Inhibition of the IgE-Mediated Activation of RBL-2H3 Cells by TIPP, a Novel Thymic Immunosuppressive Pentapeptide
Abstract
:1. Introduction

2. Results
2.1. Cytotoxicity of Thymic Immunosuppressive Pentapeptide (TIPP) on RBL-2H3 Cells


2.2. Optimum Conditions for IgE-Mediated Degranulation in RBL-2H3 Cells
2.3. Effect of TIPP on the Release of β-Hexosaminidase and Histamine in IgE-Antigen Complex-Stimulated RBL-2H3 Cells
2.4. Effect of TIPP on the Intracellular Calcium Level

2.5. Effects of TIPP on the mRNA Levels of Pro-Inflammatory Cytokines


2.6. The Inhibitory Effect of TIPP on Membrane Ruffling

2.7. The Interaction of TIPP and RBL-2H3 Cells

2.8. The Inhibitory Effect of TIPP on Cyclooxygenase-2 (COX-2) Expression

2.9. Effects of TIPP on Mitogen-Activated Protein (MAP) Kinase Activation

2.10. Effect of TIPP on Extracellular Signal-Regulated Protein Kinase (ERK)/ERK Kinase (MEK) Signaling Pathway
2.11. Effect of TIPP on the Nuclear Translocation of NF-κB

