Isolation and Characterization of Dromedary Camel Coronavirus UAE-HKU23 from Dromedaries of the Middle East: Minimal Serological Cross-Reactivity between MERS Coronavirus and Dromedary Camel Coronavirus UAE-HKU23
Abstract
:1. Introduction
2. Results
2.1. Isolation of DcCoV UAE-HKU23
2.2. Subgenomic mRNAs and Their Leader-Body Junction Sequences
2.3. Immunofluorescence Antibody Tests and Neutralization Antibody Assays
2.4. Cross-Antigenicity between DcCoV UAE-HKU23 and MERS-CoV
2.5. Complete RdRp, S and N Gene Sequence Analysis
2.6. Codon Usage Analysis and Genetic Distance of RdRp, S and N Genes
3. Discussion
4. Materials and Methods
4.1. Virus Culture
4.2. Real-Time Quantitative RT-PCR
4.3. Electron Microscopy
4.4. Northern Blotting
4.5. Determination of Leader-Body Junction Sequence
4.6. Immunofluorescence Antibody Tests
4.7. Neutralization Antibody Assays
4.8. Cloning and Purification of (His)6-Tagged Recombinant DcCoV UAE-HKU23 and MERS-CoV Nucleocapsid Proteins from Escherichia coli
4.9. Animal Immunization Using N Proteins of DcCoV UAE-HKU23 and MERS-CoV
4.10. Western Blot Analysis
4.11. Animal Immunization Using Heat-Inactivated DcCoV UAE-HKU23
4.12. Sequencing of Complete RdRp, S, and N Genes of DcCoV UAE-HKU23 Strains
4.13. Phylogenetic Analysis
4.14. Codon Usage Analysis and Genetic Distance of RdRp, S, and N Genes
5. Conclusions
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Peck, K.M.; Burch, C.L.; Heise, M.T.; Baric, R.S. Coronavirus host range expansion and Middle East Respiratory Syndrome coronavirus emergence: Biochemical mechanisms and evolutionary perspectives. Annu. Rev. Virol. 2015, 2, 95–117. [Google Scholar] [CrossRef] [PubMed]
- Lai, M.M.; Cavanagh, D. The molecular biology of coronaviruses. Adv. Virus Res. 1997, 48, 1–100. [Google Scholar] [PubMed]
- Ziebuhr, J. Molecular biology of severe acute respiratory syndrome coronavirus. Curr. Opin. Microbiol. 2004, 7, 412–419. [Google Scholar] [CrossRef] [PubMed]
- Brian, D.A.; Baric, R.S. Coronavirus genome structure and replication. Curr. Top. Microbiol. Immunol. 2005, 287, 1–30. [Google Scholar] [PubMed]
- De Groot, R.J.; Baker, S.C.; Baric, R.; Enjuanes, L.; Gorbalenya, A.E.; Holmes, K.V.; Perlman, S.; Poon, L.; Rottier, P.J.M.; Talbot, P.J.; et al. Family—Coronaviridae. In Virus Taxonomy: Ninth Report of the International Committee on Taxonomy of Viruses, International Union of Microbiological Societies, Virology Division; Adams, M.J., Carstens, E.B., Lefkowitz, E.J., Eds.; Elsevier: San Diego, CA, USA, 2012; pp. 806–828. [Google Scholar]
- Wu, H.Y.; Brian, D.A. Subgenomic messenger RNA amplification in coronaviruses. Proc. Natl. Acad. Sci. USA 2010, 107, 12257–12262. [Google Scholar] [CrossRef] [PubMed]
- Herrewegh, A.A.; Smeenk, I.; Horzinek, M.C.; Rottier, P.J.; de Groot, R.J. Feline coronavirus type II strains 79-1683 and 79-1146 originate from a double recombination between feline coronavirus type I and canine coronavirus. J. Virol. 1998, 72, 4508–4514. [Google Scholar] [PubMed]
