Tetra-Repeat Microsatellite Markers for the Masu Salmon (Oncorhynchus masou masou) and Its Application in Cross-Subspecies Amplification
Abstract
:1. Introduction
2. Results and Discussion
3. Experimental Section
3.1. Isolation of Microsatellite Markers
3.2. PCR Amplification and Genotyping
3.3. Data Analysis
4. Conclusions
| Marker | Motif *1 | Primer sequences (5′-3′) *2 | Ta *3 | RA (bp) *4 | GenBank No. | |
|---|---|---|---|---|---|---|
| OMAS-3 | (AGAC)14 | F-N | AGAGACAGATAGAGCCAGCCAG | 60 | 127–199 | AB851460 |
| R | TGATGAACGTTACGATTGGAAG | |||||
| OMAS-4 | (CACT)12 | F-P | TGCACATAAATTGAAGGCAAAC | 60 | 137–249 | AB851461 |
| R | GAGTCACCTGTCCCTCAGTACC | |||||
| OMAS-5 | (TCTG)13 | F-F | TTTTGCTGGTGACTCCCTAAAT | 60 | 236–348 | AB851462 |
| R | ATTTGCAGAGGGAAACAGACAT | |||||
| OMAS-7 | (AGAC)16 | F-N | GGGAAAGAAAGGAGATTGAGAGA | 60 | 235–295 | AB851463 |
| R | GACCCTGGTAGAACTGCAAACT | |||||
| OMAS-10 | (GAGG)6 | F-V | AGCAAAGGGAGATAAGGTAGGG | 60 | 305–313 | AB851464 |
| R | CATCTTCATTCAGAGGGGTAGG | |||||
| OMAS-14 | (GAGT)7 | F-F | ATTGTTAGAGCGGGAGACGATA | 60 | 98–138 | AB851465 |
| R | TCCCCAGAATTGTTAGCTGAGT | |||||
| OMAS-18 | (ATCA)9 | F-V | CACACAAAGAAAACCTTGAATGA | 60 | 113–157 | AB851466 |
| R | AACGTGACTGCACAACAAAGTT |
| Subspecies | River/Lake | Statistics of polymorphisms *1 | OMAS-3 | OMAS-4 | OMAS-5 | OMAS-7 | OMAS-10 | OMAS-14 | OMAS-18 |
|---|---|---|---|---|---|---|---|---|---|
| Oncorhynchus masou masou | Chitose River | Ho | 0.86 | 0.93 | 0.73 | 0.90 | 0.50 | 0.67 | 0.31 |
| HE | 0.89 | 0.90 | 0.84 | 0.86 | 0.62 | 0.75 | 0.74 | ||
| HW_P | 0.12 | 0.01 * | 0.00 * | 0.09 | 0.10 | 0.02 | 0.00 * | ||
| Number of Alleles | 15 | 17 | 17 | 12 | 3 | 8 | 7 | ||
| n | 43 | 42 | 40 | 42 | 42 | 43 | 35 | ||
| Oncorhynchus masou ishikawae | Miya River | Ho | 0.46 | 0.83 | 0.75 | 0.24 | - | 0.60 | 0.15 |
| HE | 0.44 | 0.85 | 0.75 | 0.61 | - | 0.44 | 0.14 | ||
| HW_P | 1.00 | 0.00 * | 0.02 | 0.00 * | - | 0.02 | 1.00 | ||
| Number of Alleles | 5 | 8 | 6 | 6 | 1 | 2 | 3 | ||
| n | 48 | 48 | 48 | 41 | 48 | 48 | 48 | ||
| Oncorhynchus masou subsp. | Lake Biwa | Ho | 0.78 | 0.87 | 0.78 | 0.78 | 0.06 | 0.53 | 0.81 |
| HE | 0.81 | 0.89 | 0.86 | 0.85 | 0.06 | 0.62 | 0.78 | ||
| HW_P | 0.66 | 0.80 | 0.10 | 0.11 | 1.00 | 0.60 | 0.98 | ||
| Number of Alleles | 9 | 14 | 11 | 9 | 2 | 7 | 7 | ||
| n | 32 | 31 | 32 | 32 | 32 | 32 | 32 | ||
| Oncorhynchus masou masou (hatchery stock) | Oohara River | Ho | 0.79 | 0.64 | 0.84 | 0.71 | 0.56 | 0.79 | 0.14 |
| HE | 0.71 | 0.69 | 0.86 | 0.67 | 0.53 | 0.68 | 0.27 | ||
| HW_P | 0.56 | 0.47 | 0.02 | 0.69 | 0.91 | 0.37 | 0.00 * | ||
| Number of Alleles | 7 | 6 | 8 | 4 | 3 | 4 | 3 | ||
