Next Article in Journal
Local Anesthetic-Induced Neurotoxicity
Next Article in Special Issue
Changes in Air CO2 Concentration Differentially Alter Transcript Levels of NtAQP1 and NtPIP2;1 Aquaporin Genes in Tobacco Leaves
Previous Article in Journal
From Olive Fruits to Olive Oil: Phenolic Compound Transfer in Six Different Olive Cultivars Grown under the Same Agronomical Conditions
Previous Article in Special Issue
Physiological Investigation and Transcriptome Analysis of Polyethylene Glycol (PEG)-Induced Dehydration Stress in Cassava
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Molecular Cloning and Expression Analysis of Eight PgWRKY Genes in Panax ginseng Responsive to Salt and Hormones

Molecular Biology Research Center, State Key Laboratory of Medical Genetics, School of Life Sciences, Central South University, Changsha 410078, China
*
Author to whom correspondence should be addressed.
These authors contributed equally to this work.
Int. J. Mol. Sci. 2016, 17(3), 319; https://doi.org/10.3390/ijms17030319
Submission received: 26 December 2015 / Revised: 3 February 2016 / Accepted: 22 February 2016 / Published: 4 March 2016
(This article belongs to the Special Issue Gene–Environment Interactions)

Abstract

:
Despite the importance of WRKY genes in plant physiological processes, little is known about their roles in Panax ginseng C.A. Meyer. Forty-eight unigenes on this species were previously reported as WRKY transcripts using the next-generation sequencing (NGS) technology. Subsequently, one gene that encodes PgWRKY1 protein belonging to subgroup II-d was cloned and functionally characterized. In this study, eight WRKY genes from the NGS-based transcriptome sequencing dataset designated as PgWRKY2-9 have been cloned and characterized. The genes encoding WRKY proteins were assigned to WRKY Group II (one subgroup II-c, four subgroup II-d, and three subgroup II-e) based on phylogenetic analysis. The cDNAs of the cloned PgWRKYs encode putative proteins ranging from 194 to 358 amino acid residues, each of which includes one WRKYGQK sequence motif and one C2H2-type zinc-finger motif. Quantitative real-time PCR (qRT-PCR) analysis demonstrated that the eight analyzed PgWRKY genes were expressed at different levels in various organs including leaves, roots, adventitious roots, stems, and seeds. Importantly, the transcription responses of these PgWRKYs to methyl jasmonate (MeJA) showed that PgWRKY2, PgWRKY3, PgWRKY4, PgWRKY5, PgWRKY6, and PgWRKY7 were downregulated by MeJA treatment, while PgWRKY8 and PgWRKY9 were upregulated to varying degrees. Moreover, the PgWRKY genes increased or decreased by salicylic acid (SA), abscisic acid (ABA), and NaCl treatments. The results suggest that the PgWRKYs may be multiple stress–inducible genes responding to both salt and hormones.

Graphical Abstract

1. Introduction

WRKY transcription factors (TFs) are confined in plant kingdom and are essential for gene expression [1]. However, WRKY-like proteins were also reported in non-plant species such as Giardia lamblia, a primitive eukaryote, Chlamydomonas reinhardtii, a unicellular green alga, and Dictyostelium discoideum, a smile mold closely associated with the lineage of animals and fungi [2,3]. The name of “WRKY” was derived from the highly conserved WRKY domain region, a 60-amino-acid stretch containing one conserved WRKYGQK sequence motif at the N-terminal portion followed by one of the two types of zinc-finger motifs, the Cys2His2 or Cys2HisCys, at the C-terminal region. Both motifs of the domain exhibit high binding affinity to the W-box in the promoter of the target gene to modulate the rate of transcription [4,5]. All the known WRKY proteins are structurally divided into three distinct groups (Groups I, II, and III) on the basis of the number of WRKY domains and the pattern of the zinc-finger motif. Group I WRKY proteins typically carry two WRKY domains and a C2H2-type zinc-finger motif, where the C-terminal WRKY domain is considered to be active in DNA binding. Group II WRKY proteins consist of a single WRKY domain and a same type of zinc-finger motif such as in group I. They are further divided into five subgroups, a–e (II-a, II-b, II-c, II-d, and II-e), according to the phylogenetic analysis of the WRKY domains. Group III WRKY TFs also contain a single WRKY domain but differ from Group I and II in their altered C2HC-type of zinc-finger motif [5,6]. Minor variations in the WRKYGQK sequence motif such as WRKYGEK, WRKYGKK, WRKYGSK, and WRKYDQK were also reported [7,8,9].
The WRKY family was widely studied in Arabidopsis thaliana and Oryza sativa for years, where many were related to phytohormones, and abiotic and biotic stresses [10,11]. In addition, several WRKY members of this family were found to have regulatory functions in many plant developmental processes such as trichome and seed coat initiation, germination, seed dormancy, leaf senescence, and secondary metabolism [12,13,14,15,16]. A principal elicitor of triterpene ginsenoside biosynthesis in Panax species and natural product biosynthesis in a number of medicinal plants is MeJA, which plays a pivotal role in plant defense signaling in response to biotic stresses [17,18]. Recently, over-expression of MeJA-responsive PqWRKY1 in Arabidopsis has been shown to enhance biotic and abiotic stress tolerance, in addition to the gene expression related to ginsenoside biosynthesis [19]. More recently, a PgWRKY1 gene in P. ginseng has been identified responding to a salt (NaCl) and various hormones (MeJA, SA, and ABA) [8].
Ginseng (Panax ginseng C.A. Meyer), known as the king of herbs, has numerous pharmaceutical effects associated with several types of diseases such as obesity, cancer, stress, diabetes, cardiovascular, and aging-related diseases [20,21,22,23,24]. Triterpene ginsenoside is the main pharmacologically active compound in P. ginseng affecting the value of the herb [25,26,27]. Although WRKY genes are important in plant growth and development, only two WRKY genes (PqWRKY1 and PgWRKY1) from different Panax species have been characterized to date [8,19]. In our lab, the study was initiated with the objective of transcriptome-wide identification of WRKY unigenes, where one (PgWRKY1) out of 48 candidates that seemed to respond to a salt and various hormones was cloned [8]. Thus, WRKY TFs were thought to be involved in various stress responses in this species. In this study, we therefore further cloned a number of PgWRKY genes encoding PgWRKY proteins belonging to three subgroups (one subgroup II-c, four subgroup II-d, and three subgroup II-e). Moreover, their expression patterns in different tissues and expression profiles under various hormones and NaCl stress conditions were performed using qRT-PCR analysis. The results will provide valuable information for other WRKY groups to dissect further molecular mechanisms and their functionalities.