- Woo, P.C.; Lau, S.K.; Yip, C.C.; Huang, Y.; Tsoi, H.W.; Chan, K.H.; Yuen, K.Y. Comparative analysis of 22 coronavirus HKU1 genomes reveals a novel genotype and evidence of natural recombination in coronavirus HKU1. J. Virol. 2006, 80, 7136–7145. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bidokhti, M.R.; Traven, M.; Ohlson, A.; Baule, C.; Hakhverdyan, M.; Belak, S.; Liu, L.; Alenius, S. Tracing the transmission of bovine coronavirus infections in cattle herds based on S gene diversity. Vet. J. 2012, 193, 386–390. [Google Scholar] [CrossRef] [PubMed]
- Decaro, N.; Martella, V.; Elia, G.; Campolo, M.; Mari, V.; Desario, C.; Lucente, M.S.; Lorusso, A.; Greco, G.; Corrente, M.; et al. Biological and genetic analysis of a bovine-like coronavirus isolated from water buffalo (Bubalus bubalis) calves. Virology 2008, 370, 213–222. [Google Scholar] [CrossRef] [PubMed]
- Guan, Y.; Zheng, B.J.; He, Y.Q.; Liu, X.L.; Zhuang, Z.X.; Cheung, C.L.; Luo, S.W.; Li, P.H.; Zhang, L.J.; Guan, Y.J.; et al. Isolation and characterization of viruses related to the SARS coronavirus from animals in southern China. Science 2003, 302, 276–278. [Google Scholar] [CrossRef] [PubMed]
- Marra, M.A.; Jones, S.J.; Astell, C.R.; Holt, R.A.; Brooks-Wilson, A.; Butterfield, Y.S.; Khattra, J.; Asano, J.K.; Barber, S.A.; Chan, S.Y.; et al. The Genome sequence of the SARS-associated coronavirus. Science 2003, 300, 1399–1404. [Google Scholar] [CrossRef] [PubMed]
- Rota, P.A.; Oberste, M.S.; Monroe, S.S.; Nix, W.A.; Campagnoli, R.; Icenogle, J.P.; Penaranda, S.; Bankamp, B.; Maher, K.; Chen, M.H.; et al. Characterization of a novel coronavirus associated with severe acute respiratory syndrome. Science 2003, 300, 1394–1399. [Google Scholar] [CrossRef] [PubMed]
- Snijder, E.J.; Bredenbeek, P.J.; Dobbe, J.C.; Thiel, V.; Ziebuhr, J.; Poon, L.L.; Guan, Y.; Rozanov, M.; Spaan, W.J.; Gorbalenya, A.E. Unique and conserved features of genome and proteome of SARS-coronavirus, an early split-off from the coronavirus group 2 lineage. J. Mol. Biol. 2003, 331, 991–1004. [Google Scholar] [CrossRef]
- Woo, P.C.; Lau, S.K.; Tsoi, H.W.; Chan, K.H.; Wong, B.H.; Che, X.Y.; Tam, V.K.; Tam, S.C.; Cheng, V.C.; Hung, I.F.; et al. Relative rates of non-pneumonic SARS coronavirus infection and SARS coronavirus pneumonia. Lancet 2004, 363, 841–845. [Google Scholar] [CrossRef]
- Cheng, V.C.; Lau, S.K.; Woo, P.C.; Yuen, K.Y. Severe acute respiratory syndrome coronavirus as an agent of emerging and reemerging infection. Clin. Microbiol. Rev. 2007, 20, 660–694. [Google Scholar] [CrossRef] [PubMed]
- Fouchier, R.A.; Hartwig, N.G.; Bestebroer, T.M.; Niemeyer, B.; de Jong, J.C.; Simon, J.H.; Osterhaus, A.D. A previously undescribed coronavirus associated with respiratory disease in humans. Proc. Natl. Acad. Sci. USA 2004, 101, 6212–6216. [Google Scholar] [CrossRef] [PubMed]
- Van der Hoek, L.; Pyrc, K.; Jebbink, M.F.; Vermeulen-Oost, W.; Berkhout, R.J.; Wolthers, K.C.; Wertheim-van Dillen, P.M.; Kaandorp, J.; Spaargaren, J.; Berkhout, B. Identification of a new human coronavirus. Nat. Med. 2004, 10, 368–373. [Google Scholar] [CrossRef] [PubMed]