| n | 39 | 39 | 38 | 38 | 39 | 39 | 37 | ||
| Average | - | Ho | 0.72 | 0.82 | 0.77 | 0.66 | 0.37 | 0.65 | 0.35 |
| HE | 0.71 | 0.83 | 0.83 | 0.75 | 0.40 | 0.62 | 0.48 | ||
| Number of Alleles | 9 | 11 | 11 | 8 | 2 | 5 | 5 | ||
Acknowledgments
Conflicts of Interest
References
- Kato, F. Life Histories of Masu and Amago Salmon (Oncorhynchus masou and Oncorhynchus rhodurus). In Pacific Salmon Life Histories; Groot, C., Margolis, L., Eds.; UBC Press: Vancouver, BC, Canada, 1991; pp. 447–520. [Google Scholar]
- Taki, Y.; Kohno, H.; Sakamoto, K.; Hosoya, K. Illustrated Fishes in Colour, revised edition; Hokuryukan: Tokyo, Japan, 2005. [Google Scholar]
- Yan, H.Y. Threatened fishes of the world: Oncorhynchus masou formosanus (Jordan & Oshima, 1919) (Salmonidae). Environ. Biol. Fishes 2000, 57, 314. [Google Scholar]
- Oohara, I.; Okazaki, T. Genetic relationship among three subspecies of Oncorhynchus masou determined by mitochondrial DNA sequence analysis. Zool. Sci 1996, 13, 189–198. [Google Scholar]
- Kawamura, K.; Kubota, M.; Furukawa, M.; Harada, Y. The genetic structure of endangered indigenous populations of the amago salmon, Oncorhynchus masou ishikawae, in Japan. Conserv. Genet 2007, 8, 1163–1176. [Google Scholar]
- Kawamura, K.; Furukawa, M.; Kubota, M.; Harada, Y. Effects of stocking hatchery fish on the phenotype of indigenous populations in the Amago salmon Oncorhynchus masou ishikawae in Japan. J. Fish Biol 2012, 81, 94–109. [Google Scholar]
- Yamazaki, Y.; Shimada, N.; Tago, Y. Detection of hybrids between masu salmon Oncorhychus masou masou and amago salmon O. m. ishikawae occurred in the Jinzu River using a random amplified polymorphic DNA technique. Fish. Sci 2005, 71, 320–326. [Google Scholar]
- Kuwahara, M.; Takahashi, H.; Kikko, T.; Kurumi, S.; Iguchi, K. Introgression of Oncorhynchus masou subsp. (Biwa salmon) genome into lake-run O. m. ishikawae (amago salmon) introduced into Lake Biwa, Japan. Ichthyol. Res 2012, 59, 195–201. [Google Scholar]
- Yamamoto, S.; Morita, K.; Koizumi, I.; Maekawa, K. Genetic differentiation of white-spotted charr (Salvelinus leucomaenis) populations after habitat fragmentation: Spatial-temporal changes in gene frequencies. Conserv. Genet 2004, 5, 529–538. [Google Scholar]
- Miyahara, H.; Yamada, H.; Sato, T.; Harada, Y.; Yamamoto, S.; Kawamura, K. Mitochondrial-nuclear discordance in the amago salmon, Oncorhynchus masou ishikawae, in the River Miya, Japan. Conserv. Genet 2012, 13, 1343–1353. [Google Scholar]
- Ministry of the Environment, Japan. Red List. Brackish and Freshwater Fishes. Available online: http://www.env.go.jp/press/file_view.php?serial=9944&hou_id=8648 (accessed on 19 November 2011).