2. Results

2.1. Cloning and Phylogeny

Through deep mining of our MeJA-treated P. ginseng transcriptome dataset, eight annotated PgWRKY unigenes (CL196. Contig1, CL495. Contig1, CL495. Contig8, CL196. Contig2, CL4686. Contig3, CL1589.Contig3, CL5364. Contig3, and Unigene 6844) were selected for cloning, showing obvious regulation in the dataset [8]. The primers were designed then and the selected candidates designated as PgWRKY2, PgWRKY3, PgWRKY4, PgWRKY5, PgWRKY6, PgWRKY7, PgWRKY8, and PgWRKY9 (GenBank accession number: KR060075-KR060079 and KU144580-KU144582) were successfully cloned. Sequence analysis showed that the eight full-length cDNAs ranged from 700 (PgWRKY7) to 1261 (PgWRKY2) bp (Figure 1, Figure S1). The length of the open reading frames (ORFs) of the PgWRKY genes vary from 585 (PgWRKY7) to 1077 bp (PgWRKY3/4), encoding proteins of 194–358 amino acids. Their molecular weight (MW) comprised from 21.59 to 39.80 kDa and their iso-electric point (PI) from 5.03 to 9.56.
In comparison with the sequence alignment of Group II WRKY proteins from different plants, each of the eight studied PgWRKY proteins was found to have a single WRKY domain consisting of one WRKYGQK sequence motif located at the N-terminal and one C2H2-type zinc-finger motif at the C-terminal (Figure 2). Therefore, these PgWRKY TFs were assigned to Group II according to the WRKY classification criteria [3,5]. Moreover, in Group II, the four PgWRKYs were assigned to subgroup II-d (PgWRKY2, PgWRKY3, PgWRKY4, and PgWRKY5), one to subgroup II-c (PgWRKY7), and three to subgroup II-e (PgWRKY6, PgWRKY8, and PgWRKY9) as per the corresponding unigenes of our transcriptomic dataset [8] and phylogenetic tree (Figure 3). Four PgWRKY proteins were found to be highly similar to PgWRKY1, PqWRKY1, StWRKY5, and PqWRKY5 and four PgWRKYs were found to be similar to PgWRKY1, AtWRKY48, PqWRKY4, and PqWRKY8. These observations point out that the eight PgWRKYs are members of the WRKY gene family.

2.2. Expression Pattern of PgWRKY Genes in Different Tissues

Emerging evidence indicated that WRKY genes show various expression patterns in different plant tissues. For example, CrWRKY1 in Catharanthus roseus was found to preferentially be expressed in roots [28], and OsWRKY82 was shown to differentially be expressed in all tested organs including stems, leaves, grains, and flowers [29]. In this study, the expression patterns of the eight studied PgWRKY genes were investigated in different P. ginseng tissues using qRT-PCR analysis (Figure 4). The results revealed that the genes were expressed differentially in leaves, roots, adventitious roots, stems, and seeds. In subgroup II-d, the expression level of the four surveyed PgWRKY genes showed functional diversity, with a relative increased expression level of PgWRKY3 in stems (2.44-fold), PgWRKY4 in adventitious roots (1.43-fold), and PgWRKY5 in roots (1.54-fold), compared with that in leaves (one-fold). In subgroup II-e, PgWRKY9 expression was the highest in seeds (3.67-fold). However, the expression of PgWRKY8 assigned to the same group was relatively lower in all the investigated organs compared with that in leaves. The remaining PgWRKY7 belonging to subgroup II-c was expressed at the highest level in adventitious roots (2.12-fold). We further observed the decreased transcripts of the eight PgWRKY genes in the tested organs compared to leaves. The lowest expression levels were shown by the following genes: PgWRKY2, PgWRKY6, and PgWRKY9 in stems (0.77-, 0.68-, and 0.19-fold), PgWRKY3 in roots (0.84-fold), and PgWRKY7 and PgWRKY8 in seeds (0.05- and 0.13-fold). Likewise, the expression levels of PgWRKY4 and PgWRKY5 were observed at the same lowest level in seeds (0.47-fold). The results imply that the WRKY members belonging to different subgroups might have diverse functions.

2.3. Expression Analysis of PgWRKY Genes under Different Treatments

To investigate which PgWRKY genes were significantly regulated in P. ginseng hairy roots, we performed qRT-PCR analysis at different time points following various treatments: MeJA, SA, ABA, and NaCl (Figure 5). The results showed that six PgWRKY genes were significantly downregulated in hairy roots treated with MeJA, with four in subgroup II-d (PgWRKY2, PgWRKY3, PgWRKY4, and PgWRKY5), one in subgroup II-e (PgWRKY6), and one in subgroup II-c (PgWRKY7). Among them, PgWRKY4, PgWRKY6, and PgWRKY7 showed reduced expression at all time points of treatment compared to the control. The remaining two PgWRKYs (PgWRKY8 and PgWRKY9) belonging to subgroup II-e were found to be induced during all time points of MeJA treatment except in the 12 h treatment of PgWRKY8. The statistical analysis showed that the changes in the expression levels of PgWRKYs with MeJA were significant (p < 0.05 or < 0.01). Under SA treatment, the transcripts of three PgWRKY genes (PgWRKY3, PgWRKY5, and PgWRKY9) were found to decrease significantly. The expression level of PgWRKY3 decreased until 24 h and returned to the control level thereafter. The PgWRKY5 expression was found to be downregulated only at 36 h, whereas the PgWRKY9 was reduced until 36 h post-treatment. The PgWRKY2 was significantly induced only at 24 h and PgWRKY4 at 36 h. The transcripts of PgWRKY6 were accumulated quickly from 6 to 48 h compared to the control. The expression level of PgWRKY7 significantly decreased at 6 h but increased at 12 h and its highest level of expression was found at 48 h post-treatment. The transcripts of PgWRKY8 started to significantly increase from 6 h and this trend was observed till 48 h with the exception of 36 h of SA treatment. During ABA treatment, the transcripts of five PgWRKYs (PgWRKY2, PgWRKY4, PgWRKY5, PgWRKY8, and PgWRKY9) were found to be significantly upregulated in comparison with the control. The transcripts of PgWRKY2 were induced only during 6 h and PgWRKY5 only during 12 h of treatment. The level of PgWRKY8 expression increased slightly from 3 to 6 h compared to the control, while a remarkable increase in the transcripts of PgWRKY9 was observed from 6 to 12 h. The transcripts of PgWRKY4 were found to be accumulated at three time points of treatments including 6, 12, and 36 h. The expression level of PgWRKY3 rapidly increased at the beginning of the treatment but decreased dramatically at 48 h, while the decreased transcripts of PgWRKY6 were obtained at the beginning and this trend lasted from 12 to 48 h. Likewise, the expression level of PgWRKY7 declined at the start of ABA treatment and the reduction was also observed between 36 and 48 h of ABA treatment. In NaCl treatment, the transcript levels of all the tested PgWRKYs were significantly upregulated or downregulated, except PgWRKY5. Among them, only the transcripts of PgWRKY9 were induced at all time points of treatment in comparison with the control. It was found to increase rapidly at the beginning of NaCl treatment and continually increased with the passage of time until the highest level was reached at 48 h (13.01-fold). Moreover, the induced expression of PgWRKY2 and PgWRKY6 was observed only at 12 h, while PgWRKY3 and PgWRKY4 showed this trend during 6 h of the salt treatment. The expression level of PgWRKY7 also increased at 12 h, but declined when it was treated for the period of 24 h. The transcript level of PgWRKY8 was found to significantly increase at four time points (3, 6, 12, and 48 h) of NaCl treatment. The statistical analysis indicated that the changes in the expression levels of all the analyzed PgWRKYs except PgWRKY5 were extremely significant (p < 0.01) upon NaCl treatment.
Integrating the gene expression results of the eight PgWRKYs during four different treatments (Table 1), the transcripts of the PgWRKY9 belonging to subgroup II-e accumulated simultaneously at all time points of MeJA and NaCl treatments with the highest peak at 3 h (5.71-fold) and 48 h (13.01-fold), respectively. The expression of PgWRKY2 belonging to subgroup II-d was induced by both SA and ABA with the best induced expression during 24 h (3.39-fold) of SA treatment. Moreover, among all the treatments, the highest induced expression of PgWRKY3, PgWRKY4, and PgWRKY5 was observed with the treatment of ABA including 4.29-fold at 3 h, 6.95-fold at 12 h, and 4.22-fold at 12 h, respectively, in comparison with the control. Likewise, PgWRKY6 transcripts showed the highest induced expression with SA (7.93-fold at 36 h), PgWRKY7 also with SA (2.65-fold at 48 h), and PgWRKY8 with NaCl (11.78-fold at 6 h). However, only the PgWRKY5 belonging to the set of eight PgWRKY genes did not show any significant regulation upon NaCl treatment. Interestingly, MeJA did not induce PgWRKY2/3/4/5/6/7 expression; it was instead significantly reduced by MeJA. The lowest accumulation of PgWRKY2 transcripts was observed at 6 h (0.33-fold), PgWRKY4 at 12 h (0.17-fold), and PgWRKY5 also at 12 h (0.27-fold) of MeJA treatment. Moreover, PgWRKY3 and PgWRKY6 showed the lowest expression at 48 h (0.12-fold) and at 3 h (0.20-fold) of ABA treatment, respectively. Likewise, the PgWRKY7 transcripts were accumulated at the lowest level at 24 h (0.15-fold) of NaCl treatment. In SA treatment, the expression level of PgWRKY8 was found to be the lowest at 36 h (0.35-fold) and PgWRKY9 at 12 h (0.14-fold). These observations indicate that PgWRKY genes are multiple stress–inducible genes responding to NaCl and various hormones.