3. Discussion
4. Experimental Section
4.1. Reagents
4.2. Cell Culture
4.3. Cytotoxicity Assay of TIPP on RBL-2H3 Cells
4.4. Cell Sensitization and Stimulation for Degranulation Assay
4.5. β-Hexosaminidase Activity and Histamine Content Determination
4.6. Measurement of Intracellular Calcium
4.7. Quantification PCR
| Genes | Forward Primer (5'→3') | Reverse Primer (5'→3') |
|---|---|---|
| IL-3 | CCAGATTTCAGACAGGGGCTC | CAGGTTTACTCTCCGCAAGGT |
| IL-4 | TCCACGGATGTAACGACAGC | TCATTCACGGTGCAGCTTCT |
| IL-6 | CACTTCACAAGTCGGAGGCT | TCTGACAGTGCATCATCGCT |
| IL-13 | ATGGTATGGAGCGTGGACCT | AGCGGAAAAGTTGCTTGGAG |
| TNF-α | ATGGGCTCCCTCTCATCAGT | GAAATGGCAAATCGGCTGAC |
| MCP-1 | AGCCAACTCTCACTGAAGCC | AACTGTGAACAACAGGCCCA |
| COX-2 | TGACTTTGGCAGGCTGGATT | ACTGCACTTCTGGTACCGTG |
| β-actin | GCATTGCTGACAGGATGCAG | GTAACAGTCCGCCTAGAAGCA |
4.8. Confocal Fluorescence Microscope Observation
4.9. Flow Cytometry Analysis
4.10. Western Blot Analysis
4.11. Statistical Analysis
5. Conclusions
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Amin, K. The role of mast cells in allergic inflammation. Respir. Med. 2012, 106, 9–14. [Google Scholar] [CrossRef] [PubMed]
- Moiseeva, E.P.; Bradding, P. Mast cells in lung inflammation. In Mast Cell Biology: Contemporary and Emerging Topics; Gilfillan, A.M., Metcalfe, D.D., Eds.; Springer: New York, NY, USA, 2011; Volume 716, pp. 235–269. [Google Scholar]
- Choi, Y.; Kim, M.S.; Hwang, J.K. Inhibitory effects of panduratin A on allergy-related mediator production in rat basophilic leukemia mast cells. Inflammation 2012, 35, 1904–1915. [Google Scholar] [CrossRef] [PubMed]
- Rivera, J.; Gilfillan, A.M. Molecular regulation of mast cell activation. J. Allergy Clin. Immunol. 2006, 117, 1214–1225. [Google Scholar] [CrossRef] [PubMed]
- Houck, J.C.; Hennings, H. Chalones specific endogenous mitotic inhibitors. FEBS Lett. 1973, 32, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Allen, J.C.; Smith, J.C.; Curry, M.C.; Gaugas, J.M. Identification of a thymic inhibitor (“chalone”) of lymphocyte transformation as a spermine complex. Nature 1977, 267, 623–625. [Google Scholar] [CrossRef] [PubMed]
- Kiger, N.; Florentin, I.; Lorans, G.; Mathe, G. Further purification and chemical characterization of the lymphocyte-inhibiting-factor extracted from thymus (LIFT). Immunology 1977, 33, 439–448. [Google Scholar] [PubMed]
- Houck, J.C.; Irausquin, H.; Leikin, S. Lymphocyte DNA synthesis inhibition. Science 1971, 173, 1139–1141. [Google Scholar] [CrossRef] [PubMed]
- Blazsek, I. Inhibition of lymphocyte production via thymic factors. Blut 1981, 42, 235–248. [Google Scholar] [CrossRef] [PubMed]
- Maschler, R.; Maurer, H.R. Screening for specific calf thymus inhibitors (chalones) of T-lymphocyte proliferation. Hoppe Seylers Z. Physiol. Chem. 1979, 360, 735–746. [Google Scholar] [CrossRef] [PubMed]
- Patt, L.; Gleisner, J.; Barrantes, D.; Houck, J. Low molecular weight inhibitors of lymphocyte transformation. Pharmacology 1981, 23, 117–127. [Google Scholar] [CrossRef] [PubMed]
- Zhao, S.M.; Zhang, T.G.; Yue, Q.A.; Zang, H.C.; Wang, F.S.; Wang, H.Y. The effect of U2 fraction of porcine thymus immnosuppressive extract on lymphocyte proliferation. Chin. J. Biochem. Pharm. 2003, 24, 133–134. [Google Scholar]
- Shang, X.Y.; Zhang, S.L.; Jiao, B.; Lu, F.Y.; Tian, G.; Li, F.C. Anti-allergic effects of thymic immunosuppressive fraction. Chin. Pharmacol. Bull. 1996, 21, 360–361. [Google Scholar]
- Xin, X.L.; Zhang, S.L.; Wang, F.S. Effects of thymic immunosuppressive extract on mouse immune fuctions. Chin. J. Biochem. Pharm. 1996, 17, 185–187. [Google Scholar]
- Kim, H.H.; Yoo, J.S.; Lee, H.S.; Kwon, T.K.; Shin, T.Y.; Kim, S.H. Elsholtzia ciliata inhibits mast cell-mediated allergic inflammation: Role of calcium, p38 mitogen-activated protein kinase and nuclear factor-κB. Exp. Biol. Med. 2011, 236, 1070–1077. [Google Scholar] [CrossRef]
- Sahara, N.; Siraganian, R.P.; Oliver, C. Morphological changes induced by the calcium ionophore A23187 in rat basophilic leukemia (2H3) cells. J. Histochem. Cytochem. 1990, 38, 975–983. [Google Scholar] [CrossRef] [PubMed]