- Lin, Y-S.; Yang, P.S.; Liang, S.H.; Tsao, S.H.; Juang, L.C. Ecological studies of Formosan landlocked salmon, Oncorhynchus masou formosanus. I. Preliminary study on the relationship between population distribution and environmental factors in Wuling Farm. In Ecological Research No. 23; 1987; Council of Agriculture, executive Yuan: Taipei, Taiwan. [Google Scholar]
- Kottelat, M. Oncorhynchus Formosanus. IUCN 2013 IUCN Red List of Threatened Species. Ver. 2013.1. 1996. Available online: http://www.iucnredlist.org (accessed on 15 November 2013).
- Sato, T.; Gwo, J.-C. Demographic and genetic consequences of population subdivision in Formosa land-locked salmon Oncorhynchus masou formosanus, the southernmost subspecies of the salmonids. Ichthyol. Res 2011, 58, 209–216. [Google Scholar]
- Noguchi, D.; Ikeda, M.; Nakajima, M.; Taniguchi, N. Isolation and characterization of microsatellite DNA markers for population genetics study of masu salmon Oncorhynchus masou masou. Fish Genet. Breed. Sci 2003, 33, 61–66. [Google Scholar]
- Nakamura, Y.; Shigenobu, Y.; Sugaya, T.; Kurokawa, T.; Saitoh, K. Automated screening and primer design of fish microsatellite DNA loci on pyrosequencing data. Ichthyol. Res 2013, 60, 184–187. [Google Scholar]
- Excoffier, L.; Lischer, H.E.L. Arlequin suite ver 3.5: A new series of programs to perform population genetic analyses under Linux and Windows. Mol. Ecol. Resour 2010, 10, 564–567. [Google Scholar]
- Benjamini, Y.; Hochberg, Y. Controlling the false discovery rate: A practical and powerful approach to multiple testing. J. R. Stat. Soc. Ser. B 1995, 57, 289–300. [Google Scholar]
© 2013 by the authors; licensee MDPI, Basel, Switzerland This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).
Share and Cite
Yamamoto, S.; Kurokawa, T.; Sekino, M.; Yasuike, M.; Saitoh, K. Tetra-Repeat Microsatellite Markers for the Masu Salmon (Oncorhynchus masou masou) and Its Application in Cross-Subspecies Amplification. Int. J. Mol. Sci. 2013, 14, 23153-23159. https://doi.org/10.3390/ijms141123153
Yamamoto S, Kurokawa T, Sekino M, Yasuike M, Saitoh K. Tetra-Repeat Microsatellite Markers for the Masu Salmon (Oncorhynchus masou masou) and Its Application in Cross-Subspecies Amplification. International Journal of Molecular Sciences. 2013; 14(11):23153-23159. https://doi.org/10.3390/ijms141123153
Chicago/Turabian StyleYamamoto, Shoichiro, Tadahide Kurokawa, Masashi Sekino, Motoshige Yasuike, and Kenji Saitoh. 2013. "Tetra-Repeat Microsatellite Markers for the Masu Salmon (Oncorhynchus masou masou) and Its Application in Cross-Subspecies Amplification" International Journal of Molecular Sciences 14, no. 11: 23153-23159. https://doi.org/10.3390/ijms141123153
APA StyleYamamoto, S., Kurokawa, T., Sekino, M., Yasuike, M., & Saitoh, K. (2013). Tetra-Repeat Microsatellite Markers for the Masu Salmon (Oncorhynchus masou masou) and Its Application in Cross-Subspecies Amplification. International Journal of Molecular Sciences, 14(11), 23153-23159. https://doi.org/10.3390/ijms141123153