3. Discussion

WRKY proteins in higher plants play important roles in response to various physiological processes, particularly in biotic and abiotic stresses [4,30]. In recent years, many WRKY genes have been isolated and functionally characterized, mostly in model plants such as Arabidopsis and rice [5,31,32]. Moreover, a number of WRKY genes and their roles have been identified in many medicinal plants including Coptis japonica, Catharanthus roseus, Artemisia annua, and P. quinquefolius [15,19,28,33]. In spite of the pharmaceutical and industrial importance related to P. ginseng from ancient times, only one WRKY gene (PgWRKY1) has previously been characterized in P. ginseng [8]. In this study, the PgWRKY2/3/4/5/6/7/8/9 genes cloned and characterized will provide more insight into expression profiles under MeJA, SA, ABA, and salt treatments. To elucidate the relationships among the WRKY DNA binding regions from different plants, we carried out multiple alignment analysis (Figure 2) which shows high sequence identities of PgWRKY2/3/4/5/6/7/8/9 proteins, indicating that amino acid residues are highly conserved among WRKY proteins. Phylogenetic tree analysis (Figure 3) showed that PgWRKY2/3/4/5/6/7/8/9 and other plant WRKYs are homologous, suggesting a probable functional similarity among them. Expression analysis of PgWRKY2/3/4/5/6/7/8/9 in various organs (Figure 4) revealed that PgWRKY5 was relatively higher in roots, PgWRKY3 in stems, PgWRKY4 and PgWRKY7 in adventitious roots, and PgWRKY9 in seeds compared with leaves, suggesting that they might be involved in the development of all P. ginseng organs.
The WRKY genes were previously identified to respond to different hormones and abiotic stresses and to be involved in a number of life processes including stress resistance, defense, and secondary metabolism [15,34,35,36]. About 109 OsWRKY genes were identified in rice [10,29,37], and mostly were shown to be involved in many hormones, biotic stress, and abiotic stress responses. Among various elicitors, MeJA was identified to be an effective elicitor for the induction of ginsenoside contents in hairy roots and cultured cells of Panax species [18,38]. The recently discovered PqWRKY1 in P. quinquefolius related to triterpene ginsenoside biosynthesis was induced rapidly upon MeJA treatment [19]. More recently, we identified the PgWRKY1 in P. ginseng to be downregulated by MeJA, but upregulated upon SA, ABA, and salt treatments [8]. Therefore, the exploration of the functions of various treatments and salt-responsive WRKY genes in P. ginseng will be helpful in discovering genes involved in stress resistance and secondary metabolite biosynthesis. In the present study, we further identified six PgWRKY genes (PgWRKY2, PgWRKY3, PgWRKY4, PgWRKY5, PgWRKY6, and PgWRKY7) to significantly be downregulated at all time points of MeJA treatment, whereas two PgWRKYs (PgWRKY8 and PgWRKY9) were found to be induced during this treatment (Figure 5). MeJA-regulated WRKY genes were previously identified to be regulated by SA, ABA, and salt [39,40]. For example, the transcripts of LtWRKY21 in Larrea tridentate vegetative tissues were induced by ABA and in response to various environmental stresses such as water deficit, wounding, drought, and salt stresses [41]. Moreover, the major part of Arabidopsis WRKY TF-related genes was shown to be induced by SA treatment [11,42]. We therefore tried to observe if the expression profiles of the eight studied PgWRKYs were related to SA, ABA, and salt stresses, where all the analyzed genes were found to differentially be expressed with these treatments (Figure 5). SA treatment led the best induced expression of PgWRKY6 (7.93-fold). Likewise, most of these PgWRKY genes were also found to significantly increase with the treatment of ABA and NaCl. Among the eight PgWRKY genes, the transcripts of the PgWRKY9 were found to have maximum induction with the treatment of ABA and NaCl with 8.28- and 13.01-fold, respectively. These findings indicated that PgWRKY genes have multi-functional roles in various hormone and salt treatments and may potentially be applied in breeding new P. ginseng cultivars with increased stress resistance.

4. Materials and Methods

4.1. Plant Materials

Commercial cultivars of ginseng (Panax ginseng C.A. Meyer) with four-year-old were collected from the forest of the Changbai mountain of Fusong County, Baishan, Jilin Province, China. Untreated fresh hairy roots were used to extract RNA for gene cloning and treated hairy roots with different hormones (MeJA, SA, and ABA) and a salt (NaCl) were used to observe expression profiles. Ginseng roots, adventitious roots, stems, seeds, and leaves were used separately for RNA isolation and tissue-specific expression analysis.

