility. Anim. Reprod. Sci. 2016, 169, 76–87. [Google Scholar] [CrossRef] [PubMed]
- Gerdin, M.J.; Masana, M.I.; Rivera-Bermúdez, M.A.; Hudson, R.L.; Earnest, D.J.; Gillette, M.U.; Dubocovich, M.L. Melatonin desensitizes endogenous MT2 melatonin receptors in the rat suprachiasmatic nucleus: Relevance for defining the periods of sensitivity of the mammalian circadian clock to melatonin. FASEB J. 2004, 18, 1646–1656. [Google Scholar] [CrossRef] [PubMed]
- Hagedorn, T.M.; Carlin, R.W.; Schultz, B.D. Oxytocin and vasopressin stimulate anion secretion by human and porcine vas deferens epithelia. Biol. Reprod. 2007, 77, 416–424. [Google Scholar] [CrossRef] [PubMed]
- Gilad, E.; Laudon, M.; Matzkin, H.; Zisapel, N. Evidence for a local action of melatonin on the rat prostate. The Journal of Urology 1998, 159, 1069–1073. [Google Scholar] [CrossRef]
- Karagiannidis, A.; Varsakeli, S.; Alexopoulos, C.; Amarantidis, I. Seasonal variation in semen characteristics of Chios and Friesian rams in greece. Small Rumin. Res. 2000, 37, 125–130. [Google Scholar] [CrossRef]
- Coyan, K.; Kaya, A.; Karaca, F.; Ataman, M.B.; Yildiz, C. The effect of melatonin on sperm quality and testicular size of normospermic and pathospermic rams in the anoestrous season. Wien. Tierarztl. Monatsschr. 1998, 85, 383–388. [Google Scholar]
- Chomczynski, P.; Sacchi, N. The single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction: Twenty-something years on. Nat. Protocols 2006, 1, 581–585. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−∆∆CT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Casao, A.; Pérez-Pé, R.; Forcada, F.; Abecia, A.; Muiño-Blanco, T.; Cebrián-Pérez, J.A. Immunolocalization of Melatonin Receptor MT1A in Ovine Cumulus Cells. In ITEA, Proceeding of XIV Jornadas sobre Producción Animal, Zaragoza, Spain, 17–18 May 2011.
- Coge, F.; Guenin, S.P.; Fery, I.; Migaud, M.; Devavry, S.; Slugocki, C.; Legros, C.; Ouvry, C.; Cohen, W.; Renault, N.; et al. The end of a myth: Cloning and characterization of the ovine melatonin MT2 receptor. Br. J. Pharmacol. 2009, 158, 1248–1262. [Google Scholar] [CrossRef] [PubMed]
Gene | Accession Number | Forward Primer (5’-sequence-3’) (Position) | Reverse Primer (5’-sequence-3’) (Position) |
---|---|---|---|
MT1 | NM_001009725.1 | CTCCATCCTCATCTTCACCATC (164–185) | GGCTCACCACAAACACATTC (276–257) |
MT2 | NM_001130938.1 | GCTGAGAGAATGGAGCGATATG (1692–1713) | GTCCACAGTGAGAAGCCATC (1772–1753) |
β-actin | NM_001009784 | CTCTTCCAGCCTTCCTTCCT (867–886) | GGGCAGTGATCTCTTTCTGC (1044–1025) |
GAPDH | NM_001190390 | CAAGGTCATCCATGACCACTTTG (516–538) | GTCCACCACCCTGTTGCTGTAG (1011–990) |
© 2017 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license ( http://creativecommons.org/licenses/by/4.0/).
Share and Cite
González-Arto, M.; Aguilar, D.; Gaspar-Torrubia, E.; Gallego, M.; Carvajal-Serna, M.; Herrera-Marcos, L.V.; Serrano-Blesa, E.; Hamilton, T.R.d.S.; Pérez-Pé, R.; Muiño-Blanco, T.; et al. Melatonin MT1 and MT2 Receptors in the Ram Reproductive Tract. Int. J. Mol. Sci. 2017, 18, 662. https://doi.org/10.3390/ijms18030662
González-Arto M, Aguilar D, Gaspar-Torrubia E, Gallego M, Carvajal-Serna M, Herrera-Marcos LV, Serrano-Blesa E, Hamilton TRdS, Pérez-Pé R, Muiño-Blanco T, et al. Melatonin MT1 and MT2 Receptors in the Ram Reproductive Tract. International Journal of Molecular Sciences. 2017; 18(3):662. https://doi.org/10.3390/ijms18030662
Chicago/Turabian StyleGonzález-Arto, Marta, David Aguilar, Elena Gaspar-Torrubia, Margarita Gallego, Melissa Carvajal-Serna, Luis V. Herrera-Marcos, Edith Serrano-Blesa, Thais Rose dos Santos Hamilton, Rosaura Pérez-Pé, Teresa Muiño-Blanco, and et al. 2017. "Melatonin MT1 and MT2 Receptors in the Ram Reproductive Tract" International Journal of Molecular Sciences 18, no. 3: 662. https://doi.org/10.3390/ijms18030662
APA StyleGonzález-Arto, M., Aguilar, D., Gaspar-Torrubia, E., Gallego, M., Carvajal-Serna, M., Herrera-Marcos, L. V., Serrano-Blesa, E., Hamilton, T. R. d. S., Pérez-Pé, R., Muiño-Blanco, T., Cebrián-Pérez, J. A., & Casao, A. (2017). Melatonin MT1 and MT2 Receptors in the Ram Reproductive Tract. International Journal of Molecular Sciences, 18(3), 662. https://doi.org/10.3390/ijms18030662