Molecular Cloning and Expression Analysis of Eight PgWRKY Genes in Panax ginseng Responsive to Salt and Hormones
Abstract
:1. Introduction
2. Results
2.1. Cloning and Phylogeny
2.2. Expression Pattern of PgWRKY Genes in Different Tissues
2.3. Expression Analysis of PgWRKY Genes under Different Treatments
3. Discussion
4. Materials and Methods
4.1. Plant Materials
4.2. Cloning of PgWRKYs
4.3. Salts and Hormone Treatments
4.4. Expression Analysis
4.5. Statistical Analysis
5. Conclusions
Supplementary Materials
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Zhang, Y.J.; Wang, L.J. The WRKY transcription factor superfamily: Its origin in eukaryotes and expansion in plants. BMC Evol. Biol. 2005, 5, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Pan, Y.J.; Cho, C.C.; Kao, Y.Y.; Sun, C.H. A novel WRKY-like protein involved in transcriptional activation of cyst wall protein genes in Giardia lamblia. J. Biol. Chem. 2009, 284, 17975–17988. [Google Scholar] [CrossRef] [PubMed]
- Rushton, P.J.; Somssich, I.E.; Ringler, P.; Shen, Q.X.J. WRKY transcription factors. Trends Plant Sci. 2010, 15, 247–258. [Google Scholar] [CrossRef] [PubMed]
- Ülker, B.; Somssich, I.E. WRKY transcription factors: From DNA binding towards biological function. Curr. Opin. Plant Biol. 2004, 7, 491–498. [Google Scholar] [CrossRef] [PubMed]
- Eulgem, T.; Rushton, P.J.; Robatzek, S.; Somssich, I.E. The WRKY superfamily of plant transcription factors. Trends Plant Sci. 2000, 5, 199–206. [Google Scholar] [CrossRef]
- Ross, C.A.; Liu, Y.; Shen, Q.X.J. The WRKY gene family in rice (Oryza sativa). J. Integr. Plant Biol. 2007, 49, 827–842. [Google Scholar] [CrossRef]
- Xie, Z.; Ruas, P.; Shen, Q.X.J. Regulatory networks of the phytohormone abscisic acid. Plant Horm. 2005, 72, 235–269. [Google Scholar]
- Nuruzzaman, M.; Cao, H.Z.; Xiu, H.; Luo, T.; Li, J.; Chen, X.; Luo, J.; Luo, Z.Y. Transcriptomics-based identification of WRKY genes and molecular characterization of a salt and hormone-responsive PgWRKY1 gene in Panax ginseng. Acta Biochim. Biophys. Sin. 2015. [Google Scholar] [CrossRef]
- Schluttenhofer, C.; Pattanaik, S.; Patra, B.; Yuan, L. Analyses of Catharanthus roseus and Arabidopsis thaliana WRKY transcription factors reveal involvement in jasmonate signaling. BMC Genom. 2014, 15, 502. [Google Scholar] [CrossRef] [PubMed]
- Ramamoorthy, R.; Jiang, S.Y.; Kumar, N.; Venkatesh, P.N.; Ramachandran, S. A comprehensive transcriptional profiling of the WRKY gene family in rice under various abiotic and phytohormone treatments. Plant Cell Physiol. 2008, 49, 865–879. [Google Scholar] [CrossRef] [PubMed]
- Dong, J.X.; Chen, C.H.; Chen, Z.X. Expression profiles of the Arabidopsis WRKY gene superfamily during plant defense response. Plant Mol. Biol. 2003, 51, 21–37. [Google Scholar] [CrossRef] [PubMed]