- Vabret, A.; Mourez, T.; Dina, J.; van der Hoek, L.; Gouarin, S.; Petitjean, J.; Brouard, J.; Freymuth, F. Human coronavirus NL63, France. Emerg. Infect. Dis. 2005, 11, 1225–1229. [Google Scholar] [CrossRef] [PubMed]
- Woo, P.C.; Lau, S.K.; Chu, C.M.; Chan, K.H.; Tsoi, H.W.; Huang, Y.; Wong, B.H.; Poon, R.W.; Cai, J.J.; Luk, W.K.; et al. Characterization and complete genome sequence of a novel coronavirus, coronavirus HKU1, from patients with pneumonia. J. Virol. 2005, 79, 884–895. [Google Scholar] [CrossRef] [PubMed]
- Woo, P.C.; Lau, S.K.; Tsoi, H.W.; Huang, Y.; Poon, R.W.; Chu, C.M.; Lee, R.A.; Luk, W.K.; Wong, G.K.; Wong, B.H.; et al. Clinical and molecular epidemiological features of coronavirus HKU1-associated community-acquired pneumonia. J. Infect. Dis. 2005, 192, 1898–1907. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lau, S.K.; Woo, P.C.; Yip, C.C.; Tse, H.; Tsoi, H.W.; Cheng, V.C.; Lee, P.; Tang, B.S.; Cheung, C.H.; Lee, R.A.; et al. Coronavirus HKU1 and other coronavirus infections in Hong Kong. J. Clin. Microbiol. 2006, 44, 2063–2071. [Google Scholar] [CrossRef] [PubMed]
- Lau, S.K.; Woo, P.C.; Li, K.S.; Huang, Y.; Tsoi, H.W.; Wong, B.H.; Wong, S.S.; Leung, S.Y.; Chan, K.H.; Yuen, K.Y. Severe acute respiratory syndrome coronavirus-like virus in Chinese horseshoe bats. Proc. Natl. Acad. Sci. USA 2005, 102, 14040–14045. [Google Scholar] [CrossRef] [PubMed]
- Li, W.; Shi, Z.; Yu, M.; Ren, W.; Smith, C.; Epstein, J.H.; Wang, H.; Crameri, G.; Hu, Z.; Zhang, H.; et al. Bats are natural reservoirs of SARS-like coronaviruses. Science 2005, 310, 676–679. [Google Scholar] [CrossRef] [PubMed]
- Ge, X.Y.; Li, J.L.; Yang, X.L.; Chmura, A.A.; Zhu, G.; Epstein, J.H.; Mazet, J.K.; Hu, B.; Zhang, W.; Peng, C.; et al. Isolation and characterization of a bat SARS-like coronavirus that uses the ACE2 receptor. Nature 2013, 503, 535–538. [Google Scholar] [CrossRef] [PubMed]
- Woo, P.C.; Lau, S.K.; Li, K.S.; Poon, R.W.; Wong, B.H.; Tsoi, H.W.; Yip, B.C.; Huang, Y.; Chan, K.H.; Yuen, K.Y. Molecular diversity of coronaviruses in bats. Virology 2006, 351, 180–187. [Google Scholar] [CrossRef] [PubMed]
- Woo, P.C.; Wang, M.; Lau, S.K.; Xu, H.; Poon, R.W.; Guo, R.; Wong, B.H.; Gao, K.; Tsoi, H.W.; Huang, Y.; et al. Comparative analysis of twelve genomes of three novel group 2c and group 2d coronaviruses reveals unique group and subgroup features. J. Virol. 2007, 81, 1574–1585. [Google Scholar] [CrossRef] [PubMed]
- Lau, S.K.; Woo, P.C.; Li, K.S.; Huang, Y.; Wang, M.; Lam, C.S.; Xu, H.; Guo, R.; Chan, K.H.; Zheng, B.J.; et al. Complete genome sequence of bat coronavirus HKU2 from Chinese horseshoe bats revealed a much smaller spike gene with a different evolutionary lineage from the rest of the genome. Virology 2007, 367, 428–439. [Google Scholar] [CrossRef] [PubMed]
- Woo, P.C.; Lau, S.K.; Lam, C.S.; Lai, K.K.; Huang, Y.; Lee, P.; Luk, G.S.; Dyrting, K.C.; Chan, K.H.; Yuen, K.Y. Comparative analysis of complete genome sequences of three avian coronaviruses reveals a novel group 3c coronavirus. J. Virol. 2009, 83, 908–917. [Google Scholar] [CrossRef] [PubMed]
