Characterization of a Functional Role of the Bradyrhizobium japonicum Isocitrate Lyase in Desiccation Tolerance
Abstract
:1. Introduction
2. Results
2.1. Purified AceA Has ICL Activity
Purification Steps | Soluble Protein (mg) | Total Activity (U) | Specific Activity (U/mg) |
---|---|---|---|
Cell-free extract | 45.2 | 36.2 | 0.8 |
Filtered on Ni-NTA column | 2.3 | 3.0 | 1.3 |
Purified ICL protein | 0.04 | 0.1 | 2.1 |
2.2. The aceA Mutant WC2455 Is Sensitive to Desiccation and Salt Stress
2.3. Involvement of AceA in Response to Desiccation Stress Is Independent of the Glyoxylate Pathway or the TCA Cycle
Locus (Gene) | Gene Description a | Desiccation | |
---|---|---|---|
Wild Type | WC2455 | ||
bll0452 (sucA) | alpha-ketoglutarate dehydrogenase | 1.0 | 1.0 |
bll0455 (sucC) | succinyl-CoA synthetase beta chain | −1.3 | −1.7 |
bll1474 (glcB) | malate synthase | −1.6 | 1.1 |
blr0512 (sdhC) | succinate dehydrogenase cytochrome | 1.3 | 1.0 |
blr2455 (aceA) | isocitrate lyase | 148.0 | ND b |
blr5747 (icdA) | isocitrate dehydrogenase | −1.3 | 1.1 |
blr6519 (fumC) | fumarase C | 1.6 | 1.2 |
2.4. Comparison of the Global Transcription Profiles in Wild Type and Mutant Strains
Physiological Process | Locus (Gene ID) a | Description b | Fold Induction |
---|---|---|---|
Chaperones | bsl3986 (cspA) | cold shock protein | 1.7 |
blr4637 | probable HspC2 heat shock protein | 1.6 | |
blr4635 (groEL) | chaperonin GroEL | 1.5 | |
blr4653 (dnaJ) | molecular chaperone DnaJ family | 1.7 | |
bll5219 (hspD) | small heat shock protein | 2.1 | |
blr5625 (groES) | 10 KD chaperonin | 2.5 | |
blr5626 (groEL) | 60 KDA chaperonin | 2.1 | |
Energy metabolism | blr1656 | putative glycosyl hydrolase | 2.0 |
bll3998 | probable succinate-semialdehyde dehydrogenase | 2.3 | |
blr4657 | beta-glucosidase | 1.6 | |
bll4784 | aldehyde dehydrogenase | 1.8 | |
blr6128 (cycB) | cytochrome c552 | 1.5 | |
blr7040 (napC) | cytochrome C-type protein | 2.1 | |
Heat shock response systems | blr0678 | heat shock protein 70 | 2.0 |
Translation | bll5377 (rpsK) | 30S ribosomal protein S11 | 1.8 |
bll5381 (rplO) | 50S ribosomal protein L15 | 1.6 | |
bsl5382 (rpmD) | 50S ribosomal protein L30 | 1.6 | |
bsl5391 (rpsQ) | 30S ribosomal protein S17 | 1.5 | |
bsl5392 (rpmC) | 50S ribosomal protein L29 | 1.8 | |
bll5397 (rplB) | 50S ribosomal protein L2 | 1.7 | |
bll5415 (rplK) | 50S ribosomal Protein L11 | 2.4 |
2.5. The Inactivation of AceA Results in Delayed Soybean Nodulation
3. Discussion
4. Experimental Section
4.1. Bacterial Strains and Culture Conditions
4.2. Desiccation Stress Assay
Strain or Plasmid | Genotypes, Relevant Characteristics | Source |
---|---|---|
B. japonicum strains | ||
USDA110 | wild type | USDA-ARS (Beltsville, MD, USA) |
WC2455 | aceA::Km | [25] |
WC2455-C | WC2455 complemented strain | [6] |
E. coli strains | ||
DH5α | supE44 ∆lacU169 (ø 80lacZ∆M15) hsdR17 recA1 endA1 gyrA96 thi-1 relA1 | [27] |
RIL(DE3) | argU (AGA, AGG), ileY (AUA), leuW (CUA) | Agilent (La Jolla, CA, USA) |
Plasmids | ||
pTE3 | complementing plasmid, Tcr | [28] |
pRK2073 | RK2, Tra+,Smr | [29] |
pGEM-T easy | cloning vector | Promega (Madison, WI, USA) |
pQE2 | expression vector, 6X His tag, T7 promoter | Qiagen (Valencia, CA, USA) |
pGEM-T easy::aceA | pGEM T easy containing 1.5 kb fragment including entire aceA gene | This study |