- Johnson, C.S.; Kolevski, B.; Smyth, D.R. TRANSPARENT TESTA GLABRA2, a trichome and seed coat development gene of Arabidopsis, encodes a WRKY transcription factor. Plant Cell 2002, 14, 1359–1375. [Google Scholar] [CrossRef] [PubMed]
- Lagace, M.; Matton, D.P. Characterization of a WRKY transcription factor expressed in late torpedo-stage embryos of Solanum chacoense. Planta 2004, 219, 185–189. [Google Scholar] [CrossRef] [PubMed]
- Miao, Y.; Smykowski, A.; Zentgraf, U. A novel upstream regulator of WRKY53 transcription during leaf senescence in Arabidopsis thaliana. Plant Biol. 2008, 10, 110–120. [Google Scholar] [CrossRef] [PubMed]
- Kato, N.; Dubouzet, E.; Kokabu, Y.; Yoshida, S.; Taniguchi, Y.; Dubouzet, J.G.; Yazaki, K.; Sato, F. Identification of a WRKY protein as a transcriptional regulator of benzylisoquinoline alkaloid biosynthesis in Coptis japonica. Plant Cell Physiol. 2007, 48, 8–18. [Google Scholar] [CrossRef] [PubMed]
- Luo, M.; Dennis, E.S.; Berger, F.; Peacock, W.J.; Chaudhury, A. MINISEED3 (MINI3), a WRKY family gene, and HAIKU2 (IKU2), a leucine-rich repeat (LRR) KINASE gene, are regulators of seed size in Arabidopsis. Proc. Natl. Acad. Sci. USA 2005, 102, 17531–17536. [Google Scholar] [CrossRef] [PubMed]
- Wei, S. Methyl jasmonic acid induced expression pattern of terpenoid indole alkaloid pathway genes in Catharanthus roseus seedlings. Plant Growth Regul. 2010, 61, 243–251. [Google Scholar] [CrossRef]
- Thanh, N.T.; Murthy, H.N.; Yu, K.W.; Hahn, E.J.; Paek, K.Y. Methyl jasmonate elicitation enhanced synthesis of ginsenoside by cell suspension cultures of Panax ginseng in 5-I balloon type bubble bioreactors. Appl. Microbiol. Biotechnol. 2005, 67, 197–201. [Google Scholar] [CrossRef] [PubMed]
- Sun, Y.Z.; Niu, Y.Y.; Xu, J.; Li, Y.; Luo, H.M.; Zhu, Y.J.; Liu, M.Z.; Wu, Q.; Song, J.Y.; Sun, C.; et al. Discovery of WRKY transcription factors through transcriptome analysis and characterization of a novel methyl jasmonate-inducible PqWRKY1 gene from Panax quinquefolius. Plant Cell Tissue Organ Cult. 2013, 114, 269–277. [Google Scholar] [CrossRef]
- Nuruzzaman, M.; Zhang, R.; Cao, H.Z.; Luo, Z.Y. Plant pleiotropic drug resistance transporters: Transport mechanism, gene expression, and function. J. Integr. Plant Biol. 2014, 56, 729–740. [Google Scholar] [CrossRef] [PubMed]
- Kim, K.H.; Choi, I.; Lee, Y.W.; Cho, C.K.; Yoo, H.S.; Lee, S.B.; Choi, S.H.; Kwon, K.R.; Jang, J.H. Target genes involved in antiproliferative effect of modified ginseng extracts in lung cancer A549 cells. Acta Biochim. Biophys. Sin. 2014, 46, 441–449. [Google Scholar] [CrossRef] [PubMed]