- Lau, S.K.; Li, K.S.; Huang, Y.; Shek, C.T.; Tse, H.; Wang, M.; Choi, G.K.; Xu, H.; Lam, C.S.; Guo, R.; et al. Ecoepidemiology and complete genome comparison of different strains of severe acute respiratory syndrome-related Rhinolophus bat coronavirus in China reveal bats as a reservoir for acute, self-limiting infection that allows recombination events. J. Virol. 2010, 84, 2808–2819. [Google Scholar] [CrossRef] [PubMed]
- Lau, S.K.; Poon, R.W.; Wong, B.H.; Wang, M.; Huang, Y.; Xu, H.; Guo, R.; Li, K.S.; Gao, K.; Chan, K.H.; et al. Coexistence of different genotypes in the same bat and serological characterization of Rousettus bat coronavirus HKU9 belonging to a novel Betacoronavirus subgroup. J. Virol. 2010, 84, 11385–11394. [Google Scholar] [CrossRef] [PubMed]
- Lau, S.K.; Li, K.S.; Tsang, A.K.; Shek, C.T.; Wang, M.; Choi, G.K.; Guo, R.; Wong, B.H.; Poon, R.W.; Lam, C.S.; et al. Recent transmission of a novel alphacoronavirus, bat coronavirus HKU10, from Leschenault’s rousettes to pomona leaf-nosed bats: First evidence of interspecies transmission of coronavirus between bats of different suborders. J. Virol. 2012, 86, 11906–11918. [Google Scholar] [CrossRef] [PubMed]
- Woo, P.C.; Lau, S.K.; Lam, C.S.; Lau, C.C.; Tsang, A.K.; Lau, J.H.; Bai, R.; Teng, J.L.; Tsang, C.C.; Wang, M.; et al. Discovery of seven novel Mammalian and avian coronaviruses in the genus deltacoronavirus supports bat coronaviruses as the gene source of alphacoronavirus and betacoronavirus and avian coronaviruses as the gene source of gammacoronavirus and deltacoronavirus. J. Virol. 2012, 86, 3995–4008. [Google Scholar] [PubMed]
- Lau, S.K.; Woo, P.C.; Yip, C.C.; Fan, R.Y.; Huang, Y.; Wang, M.; Guo, R.; Lam, C.S.; Tsang, A.K.; Lai, K.K.; et al. Isolation and characterization of a novel Betacoronavirus subgroup A coronavirus, rabbit coronavirus HKU14, from domestic rabbits. J. Virol. 2012, 86, 5481–5496. [Google Scholar] [CrossRef] [PubMed]
- Woo, P.C.; Lau, S.K.; Lam, C.S.; Tsang, A.K.; Hui, S.W.; Fan, R.Y.; Martelli, P.; Yuen, K.Y. Discovery of a novel bottlenose dolphin coronavirus reveals a distinct species of marine mammal coronavirus in gammacoronavirus. J. Virol. 2014, 88, 1318–1331. [Google Scholar] [CrossRef] [PubMed]
- Lau, S.K.; Woo, P.C.; Li, K.S.; Tsang, A.K.; Fan, R.Y.; Luk, H.K.; Cai, J.P.; Chan, K.H.; Zheng, B.J.; Wang, M.; et al. Discovery of a novel coronavirus, China Rattus coronavirus HKU24, from Norway rats supports murine origin of Betacoronavirus 1 with implications on the ancestor of Betacoronavirus lineage A. J. Virol. 2015, 89, 3076–3092. [Google Scholar] [CrossRef] [PubMed]
- Zaki, A.M.; van Boheemen, S.; Bestebroer, T.M.; Osterhaus, A.D.; Fouchier, R.A. Isolation of a novel coronavirus from a man with pneumonia in Saudi Arabia. N. Engl. J. Med. 2012, 367, 1814–1820. [Google Scholar] [CrossRef] [PubMed]