pTE-aceA | pTE3 containing 1.5 kb fragment of aceA | This study |
pHis-aceA | pQE2 containing 1.8 kb fragment of aceA | This study |
4.3. Salt Stress Assay
4.4. RNA Isolation and Microarray Analysis
4.5. qRT-PCR Analysis
Gene | Forward Sequence 5′–3′ | Reverse Sequence 5′−3′ |
---|---|---|
bll0452 | CGGCATCGACGACATCTACCTGAT | TCCAGATAGGGCTCGATGAAGTGC |
bll0455 | GAGACAGAGGAAGACGCCAAGGAA | GCCATGCCGTAGAGCTTGATGATG |
bll1474 | GCCTCCAAGCGCATCATGTTCATC | CATGTCGACGTTCCAGTCCTCGTA |
blr0512 | TTCAAGGCCAATGAGCGCGAAG | ACGATCCAGATCAGCACCGTCA |
blr2455 | GGCGACCAGTACAACAGCTT | GTCTCGATCCAGAGCAGGTC |
blr5747 | TGTCGACCAAGAACACCATCCTCA | TAGTTCTTGCAGGCCCAGACATAGC |
blr6519 | GGCCATTTCGAGCTCAACGTCTAC | CTGACGCAATGTTCGGTGAAGGAG |
bll0631 | TCAACCTTCTGACGGTGAACGC | TGCAGCAATTGCGACAGACCTT |
4.6. ICL Enzyme Assay
4.7. Construction of pQE2::AceA Strain
4.8. Purification of AceA Protein
4.9. Nodulation Assay
5. Conclusions
Supplementary Materials
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Bashan, Y. Inoculants of plant growth-promoting bacteria for use in agriculture. Biotechnol. Adv. 1998, 16, 729–770. [Google Scholar] [CrossRef]
- Mary, P.; Ochin, D.; Tailliez, R. Rates of drying and survival of Rhizobium meliloti strains during storage at different relative humidities. Appl. Environ. Microbiol. 1985, 50, 207–211. [Google Scholar] [PubMed]
- Streeter, J.G. Factors affecting the survival of Bradyrhizobium applied in liquid cultures to soya bean [Glycine max (L.) Merr.] seeds. J. Appl. Microbiol. 2007, 103, 1282–1290. [Google Scholar] [CrossRef] [PubMed]
- Cytryn, E.J.; Sangurdekar, D.P.; Streeter, J.G.; Franck, W.L.; Chang, W.-S.; Stacey, G.; Emerich, D.W.; Joshi, T.; Xu, D.; Sadowsky, M.J. Transcriptional and physiological responses of Bradyrhizobium japonicum to desiccation-induced stress. J. Bacteriol. 2007, 189, 6751–6762. [Google Scholar] [CrossRef] [PubMed]
- Donati, A.J.; Jeon, J.M.; Sangurdekar, D.; So, J.-S.; Chang, W.-S. Genome-wide transcriptional and physiological responses of Bradyrhizobium japonicum to paraquat-mediated oxidative stress. Appl. Environ. Microbiol. 2011, 77, 3633–3643. [Google Scholar] [CrossRef] [PubMed]
- Jeon, J.M.; Lee, H.-I.; Donati, A.J.; So, J.-S.; Emerich, D.W.; Woo-Suk Chang, W.-S.C. Whole-genome expression profiling of Bradyrhizobium japonicum in response to hydrogen peroxide. Mol. Plant Microbe Interact. 2011, 24, 1472–1481. [Google Scholar] [CrossRef] [PubMed]
- Fang, F.C.; Libby, S.J.; Castor, M.E.; Fung, A.M. Isocitrate lyase (AceA) is required for Salmonella persistence but not for acute lethal infection in mice. Infect. Immun. 2005, 73, 2547–2549. [Google Scholar] [CrossRef] [PubMed]
- Lorenz, M.C.; Fink, G.R. Life and death in a macrophage: Role of the glyoxylate cycle in virulence. Eukaryot. Cell 2002, 1, 657–662. [Google Scholar] [CrossRef] [PubMed]
- Dunn, M. Tricarboxylic acid cycle and anaplerotic enzymes in rhizobia. FEMS Microbiol. Rev. 1998, 22, 105–123. [Google Scholar] [CrossRef] [PubMed]
- Geddes, B.A.; Oresnik, I.J. Physiology, genetics, and biochemistry of carbon metabolism in the alphaproteobacterium Sinorhizobium meliloti. Can. J. Microbiol. 2014, 60, 491–507. [Google Scholar] [CrossRef] [PubMed]