- Yang, N.Q.; Chen, P.S.; Tao, Z.W.; Zhou, N.T.; Gong, X.X.; Xu, Z.H.; Zhang, M.; Zhang, D.G.; Chen, B.; Tao, Z.X.; et al. Beneficial effects of ginsenoside-Rg1 on ischemia-induced angiogenesis in diabetic mice. Acta Biochim. Biophys. Sin. 2012, 44, 999–1005. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Z.Y.; Du, G.J.; Wang, C.Z.; Wen, X.D.; Calway, T.; Li, Z.J.; He, T.C.; Du, W.; Bissonnette, M.; Musch, M.W.; et al. Compound K, a ginsenoside metabolite, inhibits colon cancer growth via multiple pathways including p53-p21 interactions. Int. J. Mol. Sci. 2013, 14, 2980–2995. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.; Lee, M.S.; Kim, C.T.; Kim, I.H.; Kim, Y. Ginsenoside Rg3 reduces lipid accumulation with AMP-activated protein Kinase (AMPK) activation in HepG2 cells. Int. J. Mol. Sci. 2012, 13, 5729–5739. [Google Scholar] [CrossRef] [PubMed]
- Zhang, R.; Huang, J.J.; Zhu, J.; Xie, X.L.; Tang, Q.; Chen, X.H.; Luo, J.; Luo, Z.Y. Isolation and characterization of a novel PDR-type ABC transporter gene PgPDR3 from Panax ginseng C.A. Meyer induced by methyl jasmonate. Mol. Biol. Rep. 2013, 40, 6195–6204. [Google Scholar] [CrossRef] [PubMed]
- Zhang, R.; Zhu, J.; Cao, H.Z.; An, Y.R.; Huang, J.J.; Chen, X.H.; Nuruzzaman, M.; Afrin, S.; Luo, Z.Y. Molecular cloning and expression analysis of PDR1-like gene in ginseng subjected to salt and cold stresses or hormonal treatment. Plant Physiol. Biochem. 2013, 71, 203–211. [Google Scholar] [CrossRef] [PubMed]
- Cao, H.Z.; Nuruzzaman, M.; Xiu, H.; Huang, J.; Wu, K.; Chen, X.; Li, J.; Wang, L.; Jeong, J.H.; Park, S.J.; et al. Transcriptome analysis of methyl jasmonate-elicited Panax ginseng adventitious roots to discover putative ginsenoside biosynthesis and transport genes. Int. J. Mol. Sci. 2015, 16, 3035–3057. [Google Scholar] [CrossRef] [PubMed]
- Suttipanta, N.; Pattanaik, S.; Kulshrestha, M.; Patra, B.; Singh, S.K.; Yuan, L. The transcription factor CrWRKY1 positively regulates the terpenoid indole alkaloid biosynthesis in Catharanthus roseus. Plant Physiol. 2011, 157, 2081–2093. [Google Scholar] [CrossRef] [PubMed]
- Peng, X.X.; Tang, X.K.; Zhou, P.L.; Hu, Y.J.; Deng, X.B.; He, Y.; Wang, H.H. Isolation and expression patterns of rice WRKY82 transcription factor gene responsive to both biotic and abiotic stresses. Agric. Sci. China 2011, 10, 893–901. [Google Scholar] [CrossRef]
- Chen, H.; Lai, Z.B.; Shi, J.W.; Xiao, Y.; Chen, Z.X.; Xu, X.P. Roles of Arabidopsis WRKY18, WRKY40 and WRKY60 transcription factors in plant responses to abscisic acid and abiotic stress. BMC Plant Biol. 2010, 10, 281. [Google Scholar] [CrossRef] [PubMed]
- Cheong, Y.H.; Chang, H.S.; Gupta, R.; Wang, X.; Zhu, T.; Luan, S. Transcriptional profiling reveals novel interactions between wounding, pathogen, abiotic stress, and hormonal responses in Arabidopsis. Plant Physiol. 2002, 129, 661–677. [Google Scholar] [CrossRef] [PubMed]
- Song, Y.; Al, C.; Jing, S.; Yu, D. Research progress on functional analysis of Rice WRKY genes. Rice Sci. 2010, 17, 60–72. [Google Scholar] [CrossRef]
- Ma, D.M.; Pu, G.B.; Lei, C.Y.; Ma, L.Q.; Wang, H.H.; Guo, Y.W.; Chen, J.L.; Du, Z.G.; Wang, H.; Li, G.F.; et al. Isolation and characterization of AaWRKY1, an Artemisia annua transcription factor that regulates the Amorpha-4,11-diene synthase gene, a key gene of artemisinin biosynthesis. Plant Cell Physiol. 2009, 50, 2146–2161. [Google Scholar] [CrossRef] [PubMed]