- De Groot, R.J.; Baker, S.C.; Baric, R.S.; Brown, C.S.; Drosten, C.; Enjuanes, L.; Fouchier, R.A.; Galiano, M.; Gorbalenya, A.E.; Memish, Z.A.; et al. Middle East respiratory syndrome coronavirus (MERS-CoV): Announcement of the coronavirus study group. J. Virol. 2013, 87, 7790–7792. [Google Scholar] [CrossRef] [PubMed]
- Lau, S.K.; Li, K.S.; Tsang, A.K.; Lam, C.S.; Ahmed, S.; Chen, H.; Chan, K.H.; Woo, P.C.; Yuen, K.Y. Genetic characterization of betacoronavirus lineage C viruses in bats reveals marked sequence divergence in the Spike protein of pipistrellus bat coronavirus HKU5 in Japanese pipistrelle: Implications for the origin of the novel Middle East respiratory syndrome coronavirus. J. Virol. 2013, 87, 8638–8650. [Google Scholar] [PubMed]
- Abd, E.W.A.; Patel, P.; Heidenreich, D.; Hufert, F.T.; Weidmann, M. Reverse transcription recombinase polymerase amplification assay for the detection of Middle East respiratory syndrome coronavirus. PLoS Curr. 2013, 5. [Google Scholar] [CrossRef]
- Reusken, C.B.; Haagmans, B.L.; Muller, M.A.; Gutierrez, C.; Godeke, G.J.; Meyer, B.; Muth, D.; Raj, V.S.; Vries, L.S.; Corman, V.M.; et al. Middle East respiratory syndrome coronavirus neutralising serum antibodies in dromedary camels: A comparative serological study. Lancet Infect. Dis. 2013, 13, 859–866. [Google Scholar] [CrossRef]
- Perera, R.A.; Wang, P.; Gomaa, M.R.; El-Shesheny, R.; Kandeil, A.; Bagato, O.; Siu, L.Y.; Shehata, M.M.; Kayed, A.S.; Moatasim, Y.; et al. Seroepidemiology for MERS coronavirus using microneutralisation and pseudoparticle virus neutralisation assays reveal a high prevalence of antibody in dromedary camels in Egypt, June 2013. Euro Surveill. 2013, 18. pii=20574. [Google Scholar] [CrossRef] [PubMed]
- Raj, V.S.; Farag, E.A.; Reusken, C.B.; Lamers, M.M.; Pas, S.D.; Voermans, J.; Smits, S.L.; Osterhaus, A.D.; Al-Mawlawi, N.; Al-Romaihi, H.E.; et al. Isolation of MERS coronavirus from a dromedary camel, Qatar, 2014. Emerg. Infect. Dis. 2014, 20, 1339–1342. [Google Scholar] [CrossRef] [PubMed]
- Chu, D.K.; Poon, L.L.; Gomaa, M.M.; Shehata, M.M.; Perera, R.A.; Abu Zeid, D.; El Rifay, A.S.; Siu, L.Y.; Guan, Y.; Webby, R.J.; et al. MERS coronaviruses in dromedary camels, Egypt. Emerg. Infect. Dis. 2014, 20, 1049–1053. [Google Scholar] [CrossRef] [PubMed]
- Hemida, M.G.; Chu, D.K.; Poon, L.L.; Perera, R.A.; Alhammadi, M.A.; Ng, H.Y.; Siu, L.Y.; Guan, Y.; Alnaeem, A.; Peiris, M. MERS coronavirus in dromedary camel herd, Saudi Arabia. Emerg. Infect. Dis. 2014, 20, 1231–1234. [Google Scholar] [CrossRef] [PubMed]
- Alagaili, A.N.; Briese, T.; Mishra, N.; Kapoor, V.; Sameroff, S.C.; Burbelo, P.D.; de Wit, E.; Munster, V.J.; Hensley, L.E.; Zalmout, I.S.; et al. Middle East respiratory syndrome coronavirus infection in dromedary camels in Saudi Arabia. MBio 2014, 5, e00884-14. [Google Scholar] [CrossRef] [PubMed]
- Wernery, U.; Corman, V.M.; Wong, E.Y.; Tsang, A.K.; Muth, D.; Lau, S.K.; Khazanehdari, K.; Zirkel, F.; Ali, M.; Nagy, P.; et al. Acute middle East respiratory syndrome coronavirus infection in livestock Dromedaries, Dubai, 2014. Emerg. Infect. Dis. 2015, 21, 1019–1022. [Google Scholar] [CrossRef] [PubMed]