4.2. Cloning of PgWRKYs

Based on the selected eight PgWRKYs unigenes from our previous P. ginseng tanscriptome dataset [8], gene-specific primers (Table 2) were individually designed for PCR amplification of the PgWRKY genes based on the complete ORF cDNA sequences. Total RNA was extracted from hairy roots by E.Z.N.A plant RNA Kit (Omega Bio-Tek, Doraville, GA, USA) according to the manufacturer’s protocols and then treated by RNase-free DNase I (Omega Bio-Tek) to prevent residual DNA. The first-strand cDNA was synthesized in a reaction volume of 20 µL using 1 µg of total RNA and RevertAid First-Strand cDNA synthesis Kit (Thermo Fisher Scientific, Waltham, MA, USA) following the manufacture’s procedure. PCR reaction was carried out in a 16 µL reaction volume including 8 µL of 2× Taq MasterMix, 1 µL of each primer (10 µM), 5.5 µL of ddH2O, and 0.5 µL of cDNA template. The PCR conditions were as follows: 94 °C for 1 min; 94 °C for 30 s, 50–58 °C for 30 s (PgWRKY3 and PgWRKY6: 50 °C, PgWRKY7, PgWRKY8, and PgWRKY9: 52 °C, and PgWRKY2, PgWRKY4, and PgWRKY5: 58 °C), 72 °C for 1 min with 35 cycles; and 72 °C for 10 min. All of the amplified PCR products were purified using Wizard SV Gel and PCR Clean-Up System Kit (Promega, Madison, WI, USA). We then cloned the purified PCR fragments into the pGEM-T Easy vector (Promega) (Figure S2) and subsequently sequenced the successful clones by Invitrogen (Pudong, Shanghai, China). To calculate the theoretical PI and MW of the studied PgWRKY proteins, their respective amino acid sequences were pasted in the box found using ExPASy server (http://web.expasy.org/protparam/). The amino acid sequences of PgWRKY proteins and other plant WRKY proteins were aligned using CLUSTAL_X and the phylogenetic tree was generated with the MEGA4.0 program using NJ algorithm with 1000 bootstrap trials [43]. Multiple sequence alignments using amino acid sequences of the studied PgWRKY proteins were determined with DNAMAN software (http://www.lynnon.com/alignm.html). Primers were designed with primer premier 5.0 software (http://www.idtdna.com/Primerquest/Home/Index).

4.3. Salts and Hormone Treatments

To analyze the responses of PgWRKY genes to a salt and various hormone treatments, hairy roots cultured for two weeks were transferred to eight conical flasks, each of which contained 40 mL Murashige and Skoog (MS) medium. Subsequently, 200 µM MeJA, 200 µM SA, 20 µM ABA, and 50 mM NaCl were individually added in four of the flasks. Equal amount of solvents used to dissolve the hormones and salt were added in the remaining four flasks (empty control). All the flasks were stored on a rotary shaker with 180 rpm and 28 °C in dark. The hairy root samples following 0, 3, 6, 12, 24, 36, and 48 h treatment were collected immediately and frozen in liquid nitrogen and then stored at −80 °C for RNA extraction.

4.4. Expression Analysis

The transcript levels of PgWRKY genes from various organs and hairy roots of P. ginseng were measured by qRT-PCR with UltraSYBR mixture (with ROXII) (CWBIO, Beijing, China) using the Mastercycler ep realplex2 detection system (Eppendorf, Humberg, Germany). Total RNA using E.Z.N.A plant RNA Kit was isolated from the salt and hormone treated hairy root samples and then reversely transcribed into cDNAs using RevertAid First-Strand cDNA Synthesis Kit (Fermentas, Waltham, MA, USA). Gene-specific primers and Pgβ-actin (internal control) primers (Table 3) were used for qRT-PCR analysis. The amplification of cDNA was performed in a 50 µL reaction mixture containing 25 µL of 2× UltraSYBR Mixture (with ROXII), 1 µL of each 10 µM primers (forward and reverse), 50 ng of cDNA, and ddH2O up to 50 µL. The PCR conditions were as follows: 95 °C for 10 min; 95 °C for 30 s, 60–62 °C for 30 s (PgWRKY7, PgWRKY8, and PgWRKY9: 60 °C, and PgWRKY2, PgWRKY3, PgWRKY4, PgWRKY5, and PgWRKY6: 62 °C), 72 °C for 1 min, 40 cycles. A melting curve analysis was performed following amplification cycles to validate the specificity of the reactions. This was carried out by heating all the amplified fragments between 60 and 95 °C at 0.5 °C per 10 s. Post qRT-PCR calculations were performed to analyze relative gene expression levels of the studied PgWRKY genes based on the 2−∆∆Ct method as explained earlier [44]. The results obtained for the level of gene expression were demonstrated following normalization with the Pgβ-actin used as internal control. All the qRT-PCR amplifications were repeated three times.

4.5. Statistical Analysis

Data from qRT-PCR were presented as the mean ± standard deviation (SD) of three independent experiments, each of those was repeated three times. Analysis of variance (ANOVA) was used to conduct statistical analysis and comparison of means was performed using the least significant difference (LSD) test at p = 0.05. The differences were considered statistically significant when p < 0.05 and extremely significant when p < 0.01.

5. Conclusions

In this study, we cloned eight PgWRKY cDNAs from P. ginseng along with their expression patterns in different tissues and expression profiles under a salt and various hormones. We found two PgWRKYs to be upregulated while others were downregulated following MeJA treatments. Furthermore, the genes were regulated differentially at transcript levels by SA, ABA, and salt treatments. The observations of the analyzed PgWRKYs will provide a comprehensive overview of the WRKY family in P. ginseng which might contribute in guiding ginseng breeding and discovering genes related to stress tolerance and secondary metabolite biosynthesis in Panax ginseng and related species.

Supplementary Materials

Supplementary materials can be found at https://www.mdpi.com/1422-0067/17/3/319/s1.

Acknowledgments

The work was supported by the National Natural Science Foundation of China (Nos. 30470189, 81071821, 81250110086, and 812111392), the Key Hunan Provincial Natural Science Foundation of China (Nos. 13JJ2016 and 07JJ5096), the Science and Technology Program of Hunan Province of China (No. 2014SK4050), Changsha National High Tech Zone Innovation Leading Talent Program (No. 20143701), and the Fundamental Research Funds for the Central Universities of Central South University (No. 721500011).