- Hara, K.; Yagi, M.; Kusano, T.; Sano, H. Rapid systemic accumulation of transcripts encoding a tobacco WRKY transcription factor upon wounding. Mol. Gen. Genet. 2000, 263, 30–37. [Google Scholar] [CrossRef] [PubMed]
- Xie, Z.; Zhang, Z.L.; Zou, X.L.; Yang, G.X.; Komatsu, S.; Shen, Q.X.J. Interactions of two abscisic-acid induced WRKY genes in repressing gibberellin signaling in aleurone cells. Plant J. 2006, 46, 231–242. [Google Scholar] [CrossRef] [PubMed]
- Xie, D.X.; Feys, B.F.; James, S.; Nieto-Rostro, M.; Turner, J.G. COI1: An Arabidopsis gene required for jasmonate-regulated defense and fertility. Science 1998, 280, 1091–1094. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; Bai, X.; Wang, X.; Chu, C. OsWRKY71, a rice transcription factor, is involved in rice defense response. J. Plant Physiol. 2007, 164, 969–979. [Google Scholar] [CrossRef] [PubMed]
- Kim, Y.S.; Hahn, E.J.; Murthy, H.N.; Paek, K.Y. Adventitious root growth and ginsenoside accumulation in Panax ginseng cultures as affected by methyl jasmonate. Biotechnol. Lett. 2004, 26, 1619–1622. [Google Scholar] [CrossRef] [PubMed]
- Qiu, D.Y.; Xiao, J.; Ding, X.H.; Xiong, M.; Cai, M.; Cao, C.L.; Li, X.H.; Xu, C.G.; Wang, S.P. OsWRKY13 mediates rice disease resistance by regulating defense-related genes in salicylate- and jasmonate-dependent signaling. Mol. Plant Microbe Interact. 2007, 20, 492–499. [Google Scholar] [CrossRef] [PubMed]
- Pandey, S.P.; Roccaro, M.; Schon, M.; Logemann, E.; Somssich, I.E. Transcriptional reprogramming regulated by WRKY18 and WRKY40 facilitates powdery mildew infection of Arabidopsis. Plant J. 2010, 64, 912–923. [Google Scholar] [CrossRef] [PubMed]
- Zou, X.L.; Shen, Q.J.X.; Neuman, D. An ABA inducible WRKY gene integrates responses of creosote bush (Larrea tridentata) to elevated CO2 and abiotic stresses. Plant Sci. 2007, 172, 997–1004. [Google Scholar] [CrossRef]
- Kalde, M.; Barth, M.; Somssich, I.E.; Lippok, B. Members of the Arabidopsis WRKY group III transcription factors are part of different plant defense signaling pathways. Mol. Plant Microbe Interact. 2003, 16, 295–305. [Google Scholar] [CrossRef] [PubMed]
- Tamura, K.; Dudley, J.; Nei, M.; Kumar, S. MEGA4: Molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol. Biol. Evol. 2007, 24, 1596–1599. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−∆∆Ct method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
Gene | Group | MeJA | SA | ABA | NaCl |
---|---|---|---|---|---|
PgWRKY2 | Group II-d | D | ** | * | ** |
PgWRKY3 | Group II-d | D | D | • | ** |
PgWRKY4 | Group II-d | D | ** | ** | ** |
PgWRKY5 | Group II-d | D | D | ** | - |
PgWRKY6 | Group II-e | D | ** | D | ** |
PgWRKY7 | Group II-c | D | • | D | • |
PgWRKY8 | Group II-e | ** | • | ** | ** |
PgWRKY9 | Group II-e | ** | • | ** | ** |