- Siraganian, R.P. Mast cell signal transduction from the high-affinity IgE receptor. Curr. Opin. Immunol. 2003, 15, 639–646. [Google Scholar] [CrossRef] [PubMed]
- Gilfillan, A.M.; Tkaczyk, C. Integrated signalling pathways for mast-cell activation. Nat. Rev. Immunol. 2006, 6, 218–230. [Google Scholar] [CrossRef] [PubMed]
- Chung, M.J.; Sohng, J.K.; Choi, D.J.; Park, Y.I. Inhibitory effect of phloretin and biochanin A on IgE-mediated allergic responses in rat basophilic leukemia RBL-2H3 cells. Life Sci. 2013, 93, 401–408. [Google Scholar] [CrossRef] [PubMed]
- Cho, D.I.; Kim, S.Y.; Zheng, M.; Jin, M.; Choi, H.K.; Yi, A.K.; Kim, K.M. Identification of cis-acting elements and signaling components of high affinity IgE receptor that regulate the expression of cyclooxygenase-2. Cell. Physiol. Biochem. 2012, 29, 725–736. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.H.; Seo, J.Y.; Ko, N.Y.; Chang, S.H.; Her, E.; Park, T.; Lee, H.Y.; Han, J.W.; Kim, Y.M.; Choi, W.S. Inhibitory activity of Chrysanthemi sibirici herba extract on RBL-2H3 mast cells and compound 48/80-induced anaphylaxis. J. Ethnopharmacol. 2004, 95, 425–430. [Google Scholar] [CrossRef] [PubMed]
- Roskoski, R., Jr. ERK1/2 MAP kinases: Structure, function, and regulation. Pharmacol. Res. 2012, 66, 105–143. [Google Scholar] [CrossRef] [PubMed]
- Brasier, A.R. The NF-κB regulatory network. Cardiovasc. Toxicol. 2006, 6, 111–130. [Google Scholar] [CrossRef] [PubMed]
- Liang, Y.; Zhou, Y.; Shen, P. NF-κB and its regulation on the immune system. Cell. Mol. Immunol. 2004, 1, 343–350. [Google Scholar] [PubMed]
- Oh, Y.C.; Kang, O.H.; Choi, J.G.; Lee, Y.S.; Brice, O.O.; Jung, H.J.; Hong, S.H.; Lee, Y.M.; Shin, D.W.; Kim, Y.S.; et al. Anti-allergic activity of a platycodon root ethanol extract. Int. J. Mol. Sci. 2010, 11, 2746–2758. [Google Scholar] [CrossRef]
- Lorenz, W.; Benesch, L.; Barth, H.; Matejka, E.; Meyer, R.; Kusche, J.; Hutzel, M.; Werle, E. Fluorometric assay of histamine in tissues and body fluids: Choice of the purification procedure and identification in the nanogram range. Fresenius Z. Anal. Chem. 1970, 252, 94–98. [Google Scholar] [CrossRef]
- Yamada, P.; Isoda, H.; Han, J.K.; Talorete, T.P.; Abe, Y. Inhibitory effect of fulvic acid extracted from Canadian sphagnum peat on chemical mediator release by RBL-2H3 and KU812 cells. Biosci. Biotechnol. Biochem. 2007, 71, 1294–1305. [Google Scholar] [CrossRef] [PubMed]
- Palmer, R.K.; Hutchinson, L.M.; Burpee, B.T.; Tupper, E.J.; Pelletier, J.H.; Kormendy, Z.; Hopke, A.R.; Malay, E.T.; Evans, B.L.; Velez, A.; et al. Antibacterial agent triclosan suppresses RBL-2H3 mast cell function. Toxicol. Appl. Pharmacol. 2012, 258, 99–108. [Google Scholar] [CrossRef]
- Miao, B.; Geng, M.; Li, J.; Li, F.; Chen, H.; Guan, H.; Ding, J. Sulfated polymannuroguluronate, a novel anti-acquired immune deficiency syndrome (AIDS) drug candidate, targeting CD4 in lymphocytes. Biochem. Pharmacol. 2004, 68, 641–649. [Google Scholar] [CrossRef] [PubMed]
© 2015 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lian, Q.; Cheng, Y.; Zhong, C.; Wang, F. Inhibition of the IgE-Mediated Activation of RBL-2H3 Cells by TIPP, a Novel Thymic Immunosuppressive Pentapeptide. Int. J. Mol. Sci. 2015, 16, 2252-2268. https://doi.org/10.3390/ijms16012252
Lian Q, Cheng Y, Zhong C, Wang F. Inhibition of the IgE-Mediated Activation of RBL-2H3 Cells by TIPP, a Novel Thymic Immunosuppressive Pentapeptide. International Journal of Molecular Sciences. 2015; 16(1):2252-2268. https://doi.org/10.3390/ijms16012252
Chicago/Turabian StyleLian, Qianqian, Yanna Cheng, Chuanqing Zhong, and Fengshan Wang. 2015. "Inhibition of the IgE-Mediated Activation of RBL-2H3 Cells by TIPP, a Novel Thymic Immunosuppressive Pentapeptide" International Journal of Molecular Sciences 16, no. 1: 2252-2268. https://doi.org/10.3390/ijms16012252
APA StyleLian, Q., Cheng, Y., Zhong, C., & Wang, F. (2015). Inhibition of the IgE-Mediated Activation of RBL-2H3 Cells by TIPP, a Novel Thymic Immunosuppressive Pentapeptide. International Journal of Molecular Sciences, 16(1), 2252-2268. https://doi.org/10.3390/ijms16012252