Author Contributions

Hao Xiu and Mohammed Nuruzzaman designed and performed experiments, drew figures, and wrote the manuscript; Xiangqian Guo and Hongzhe Cao helped in doing experiment and revising the manuscript; Jingjia Huang helped in drawing figures; Xianghui Chen revised the manuscripts; Kunlu Wu, Ru Zhang, Yuzhao Huang, and Junli Luo assisted in data analyzing, giving suggestions, and revising the manuscript; and Zhiyong Luo carried out the planning, gave valuable suggestions, and significantly revised the manuscript. All authors have read and approved the final manuscript.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Zhang, Y.J.; Wang, L.J. The WRKY transcription factor superfamily: Its origin in eukaryotes and expansion in plants. BMC Evol. Biol. 2005, 5, 1–12. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  2. Pan, Y.J.; Cho, C.C.; Kao, Y.Y.; Sun, C.H. A novel WRKY-like protein involved in transcriptional activation of cyst wall protein genes in Giardia lamblia. J. Biol. Chem. 2009, 284, 17975–17988. [Google Scholar] [CrossRef] [PubMed]
  3. Rushton, P.J.; Somssich, I.E.; Ringler, P.; Shen, Q.X.J. WRKY transcription factors. Trends Plant Sci. 2010, 15, 247–258. [Google Scholar] [CrossRef] [PubMed]
  4. Ülker, B.; Somssich, I.E. WRKY transcription factors: From DNA binding towards biological function. Curr. Opin. Plant Biol. 2004, 7, 491–498. [Google Scholar] [CrossRef] [PubMed]
  5. Eulgem, T.; Rushton, P.J.; Robatzek, S.; Somssich, I.E. The WRKY superfamily of plant transcription factors. Trends Plant Sci. 2000, 5, 199–206. [Google Scholar] [CrossRef]
  6. Ross, C.A.; Liu, Y.; Shen, Q.X.J. The WRKY gene family in rice (Oryza sativa). J. Integr. Plant Biol. 2007, 49, 827–842. [Google Scholar] [CrossRef]
  7. Xie, Z.; Ruas, P.; Shen, Q.X.J. Regulatory networks of the phytohormone abscisic acid. Plant Horm. 2005, 72, 235–269. [Google Scholar]
  8. Nuruzzaman, M.; Cao, H.Z.; Xiu, H.; Luo, T.; Li, J.; Chen, X.; Luo, J.; Luo, Z.Y. Transcriptomics-based identification of WRKY genes and molecular characterization of a salt and hormone-responsive PgWRKY1 gene in Panax ginseng. Acta Biochim. Biophys. Sin. 2015. [Google Scholar] [CrossRef]
  9. Schluttenhofer, C.; Pattanaik, S.; Patra, B.; Yuan, L. Analyses of Catharanthus roseus and Arabidopsis thaliana WRKY transcription factors reveal involvement in jasmonate signaling. BMC Genom. 2014, 15, 502. [Google Scholar] [CrossRef] [PubMed]
  10. Ramamoorthy, R.; Jiang, S.Y.; Kumar, N.; Venkatesh, P.N.; Ramachandran, S. A comprehensive transcriptional profiling of the WRKY gene family in rice under various abiotic and phytohormone treatments. Plant Cell Physiol. 2008, 49, 865–879. [Google Scholar] [CrossRef] [PubMed]
  11. Dong, J.X.; Chen, C.H.; Chen, Z.X. Expression profiles of the Arabidopsis WRKY gene superfamily during plant defense response. Plant Mol. Biol. 2003, 51, 21–37. [Google Scholar] [CrossRef] [PubMed]
  12. Johnson, C.S.; Kolevski, B.; Smyth, D.R. TRANSPARENT TESTA GLABRA2, a trichome and seed coat development gene of Arabidopsis, encodes a WRKY transcription factor. Plant Cell 2002, 14, 1359–1375. [Google Scholar] [CrossRef] [PubMed]
  13. Lagace, M.; Matton, D.P. Characterization of a WRKY transcription factor expressed in late torpedo-stage embryos of Solanum chacoense. Planta 2004, 219, 185–189. [Google Scholar] [CrossRef] [PubMed]
  14. Miao, Y.; Smykowski, A.; Zentgraf, U. A novel upstream regulator of WRKY53 transcription during leaf senescence in Arabidopsis thaliana. Plant Biol. 2008, 10, 110–120. [Google Scholar] [CrossRef] [PubMed]
  15. Kato, N.; Dubouzet, E.; Kokabu, Y.; Yoshida, S.; Taniguchi, Y.; Dubouzet, J.G.; Yazaki, K.; Sato, F. Identification of a WRKY protein as a transcriptional regulator of benzylisoquinoline alkaloid biosynthesis in Coptis japonica. Plant Cell Physiol. 2007, 48, 8–18. [Google Scholar] [CrossRef] [PubMed]
  16. Luo, M.; Dennis, E.S.; Berger, F.; Peacock, W.J.; Chaudhury, A. MINISEED3 (MINI3), a WRKY family gene, and HAIKU2 (IKU2), a leucine-rich repeat (LRR) KINASE gene, are regulators of seed size in Arabidopsis. Proc. Natl. Acad. Sci. USA 2005, 102, 17531–17536. [Google Scholar] [CrossRef] [PubMed]
  17. Wei, S. Methyl jasmonic acid induced expression pattern of terpenoid indole alkaloid pathway genes in Catharanthus roseus seedlings. Plant Growth Regul. 2010, 61, 243–251. [Google Scholar] [CrossRef]
  18. Thanh, N.T.; Murthy, H.N.; Yu, K.W.; Hahn, E.J.; Paek, K.Y. Methyl jasmonate elicitation enhanced synthesis of ginsenoside by cell suspension cultures of Panax ginseng in 5-I balloon type bubble bioreactors. Appl. Microbiol. Biotechnol. 2005, 67, 197–201. [Google Scholar] [CrossRef] [PubMed]
  19. Sun, Y.Z.; Niu, Y.Y.; Xu, J.; Li, Y.; Luo, H.M.; Zhu, Y.J.; Liu, M.Z.; Wu, Q.; Song, J.Y.; Sun, C.; et al. Discovery of WRKY transcription factors through transcriptome analysis and characterization of a novel methyl jasmonate-inducible PqWRKY1 gene from Panax quinquefolius. Plant Cell Tissue Organ Cult. 2013, 114, 269–277. [Google Scholar] [CrossRef]
  20. Nuruzzaman, M.; Zhang, R.; Cao, H.Z.; Luo, Z.Y. Plant pleiotropic drug resistance transporters: Transport mechanism, gene expression, and function. J. Integr. Plant Biol. 2014, 56, 729–740. [Google Scholar] [CrossRef] [PubMed]
  21. Kim, K.H.; Choi, I.; Lee, Y.W.; Cho, C.K.; Yoo, H.S.; Lee, S.B.; Choi, S.H.; Kwon, K.R.; Jang, J.H. Target genes involved in antiproliferative effect of modified ginseng extracts in lung cancer A549 cells. Acta Biochim. Biophys. Sin. 2014, 46, 441–449. [Google Scholar] [CrossRef] [PubMed]
  22. Yang, N.Q.; Chen, P.S.; Tao, Z.W.; Zhou, N.T.; Gong, X.X.; Xu, Z.H.; Zhang, M.; Zhang, D.G.; Chen, B.; Tao, Z.X.; et al. Beneficial effects of ginsenoside-Rg1 on ischemia-induced angiogenesis in diabetic mice. Acta Biochim. Biophys. Sin. 2012, 44, 999–1005. [Google Scholar] [CrossRef] [PubMed]
  23. Zhang, Z.Y.; Du, G.J.; Wang, C.Z.; Wen, X.D.; Calway, T.; Li, Z.J.; He, T.C.; Du, W.; Bissonnette, M.; Musch, M.W.; et al. Compound K, a ginsenoside metabolite, inhibits colon cancer growth via multiple pathways including p53-p21 interactions. Int. J. Mol. Sci. 2013, 14, 2980–2995. [Google Scholar] [CrossRef] [PubMed]
  24. Lee, S.; Lee, M.S.; Kim, C.T.; Kim, I.H.; Kim, Y. Ginsenoside Rg3 reduces lipid accumulation with AMP-activated protein Kinase (AMPK) activation in HepG2 cells. Int. J. Mol. Sci. 2012, 13, 5729–5739. [Google Scholar] [CrossRef] [PubMed]
  25. Zhang, R.; Huang, J.J.; Zhu, J.; Xie, X.L.; Tang, Q.; Chen, X.H.; Luo, J.; Luo, Z.Y. Isolation and characterization of a novel PDR-type ABC transporter gene PgPDR3 from Panax ginseng C.A. Meyer induced by methyl jasmonate. Mol. Biol. Rep. 2013, 40, 6195–6204. [Google Scholar] [CrossRef] [PubMed]