- Woo, P.C.; Lau, S.K.; Teng, J.L.; Tsang, A.K.; Joseph, M.; Wong, E.Y.; Tang, Y.; Sivakumar, S.; Xie, J.; Bai, R.; et al. New hepatitis E virus genotype in camels, the Middle East. Emerg. Infect. Dis. 2014, 20, 1044–1048. [Google Scholar] [CrossRef] [PubMed]
- Woo, P.C.; Lau, S.K.; Teng, J.L.; Tsang, A.K.; Joseph, M.; Wong, E.Y.; Tang, Y.; Sivakumar, S.; Bai, R.; Wernery, R.; et al. Metagenomic analysis of viromes of dromedary camel fecal samples reveals large number and high diversity of circoviruses and picobirnaviruses. Virology 2014, 471–473, 117–125. [Google Scholar] [CrossRef] [PubMed]
- Woo, P.C.; Lau, S.K.; Wernery, U.; Wong, E.Y.; Tsang, A.K.; Johnson, B.; Yip, C.C.; Lau, C.C.; Sivakumar, S.; Cai, J.P.; et al. Novel betacoronavirus in dromedaries of the Middle East, 2013. Emerg. Infect. Dis. 2014, 20, 560–572. [Google Scholar] [CrossRef] [PubMed]
- Sawicki, S.G.; Sawicki, D.L.; Siddell, S.G. A contemporary view of coronavirus transcription. J. Virol. 2007, 81, 20–29. [Google Scholar] [CrossRef] [PubMed]
- Schaad, M.C.; Chen, W.; Peel, S.A.; Baric, R.S. Studies into the mechanism for MHV transcription. Adv. Exp. Med. Biol. 1993, 342, 85–90. [Google Scholar] [PubMed]
- Jeong, Y.S.; Repass, J.F.; Kim, Y.N.; Hwang, S.M.; Makino, S. Coronavirus transcription mediated by sequences flanking the transcription consensus sequence. Virology 1996, 217, 311–322. [Google Scholar] [CrossRef] [PubMed]
- Lau, S.K.; Lee, P.; Tsang, A.K.; Yip, C.C.; Tse, H.; Lee, R.A.; So, L.Y.; Lau, Y.L.; Chan, K.H.; Woo, P.C.; et al. Molecular epidemiology of human coronavirus OC43 reveals evolution of different genotypes over time and recent emergence of a novel genotype due to natural recombination. J. Virol. 2011, 85, 11325–11337. [Google Scholar] [CrossRef] [PubMed]
- Wu, H.Y.; Ozdarendeli, A.; Brian, D.A. Bovine coronavirus 5′-proximal genomic acceptor hotspot for discontinuous transcription is 65 nucleotides wide. J. Virol. 2006, 80, 2183–2193. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Guy, J.S.; Snijder, E.J.; Denniston, D.A.; Timoney, P.J.; Balasuriya, U.B. Genomic characterization of equine coronavirus. Virology 2007, 369, 92–104. [Google Scholar] [CrossRef] [PubMed]
- Jin, L.; Cebra, C.K.; Baker, R.J.; Mattson, D.E.; Cohen, S.A.; Alvarado, D.E.; Rohrmann, G.F. Analysis of the genome sequence of an alpaca coronavirus. Virology 2007, 365, 198–203. [Google Scholar] [CrossRef] [PubMed]
- Amer, H.M.; Abd El Wahed, A.; Shalaby, M.A.; Almajhdi, F.N.; Hufert, F.T.; Weidmann, M. A new approach for diagnosis of bovine coronavirus using a reverse transcription recombinase polymerase amplification assay. J. Virol. Methods 2013, 193, 337–340. [Google Scholar] [CrossRef] [PubMed]
- Miszczak, F.; Tesson, V.; Kin, N.; Dina, J.; Balasuriya, U.B.; Pronost, S.; Vabret, A. First detection of equine coronavirus (ECoV) in Europe. Vet. Microbiol. 2014, 171, 206–209. [Google Scholar] [CrossRef] [PubMed]
- Vabret, A.; Dina, J.; Mourez, T.; Gouarin, S.; Petitjean, J.; van der Werf, S.; Freymuth, F. Inter- and intra-variant genetic heterogeneity of human coronavirus OC43 strains in France. J. Gen. Virol. 2006, 87, 3349–3353. [Google Scholar] [CrossRef] [PubMed]