- Li, S.; Xiao, X.; Li, J.; Luo, J.; Wang, F. Identification of genes regulated by changing salinity in the deep-sea bacterium Shewanella sp. WP3 using RNA arbitrarily primed PCR. Extremophiles 2006, 10, 97–104. [Google Scholar] [CrossRef] [PubMed]
- Watanabe, S.; Yamaoka, N.; Takada, Y.; Fukunaga, N. The cold-inducible icl gene encoding thermolabile isocitrate lyase of a psychrophilic bacterium, Colwellia maris. Microbiology 2002, 148, 2579–2589. [Google Scholar] [PubMed]
- Dunn, M.F.; Ramirez-Trujillo, J.A.; Hernandez-Lucas, I. Major roles of isocitrate lyase and malate synthase in bacterial and fungal pathogenesis. Microbiology 2009, 155, 3166–3175. [Google Scholar] [CrossRef] [PubMed]
- Munoz-Elias, E.J.; McKinney, J.D. Mycobacterium tuberculosis isocitrate lyases 1 and 2 are jointly required for in vivo growth and virulence. Nat. Med. 2005, 11, 638–644. [Google Scholar] [CrossRef] [PubMed]
- Sharma, V.; Sharma, S.; Hoener, Z.U.; Bentrup, K.; McKinney, J.D.; Russell, D.G.; Sacchettini, J.C. Structure of isocitrate lyase, a persistence factor of Mycobacterium tuberculosis. Nat. Struct. Biol. 2000, 7, 663–668. [Google Scholar] [CrossRef] [PubMed]
- Idnurm, A.; Howlett, B.J. Isocitrate lyase is essential for pathogenicity of the fungus Leptosphaeria maculans to canola (Brassica napus). Eukaryot. Cell 2002, 1, 719–724. [Google Scholar] [CrossRef] [PubMed]
- Pradheep, S.A.; Narayanan, S.; Vasan, S.K.; Narayanan, P.R. Cloning and expression of aceA gene encoding isocitrate lyase from Mycobacterium tuberculosis. Curr. Sci. 2000, 79, 1585–1588. [Google Scholar]
- Nollen, E.A.; Morimoto, R.I. Chaperoning signaling pathways: Molecular chaperones as stress-sensing “heat shock” proteins. J. Cell Sci. 2002, 115, 2809–2816. [Google Scholar] [PubMed]
- Chang, W.-S.; Franck, W.L.; Cytryn, E.; Jeong, S.; Joshi, T.; Emerich, D.W.; Sadowsky, M.J.; Xu, D.; Stacey, G. An oligonucleotide microarray resource for transcriptional profiling of Bradyrhizobium japonicum. Mol. Plant Microbe Interact. 2007, 20, 1298–1307. [Google Scholar] [CrossRef] [PubMed]
- Tao, H.; Bausch, C.; Richmond, C.; Blattner, F.R.; Conway, T. Functional genomics: Expression analysis of Escherichia coli growing on minimal and rich media. J. Bacteriol. 1999, 181, 6425–6440. [Google Scholar] [PubMed]
- Fisher, M.A.; Plikaytis, B.B.; Shinnick, T.M. Microarray analysis of the Mycobacterium tuberculosis transcriptional response to the acidic conditions found in phagosomes. J. Bacteriol. 2002, 184, 4025–4032. [Google Scholar] [CrossRef] [PubMed]
- Hamel, R.; Appanna, V.D.; Viswanatha, T.; Puiseux-Dao, S. Overexpression of isocitrate lyase is an important strategy in the survival of Pseudomonas fluorescens exposed to aluminum. Biochem. Biophys. Res. Commun. 2004, 317, 1189–1194. [Google Scholar] [CrossRef] [PubMed]
- Karlekar, K.; Parekh, T.V.; Chhatpar, H.S. Salt mediated changes in some enzymes of carbohydrate-metabolism in halotolerant Cladosporium sphaerospermum. J. Biosci. 1985, 9, 197–201. [Google Scholar] [CrossRef]
- Sadowsky, M.J.; Tully, R.E.; Cregan, P.B.; Keyser, H.H. Genetic diversity in Bradyrhizobium japonicum serogroup 123 and its relation to genotype-specific nodulation of soybean. Appl. Environ. Microbiol. 1987, 53, 2624–2630. [Google Scholar] [PubMed]