  26. Zhang, R.; Zhu, J.; Cao, H.Z.; An, Y.R.; Huang, J.J.; Chen, X.H.; Nuruzzaman, M.; Afrin, S.; Luo, Z.Y. Molecular cloning and expression analysis of PDR1-like gene in ginseng subjected to salt and cold stresses or hormonal treatment. Plant Physiol. Biochem. 2013, 71, 203–211. [Google Scholar] [CrossRef] [PubMed]
  27. Cao, H.Z.; Nuruzzaman, M.; Xiu, H.; Huang, J.; Wu, K.; Chen, X.; Li, J.; Wang, L.; Jeong, J.H.; Park, S.J.; et al. Transcriptome analysis of methyl jasmonate-elicited Panax ginseng adventitious roots to discover putative ginsenoside biosynthesis and transport genes. Int. J. Mol. Sci. 2015, 16, 3035–3057. [Google Scholar] [CrossRef] [PubMed]
  28. Suttipanta, N.; Pattanaik, S.; Kulshrestha, M.; Patra, B.; Singh, S.K.; Yuan, L. The transcription factor CrWRKY1 positively regulates the terpenoid indole alkaloid biosynthesis in Catharanthus roseus. Plant Physiol. 2011, 157, 2081–2093. [Google Scholar] [CrossRef] [PubMed]
  29. Peng, X.X.; Tang, X.K.; Zhou, P.L.; Hu, Y.J.; Deng, X.B.; He, Y.; Wang, H.H. Isolation and expression patterns of rice WRKY82 transcription factor gene responsive to both biotic and abiotic stresses. Agric. Sci. China 2011, 10, 893–901. [Google Scholar] [CrossRef]
  30. Chen, H.; Lai, Z.B.; Shi, J.W.; Xiao, Y.; Chen, Z.X.; Xu, X.P. Roles of Arabidopsis WRKY18, WRKY40 and WRKY60 transcription factors in plant responses to abscisic acid and abiotic stress. BMC Plant Biol. 2010, 10, 281. [Google Scholar] [CrossRef] [PubMed]
  31. Cheong, Y.H.; Chang, H.S.; Gupta, R.; Wang, X.; Zhu, T.; Luan, S. Transcriptional profiling reveals novel interactions between wounding, pathogen, abiotic stress, and hormonal responses in Arabidopsis. Plant Physiol. 2002, 129, 661–677. [Google Scholar] [CrossRef] [PubMed]
  32. Song, Y.; Al, C.; Jing, S.; Yu, D. Research progress on functional analysis of Rice WRKY genes. Rice Sci. 2010, 17, 60–72. [Google Scholar] [CrossRef]
  33. Ma, D.M.; Pu, G.B.; Lei, C.Y.; Ma, L.Q.; Wang, H.H.; Guo, Y.W.; Chen, J.L.; Du, Z.G.; Wang, H.; Li, G.F.; et al. Isolation and characterization of AaWRKY1, an Artemisia annua transcription factor that regulates the Amorpha-4,11-diene synthase gene, a key gene of artemisinin biosynthesis. Plant Cell Physiol. 2009, 50, 2146–2161. [Google Scholar] [CrossRef] [PubMed]
  34. Hara, K.; Yagi, M.; Kusano, T.; Sano, H. Rapid systemic accumulation of transcripts encoding a tobacco WRKY transcription factor upon wounding. Mol. Gen. Genet. 2000, 263, 30–37. [Google Scholar] [CrossRef] [PubMed]
  35. Xie, Z.; Zhang, Z.L.; Zou, X.L.; Yang, G.X.; Komatsu, S.; Shen, Q.X.J. Interactions of two abscisic-acid induced WRKY genes in repressing gibberellin signaling in aleurone cells. Plant J. 2006, 46, 231–242. [Google Scholar] [CrossRef] [PubMed]
  36. Xie, D.X.; Feys, B.F.; James, S.; Nieto-Rostro, M.; Turner, J.G. COI1: An Arabidopsis gene required for jasmonate-regulated defense and fertility. Science 1998, 280, 1091–1094. [Google Scholar] [CrossRef] [PubMed]
  37. Liu, X.; Bai, X.; Wang, X.; Chu, C. OsWRKY71, a rice transcription factor, is involved in rice defense response. J. Plant Physiol. 2007, 164, 969–979. [Google Scholar] [CrossRef] [PubMed]
  38. Kim, Y.S.; Hahn, E.J.; Murthy, H.N.; Paek, K.Y. Adventitious root growth and ginsenoside accumulation in Panax ginseng cultures as affected by methyl jasmonate. Biotechnol. Lett. 2004, 26, 1619–1622. [Google Scholar] [CrossRef] [PubMed]
  39. Qiu, D.Y.; Xiao, J.; Ding, X.H.; Xiong, M.; Cai, M.; Cao, C.L.; Li, X.H.; Xu, C.G.; Wang, S.P. OsWRKY13 mediates rice disease resistance by regulating defense-related genes in salicylate- and jasmonate-dependent signaling. Mol. Plant Microbe Interact. 2007, 20, 492–499. [Google Scholar] [CrossRef] [PubMed]
  40. Pandey, S.P.; Roccaro, M.; Schon, M.; Logemann, E.; Somssich, I.E. Transcriptional reprogramming regulated by WRKY18 and WRKY40 facilitates powdery mildew infection of Arabidopsis. Plant J. 2010, 64, 912–923. [Google Scholar] [CrossRef] [PubMed]
  41. Zou, X.L.; Shen, Q.J.X.; Neuman, D. An ABA inducible WRKY gene integrates responses of creosote bush (Larrea tridentata) to elevated CO2 and abiotic stresses. Plant Sci. 2007, 172, 997–1004. [Google Scholar] [CrossRef]
  42. Kalde, M.; Barth, M.; Somssich, I.E.; Lippok, B. Members of the Arabidopsis WRKY group III transcription factors are part of different plant defense signaling pathways. Mol. Plant Microbe Interact. 2003, 16, 295–305. [Google Scholar] [CrossRef] [PubMed]
  43. Tamura, K.; Dudley, J.; Nei, M.; Kumar, S. MEGA4: Molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol. Biol. Evol. 2007, 24, 1596–1599. [Google Scholar] [CrossRef] [PubMed]
  44. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−∆∆Ct method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Full-length cDNAs of the eight studied PgWRKYs (PgWRKY2-9). M: Marker (1 kbp DNA Ladder); Lane 1: PgWRKY2 (1261 bp); Lane 2: PgWRKY3 (1196 bp); Lane 3: PgWRKY4 (1233 bp); Lane 4: PgWRKY5 (1259 bp); Lane 5: PgWRKY6 (890 bp); Lane 6: PgWRKY7 (700 bp); Lane 7: PgWRKY8 (1071 bp); and Lane 8: PgWRKY9 (987 bp).
Figure 1. Full-length cDNAs of the eight studied PgWRKYs (PgWRKY2-9). M: Marker (1 kbp DNA Ladder); Lane 1: PgWRKY2 (1261 bp); Lane 2: PgWRKY3 (1196 bp); Lane 3: PgWRKY4 (1233 bp); Lane 4: PgWRKY5 (1259 bp); Lane 5: PgWRKY6 (890 bp); Lane 6: PgWRKY7 (700 bp); Lane 7: PgWRKY8 (1071 bp); and Lane 8: PgWRKY9 (987 bp).
Ijms 17 00319 g001
Figure 2. WRKY domain comparison of the eight analyzed PgWRKY TFs (PgWRKY2-9) with other members of WRKY Group II. Amino acid sequence analysis of the eight PgWRKYs with P. quinquefolius PqWRKY1 (AEQ29014.1), A. thaliana AtWRKY15 (AEC07442.1), Petroselinum crispum PcWRKY3 (AAC49528.1), Nicotiana benthamiana NbWRKY17 (AIR74899.1), Solanum tuberosum StWRKY2 (NP_001275001.1), and P. ginseng PgWRKY1 (KR060074) was accomplished using DNAMAN software. The WRKYGQK sequence motifs are underlined and cysteines (C) and histidines (H) in the zinc-finger motifs are indicated by arrowheads.
Figure 2. WRKY domain comparison of the eight analyzed PgWRKY TFs (PgWRKY2-9) with other members of WRKY Group II. Amino acid sequence analysis of the eight PgWRKYs with P. quinquefolius PqWRKY1 (AEQ29014.1), A. thaliana AtWRKY15 (AEC07442.1), Petroselinum crispum PcWRKY3 (AAC49528.1), Nicotiana benthamiana NbWRKY17 (AIR74899.1), Solanum tuberosum StWRKY2 (NP_001275001.1), and P. ginseng PgWRKY1 (KR060074) was accomplished using DNAMAN software. The WRKYGQK sequence motifs are underlined and cysteines (C) and histidines (H) in the zinc-finger motifs are indicated by arrowheads.
Ijms 17 00319 g002