- Alekseev, K.P.; Vlasova, A.N.; Jung, K.; Hasoksuz, M.; Zhang, X.; Halpin, R.; Wang, S.; Ghedin, E.; Spiro, D.; Saif, L.J. Bovine-like coronaviruses isolated from four species of captive wild ruminants are homologous to bovine coronaviruses, based on complete genomic sequences. J. Virol. 2008, 82, 12422–12431. [Google Scholar] [CrossRef] [PubMed]
- Chung, J.Y.; Kim, H.R.; Bae, Y.C.; Lee, O.S.; Oem, J.K. Detection and characterization of bovine-like coronaviruses from four species of zoo ruminants. Vet. Microbiol. 2011, 148, 396–401. [Google Scholar] [CrossRef] [PubMed]
- Hasoksuz, M.; Alekseev, K.; Vlasova, A.; Zhang, X.; Spiro, D.; Halpin, R.; Wang, S.; Ghedin, E.; Saif, L.J. Biologic, antigenic, and full-length genomic characterization of a bovine-like coronavirus isolated from a giraffe. J. Virol. 2007, 81, 4981–4990. [Google Scholar] [CrossRef] [PubMed]
- Decaro, N.; Cirone, F.; Mari, V.; Nava, D.; Tinelli, A.; Elia, G.; Di Sarno, A.; Martella, V.; Colaianni, M.L.; Aprea, G.; et al. Characterisation of bubaline coronavirus strains associated with gastroenteritis in water buffalo (Bubalus bubalis) calves. Vet. Microbiol. 2010, 145, 245–251. [Google Scholar] [CrossRef] [PubMed]
- Li, I.W.; Chan, K.H.; To, K.W.; Wong, S.S.; Ho, P.L.; Lau, S.K.; Woo, P.C.; Tsoi, H.W.; Chan, J.F.; Cheng, V.C.; et al. Differential susceptibility of different cell lines to swine-origin influenza A H1N1, seasonal human influenza A H1N1, and avian influenza A H5N1 viruses. J. Clin. Virol. 2009, 46, 325–330. [Google Scholar] [CrossRef] [PubMed]
- Kuiken, T.; Fouchier, R.A.; Schutten, M.; Rimmelzwaan, G.F.; van Amerongen, G.; van Riel, D.; Laman, J.D.; de Jong, T.; van Doornum, G.; Lim, W.; et al. Newly discovered coronavirus as the primary cause of severe acute respiratory syndrome. Lancet 2003, 362, 263–270. [Google Scholar] [CrossRef]
- Peiris, J.S.; Lai, S.T.; Poon, L.L.; Guan, Y.; Yam, L.Y.; Lim, W.; Nicholls, J.; Yee, W.K.; Yan, W.W.; Cheung, M.T.; et al. Coronavirus as a possible cause of severe acute respiratory syndrome. Lancet 2003, 361, 1319–1325. [Google Scholar] [CrossRef]
- Pyrc, K.; Jebbink, M.F.; Berkhout, B.; van der Hoek, L. Genome structure and transcriptional regulation of human coronavirus NL63. Virol. J. 2004, 1. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chan, K.H.; Chan, J.F.; Tse, H.; Chen, H.; Lau, C.C.; Cai, J.P.; Tsang, A.K.; Xiao, X.; To, K.K.; Lau, S.K.; et al. Cross-reactive antibodies in convalescent SARS patients’ sera against the emerging novel human coronavirus EMC (2012) by both immunofluorescent and neutralizing antibody tests. J. Infect. 2013, 67, 130–140. [Google Scholar] [CrossRef] [PubMed]
- Simmonds, P. SSE: A nucleotide and amino acid sequence analysis platform. BMC Res. Notes 2012, 5. [Google Scholar] [CrossRef] [PubMed]
- The R Foundation. The R Project for Statistical Computing. Available online: http://www.r-project.org (accessed on 24 April 2014).