Primer Name | Product Length (bp) | Primer Sequence (5′ to 3′) |
---|---|---|
PgWRKY2-F | 1261 | TCTTTTGGGTGTGTGAAT |
PgWRKY2-R | TTTGGCGTTTGTATGGTA | |
PgWRKY3-F | 1196 | CTTTGCTTTTCCTTAGTTG |
PgWRKY3-R | ATCATTATCTCTCTCCTTGG | |
PgWRKY4-F | 1233 | CTTTGCTTTTCCTTAGTTG |
PgWRKY4-R | AACAAACATTTCCAACCG | |
PgWRKY5-F | 1259 | TCTTTTGGGTGTGTGAAT |
PgWRKY5-R | TGGCGTTTGTATGGTAAT | |
PgWRKY6-F | 890 | CTTACCAGCCCTCTCCG |
PgWRKY6-R | ATACTTTTGTAAGGAGGACTA | |
PgWRKY7-F | 700 | AAACGCTAAAACCCAAGA |
PgWRKY7-R | ATTTTCTCTTGCTGACTTCT | |
PgWRKY8-F | 1071 | TGTGTGGGTTTGTCGTCT |
PgWRKY8-R | CGCTACTATTAAATCTTGGC | |
PgWRKY9-F | 987 | TCTCTCCTCCATAACAACT |
PgWRKY9-R | AAAAAAAGACAAATCCCC |
Primer Name | Product Length (bp) | Primer Sequence (5′ to 3′) |
---|---|---|
PgWRKY2-F | 115 | TTTATCTCCTCGTTGAGTGTCG |
PgWRKY2-R | ACCTTCGTTTGTGCTGGTATG | |
PgWRKY3-F | 110 | CGGAAACCCAGACTCACG |
PgWRKY3-R | TCGGGACCCATTAGACATCA | |
PgWRKY4-F | 134 | CACCAACAGCATCAACAGCG |
PgWRKY4-R | ATTCGGGACCCATTAGACATCA | |
PgWRKY5-F | 147 | GGAGCAATAGTGGCATCAACCTG |
PgWRKY5-R | GAGTCGCACCAATTAAATGGAAAG | |
PgWRKY6-F | 84 | CCATTCCCGTCAAGTTTCCAC |
PgWRKY6-R | CGGCAAAGTCTATGTTGTCAGG | |
PgWRKY7-F | 169 | CGACATTATCTTCCTTCAACTTTA |
PgWRKY7-R | ACTCGCATTTGGGACGGC | |
PgWRKY8-F | 127 | ATGGATAACTCTCCCTCCCCTA |
PgWRKY8-R | CATTCTCTTCAATCTTCACTGC | |
PgWRKY9-F | 118 | GCAGAAAAGAGTGGTGTCCG |
PgWRKY9-R | AGGCTTTTGACCATACTTTC | |
Pgβ-Actin-F | 176 | GCGGTTGAGGTGGTGGGT |
Pgβ-Actin-R | GTCCTACTAACAAGGCAGAG |
© 2016 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons by Attribution (CC-BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xiu, H.; Nuruzzaman, M.; Guo, X.; Cao, H.; Huang, J.; Chen, X.; Wu, K.; Zhang, R.; Huang, Y.; Luo, J.; et al. Molecular Cloning and Expression Analysis of Eight PgWRKY Genes in Panax ginseng Responsive to Salt and Hormones. Int. J. Mol. Sci. 2016, 17, 319. https://doi.org/10.3390/ijms17030319
Xiu H, Nuruzzaman M, Guo X, Cao H, Huang J, Chen X, Wu K, Zhang R, Huang Y, Luo J, et al. Molecular Cloning and Expression Analysis of Eight PgWRKY Genes in Panax ginseng Responsive to Salt and Hormones. International Journal of Molecular Sciences. 2016; 17(3):319. https://doi.org/10.3390/ijms17030319
Chicago/Turabian StyleXiu, Hao, Mohammed Nuruzzaman, Xiangqian Guo, Hongzhe Cao, Jingjia Huang, Xianghui Chen, Kunlu Wu, Ru Zhang, Yuzhao Huang, Junli Luo, and et al. 2016. "Molecular Cloning and Expression Analysis of Eight PgWRKY Genes in Panax ginseng Responsive to Salt and Hormones" International Journal of Molecular Sciences 17, no. 3: 319. https://doi.org/10.3390/ijms17030319
APA StyleXiu, H., Nuruzzaman, M., Guo, X., Cao, H., Huang, J., Chen, X., Wu, K., Zhang, R., Huang, Y., Luo, J., & Luo, Z. (2016). Molecular Cloning and Expression Analysis of Eight PgWRKY Genes in Panax ginseng Responsive to Salt and Hormones. International Journal of Molecular Sciences, 17(3), 319. https://doi.org/10.3390/ijms17030319