Figure 3. Phylogenetic relationships among the eight studied proteins (PgWRKY2-9) and other members of the WRKY family estimated based on their amino acid sequences. WRKY amino acid sequences of the following proteins were used to make the tree: PqWRKY1 (AEQ29014.1), PgWRKY1 (KR060075), NbWRKY17 (AIR74899.1), AtWRKY15 (NP_179913.1), PbWRKY20 (ACV92022.1), PbWRKY26 (ACV92028.1), GhWRKY97 (AGV75972.1), PsWRKY46 (AFU81789.1), AtWRKY11 (NP_849559.1), AtWRKY17 (NP_565574.1), AtWRKY33 (NM_129404.3), PqWRKY4 (AEQ29017.1), StWRKY5 (NP_001274847.1), PqWRKY5 (AEQ29018.1), and PqWRKY8 (AEQ29021.1). The neighbor-joining phylogenetic tree was constructed using the bootstrap method of MEGA 4.0 with 1000 replications and the respective plant species of the above proteins are shown in the tree. The black square symbols indicate the eight studied PgWRKY proteins (PgWRKY2-9).
Figure 3. Phylogenetic relationships among the eight studied proteins (PgWRKY2-9) and other members of the WRKY family estimated based on their amino acid sequences. WRKY amino acid sequences of the following proteins were used to make the tree: PqWRKY1 (AEQ29014.1), PgWRKY1 (KR060075), NbWRKY17 (AIR74899.1), AtWRKY15 (NP_179913.1), PbWRKY20 (ACV92022.1), PbWRKY26 (ACV92028.1), GhWRKY97 (AGV75972.1), PsWRKY46 (AFU81789.1), AtWRKY11 (NP_849559.1), AtWRKY17 (NP_565574.1), AtWRKY33 (NM_129404.3), PqWRKY4 (AEQ29017.1), StWRKY5 (NP_001274847.1), PqWRKY5 (AEQ29018.1), and PqWRKY8 (AEQ29021.1). The neighbor-joining phylogenetic tree was constructed using the bootstrap method of MEGA 4.0 with 1000 replications and the respective plant species of the above proteins are shown in the tree. The black square symbols indicate the eight studied PgWRKY proteins (PgWRKY2-9).
Ijms 17 00319 g003
Figure 4. Tissue-specific expression of the eight studied PgWRKYs (PgWRKY2-9) in different tissues of P. ginseng analyzed by qRT-PCR. (A) Subgroup II-d; (B) Subgroup II-e; and (C) Subgroup II-c. L: Leaves, R: Roots, AR: Adventitious roots, and S: Stems. Error bars represent standard deviation (SD) of means from three independent experiments. The relative expression was calculated using the 2−∆∆Ct method based on the corresponding gene expression in leaves. The differences between the transcript level of adventitious roots, roots, leaves, stems, and seeds are statistically significant (* p < 0.05, ** p < 0.01) according to independent samples t-test.
Figure 4. Tissue-specific expression of the eight studied PgWRKYs (PgWRKY2-9) in different tissues of P. ginseng analyzed by qRT-PCR. (A) Subgroup II-d; (B) Subgroup II-e; and (C) Subgroup II-c. L: Leaves, R: Roots, AR: Adventitious roots, and S: Stems. Error bars represent standard deviation (SD) of means from three independent experiments. The relative expression was calculated using the 2−∆∆Ct method based on the corresponding gene expression in leaves. The differences between the transcript level of adventitious roots, roots, leaves, stems, and seeds are statistically significant (* p < 0.05, ** p < 0.01) according to independent samples t-test.
Ijms 17 00319 g004
Figure 5. Expression profiles of the eight analyzed PgWRKYs (PgWRKY2-9) in P. ginseng hairy roots treated with 200 µM MeJA, 200 µM SA, 20 µM ABA, and 50 mM NaCl. (A) Subgroup II-d; (B) Subgroup II-e; and (C) Subgroup II-c. The hairy roots treated with equal amount of solvent of the corresponding chemicals were used as control (0, 3, 6, 12, 24, 36, and 48 h). The transcript levels at different time points (0, 3, 6, 12, 24, 36, and 48 h) were measured by qRT-PCR. The levels of gene expression in the treated samples were analyzed on the basis of the corresponding gene expression at 0 h using the 2−∆∆Ct method. The error bars represent the standard deviation (SD) from triplicate experiments. The differences between the level of transcript of treated and control hairy roots at 0 h are statistically significant (* p < 0.05) and extremely significant (** p < 0.01) according to independent samples t-test.
Figure 5. Expression profiles of the eight analyzed PgWRKYs (PgWRKY2-9) in P. ginseng hairy roots treated with 200 µM MeJA, 200 µM SA, 20 µM ABA, and 50 mM NaCl. (A) Subgroup II-d; (B) Subgroup II-e; and (C) Subgroup II-c. The hairy roots treated with equal amount of solvent of the corresponding chemicals were used as control (0, 3, 6, 12, 24, 36, and 48 h). The transcript levels at different time points (0, 3, 6, 12, 24, 36, and 48 h) were measured by qRT-PCR. The levels of gene expression in the treated samples were analyzed on the basis of the corresponding gene expression at 0 h using the 2−∆∆Ct method. The error bars represent the standard deviation (SD) from triplicate experiments. The differences between the level of transcript of treated and control hairy roots at 0 h are statistically significant (* p < 0.05) and extremely significant (** p < 0.01) according to independent samples t-test.
Ijms 17 00319 g005
Table 1. Expression profiles of the eight analyzed PgWRKYs (PgWRKY2-9) under various treatments.
Table 1. Expression profiles of the eight analyzed PgWRKYs (PgWRKY2-9) under various treatments.
GeneGroupMeJASAABANaCl
PgWRKY2Group II-dD*****
PgWRKY3Group II-dDD**
PgWRKY4Group II-dD******
PgWRKY5Group II-dDD**-
PgWRKY6Group II-eD**D**
PgWRKY7Group II-cDD
PgWRKY8Group II-e******
PgWRKY9Group II-e******
Treatments of hairy roots with 200 µM MeJA, 200 µM SA, 20 µM ABA, and 50 mM NaCl were performed for 0, 3, 6, 12, 24, 36, and 48 h. D: Significant downregulation of PgWRKY genes expression at p < 0.05 or 0.01; ** & *: Significant upregulation of PgWRKY genes at p < 0.01 & p < 0.05 respectively; •: Significant differential regulation of PgWRKY genes at p < 0.05 or p < 0.01; -: PgWRKY genes were not significantly regulated.
Table 2. List of primers used for cloning of eight PgWRKYs (PgWRKY2-9).
Table 2. List of primers used for cloning of eight PgWRKYs (PgWRKY2-9).
Primer NameProduct Length (bp)Primer Sequence (5′ to 3′)
PgWRKY2-F1261TCTTTTGGGTGTGTGAAT
PgWRKY2-RTTTGGCGTTTGTATGGTA
PgWRKY3-F1196CTTTGCTTTTCCTTAGTTG
PgWRKY3-RATCATTATCTCTCTCCTTGG
PgWRKY4-F1233CTTTGCTTTTCCTTAGTTG
PgWRKY4-RAACAAACATTTCCAACCG
PgWRKY5-F1259TCTTTTGGGTGTGTGAAT
PgWRKY5-RTGGCGTTTGTATGGTAAT
PgWRKY6-F890CTTACCAGCCCTCTCCG
PgWRKY6-RATACTTTTGTAAGGAGGACTA
PgWRKY7-F700AAACGCTAAAACCCAAGA
PgWRKY7-RATTTTCTCTTGCTGACTTCT
PgWRKY8-F1071TGTGTGGGTTTGTCGTCT
PgWRKY8-RCGCTACTATTAAATCTTGGC
PgWRKY9-F987TCTCTCCTCCATAACAACT
PgWRKY9-RAAAAAAAGACAAATCCCC
Table 3. List of primers of eight PgWRKYs (PgWRKY2-9) and Pgβ-actin used for qRT-PCR analysis.
Table 3. List of primers of eight PgWRKYs (PgWRKY2-9) and Pgβ-actin used for qRT-PCR analysis.
Primer NameProduct Length (bp)Primer Sequence (5′ to 3′)
PgWRKY2-F115TTTATCTCCTCGTTGAGTGTCG
PgWRKY2-RACCTTCGTTTGTGCTGGTATG
PgWRKY3-F110CGGAAACCCAGACTCACG
PgWRKY3-RTCGGGACCCATTAGACATCA
PgWRKY4-F134CACCAACAGCATCAACAGCG
PgWRKY4-RATTCGGGACCCATTAGACATCA
PgWRKY5-F147GGAGCAATAGTGGCATCAACCTG
PgWRKY5-RGAGTCGCACCAATTAAATGGAAAG
PgWRKY6-F84CCATTCCCGTCAAGTTTCCAC
PgWRKY6-RCGGCAAAGTCTATGTTGTCAGG
PgWRKY7-F169CGACATTATCTTCCTTCAACTTTA
PgWRKY7-RACTCGCATTTGGGACGGC
PgWRKY8-F127ATGGATAACTCTCCCTCCCCTA
PgWRKY8-RCATTCTCTTCAATCTTCACTGC
PgWRKY9-F118GCAGAAAAGAGTGGTGTCCG
PgWRKY9-RAGGCTTTTGACCATACTTTC
Pgβ-Actin-F176GCGGTTGAGGTGGTGGGT
Pgβ-Actin-RGTCCTACTAACAAGGCAGAG