Antibody Titer | Number (%) of Samples |
---|---|
Immunofluorescence Antibody Test | |
<20 | 1 (1.7) |
80 | 21 (35.6) |
320 | 23 (39.0) |
1280 | 13 (22.0) |
5120 | 1 (1.7) |
Neutralization Antibody Test | |
10 | 2 (3.4) |
20 | 4 (6.8) |
40 | 6 (10.2) |
80 | 18 (30.5) |
160 | 11 (18.6) |
320 | 9 (15.3) |
640 | 5 (8.5) |
1280 | 2 (3.4) |
2560 | 2 (3.4) |
Primer | Sequence (5′-3′) | Use |
---|---|---|
LPW25800 | GATTGTGAGCGATTTGCGTGC | Forward primer for all sg mRNAs PCR |
LPW18463 | GTAAACCTTTATAATTTAACACA | Reverse primer for mRNA (NS2) PCR |
LPW25801 | AATCGGTAAAGTGAAAACTCC | Reverse primer for mRNA (HE) PCR |
LPW25802 | CCACAATGTACTCAACAATAAAG | Reverse primer for mRNA (S) PCR |
LPW25803 | TAGCGAATGCTGTAAAACCAG | Reverse primer for mRNA (NS5) PCR |
LPW25804 | CTCATAAAACTGCCTACCTCT | Reverse primer for mRNA (E) PCR |
LPW18468 | CCAAGATACACATTATTCAACG | Reverse primer for mRNA (M) PCR |
LPW18469 | GAGTAATTCCAGAGAACCAAGA | Reverse primer for mRNA (N) PCR |
© 2016 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC-BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Woo, P.C.Y.; Lau, S.K.P.; Fan, R.Y.Y.; Lau, C.C.Y.; Wong, E.Y.M.; Joseph, S.; Tsang, A.K.L.; Wernery, R.; Yip, C.C.Y.; Tsang, C.-C.; et al. Isolation and Characterization of Dromedary Camel Coronavirus UAE-HKU23 from Dromedaries of the Middle East: Minimal Serological Cross-Reactivity between MERS Coronavirus and Dromedary Camel Coronavirus UAE-HKU23. Int. J. Mol. Sci. 2016, 17, 691. https://doi.org/10.3390/ijms17050691
Woo PCY, Lau SKP, Fan RYY, Lau CCY, Wong EYM, Joseph S, Tsang AKL, Wernery R, Yip CCY, Tsang C-C, et al. Isolation and Characterization of Dromedary Camel Coronavirus UAE-HKU23 from Dromedaries of the Middle East: Minimal Serological Cross-Reactivity between MERS Coronavirus and Dromedary Camel Coronavirus UAE-HKU23. International Journal of Molecular Sciences. 2016; 17(5):691. https://doi.org/10.3390/ijms17050691
Chicago/Turabian StyleWoo, Patrick C. Y., Susanna K. P. Lau, Rachel Y. Y. Fan, Candy C. Y. Lau, Emily Y. M. Wong, Sunitha Joseph, Alan K. L. Tsang, Renate Wernery, Cyril C. Y. Yip, Chi-Ching Tsang, and et al. 2016. "Isolation and Characterization of Dromedary Camel Coronavirus UAE-HKU23 from Dromedaries of the Middle East: Minimal Serological Cross-Reactivity between MERS Coronavirus and Dromedary Camel Coronavirus UAE-HKU23" International Journal of Molecular Sciences 17, no. 5: 691. https://doi.org/10.3390/ijms17050691
APA StyleWoo, P. C. Y., Lau, S. K. P., Fan, R. Y. Y., Lau, C. C. Y., Wong, E. Y. M., Joseph, S., Tsang, A. K. L., Wernery, R., Yip, C. C. Y., Tsang, C.-C., Wernery, U., & Yuen, K.-Y. (2016). Isolation and Characterization of Dromedary Camel Coronavirus UAE-HKU23 from Dromedaries of the Middle East: Minimal Serological Cross-Reactivity between MERS Coronavirus and Dromedary Camel Coronavirus UAE-HKU23. International Journal of Molecular Sciences, 17(5), 691. https://doi.org/10.3390/ijms17050691