- Franck, W.L.; Chang, W.-S.; Qiu, J.; Sugawara, M.; Sadowsky, M.J.; Stephanie, A.; Smith, S.A.S.; Gary Stacey, G.S. Whole-genome transcriptional profiling of Bradyrhizobium japonicum during chemoautotrophic growth. J. Bacteriol. 2008, 190, 6697–6705. [Google Scholar] [CrossRef] [PubMed]
- Bergersen, F.J. The growth of rhizobia in synthetic media. Aust. J. Biol. Sci. 1961, 14, 349–360. [Google Scholar]
- Sambrook, J.; Fritsch, E.F.; Maniatis, T. Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory: Cold Spring Harbor, NY, USA, 1989; Volume 3, p. A.10. [Google Scholar]
- Egelhoff, T.T.; Fisher, R.F.; Jacobs, T.W.; Mulligan, J.T.; Long, S.R. Nucleotide sequence of Rhizobium meliloti 1021 nodulation genes: nodD is read divergently from nodABC. DNA 1985, 4, 241–248. [Google Scholar] [CrossRef] [PubMed]
- Leong, S.A.; Ditta, G.S.; Helinski, D.R. Heme biosynthesis in Rhizobium. Identification of a cloned gene coding for delta-aminolevulinic acid synthetase from Rhizobium meliloti. J. Biol. Chem. 1982, 257, 8724–8730. [Google Scholar] [PubMed]
- Bittner, M.; Butow, R.; DeRisi, J.; Diehn, M.; Eberwine, J.; Epstein, C.B.; Glynne, R.; Grimmond, S.; Ideker, T.; Kacharmina, J.E.; et al. Expression analysis of RNA. In DNA Microarrays; Bowtell, D., Sambrook, J., Eds.; Cold Spring Harbor Laboratory: Cold Spring Harbor, NY, USA, 2003; pp. 101–288. [Google Scholar]
- Green, L.S.; Karr, D.B.; Emerich, D.W. Isocitrate dehydrogenase and glyoxylate cycle enzyme activities in Bradyrhizobium japonicum under various growth conditions. Arch. Microbiol. 1998, 169, 445–451. [Google Scholar] [CrossRef] [PubMed]
- Chell, R.M.; Sundaram, T.K.; Wilkinson, A.E. Isolation and characterization of isocitrate lyase from a thermophilic Bacillus sp. Biochem. J. 1978, 173, 165–177. [Google Scholar] [PubMed]
- Lee, H.-I.; Lee, J.-H.; Park, K.-H.; Sangurdekar, D.; Chang, W.-S. Effect of soybean coumestrol on Bradyrhizobium japonicum nodulation ability, biofilm formation, and transcriptional profile. Appl. Environ. Microbiol. 2012, 78, 2896–2903. [Google Scholar] [CrossRef] [PubMed]
- Donati, A.J.; Lee, H.-I.; Leveau, J.H.; Chang, W.-S. Effects of indole-3-acetic acid on the transcriptional activities and stress tolerance of Bradyrhizobium japonicum. PLoS ONE 2013, 8, e76559. [Google Scholar] [CrossRef] [PubMed]
- Broughton, W.J.; Dilworth, M.J. Control of leghaemoglobin synthesis in snake beans. Biochem. J. 1971, 125, 1075–1080. [Google Scholar]
© 2015 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jeon, J.-M.; Lee, H.-I.; Sadowsky, M.J.; Sugawara, M.; Chang, W.-S. Characterization of a Functional Role of the Bradyrhizobium japonicum Isocitrate Lyase in Desiccation Tolerance. Int. J. Mol. Sci. 2015, 16, 16695-16709. https://doi.org/10.3390/ijms160716695
Jeon J-M, Lee H-I, Sadowsky MJ, Sugawara M, Chang W-S. Characterization of a Functional Role of the Bradyrhizobium japonicum Isocitrate Lyase in Desiccation Tolerance. International Journal of Molecular Sciences. 2015; 16(7):16695-16709. https://doi.org/10.3390/ijms160716695
Chicago/Turabian StyleJeon, Jeong-Min, Hae-In Lee, Michael J. Sadowsky, Masayuki Sugawara, and Woo-Suk Chang. 2015. "Characterization of a Functional Role of the Bradyrhizobium japonicum Isocitrate Lyase in Desiccation Tolerance" International Journal of Molecular Sciences 16, no. 7: 16695-16709. https://doi.org/10.3390/ijms160716695