Share and Cite

MDPI and ACS Style

Xiu, H.; Nuruzzaman, M.; Guo, X.; Cao, H.; Huang, J.; Chen, X.; Wu, K.; Zhang, R.; Huang, Y.; Luo, J.; et al. Molecular Cloning and Expression Analysis of Eight PgWRKY Genes in Panax ginseng Responsive to Salt and Hormones. Int. J. Mol. Sci. 2016, 17, 319. https://doi.org/10.3390/ijms17030319

AMA Style

Xiu H, Nuruzzaman M, Guo X, Cao H, Huang J, Chen X, Wu K, Zhang R, Huang Y, Luo J, et al. Molecular Cloning and Expression Analysis of Eight PgWRKY Genes in Panax ginseng Responsive to Salt and Hormones. International Journal of Molecular Sciences. 2016; 17(3):319. https://doi.org/10.3390/ijms17030319

Chicago/Turabian Style

Xiu, Hao, Mohammed Nuruzzaman, Xiangqian Guo, Hongzhe Cao, Jingjia Huang, Xianghui Chen, Kunlu Wu, Ru Zhang, Yuzhao Huang, Junli Luo, and et al. 2016. "Molecular Cloning and Expression Analysis of Eight PgWRKY Genes in Panax ginseng Responsive to Salt and Hormones" International Journal of Molecular Sciences 17, no. 3: 319. https://doi.org/10.3390/ijms17030319

APA Style

Xiu, H., Nuruzzaman, M., Guo, X., Cao, H., Huang, J., Chen, X., Wu, K., Zhang, R., Huang, Y., Luo, J., & Luo, Z. (2016). Molecular Cloning and Expression Analysis of Eight PgWRKY Genes in Panax ginseng Responsive to Salt and Hormones. International Journal of Molecular Sciences, 17(3), 319. https://doi.org/10.3390/ijms17030319

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop