Significant Overexpression of DVL1 in Taiwanese Colorectal Cancer Patients with Liver Metastasis
Abstract
:1. Introduction
2. Results and Discussion
2.1. Results
2.1.1. Identification of Candidate Genes by Microarray Analysis and Bioinformatics
2.1.2. Correlation between Liver Metastasis and Clinicopathological Features
2.1.3. Correlation between DVL1 Expression with Clinicopathological Data
2.1.4. Correlation between DVL1 Expression and Liver Metastasis
2.1.5. Localization and Expression of DVL1 in Human CRC Tissue by Immunohistochemical Stain (IHC) and the Correlation with Clinicopathological Data
2.2. Discussion
3. Experimental Section
3.1. Clinical Samples Collection
3.2. Total RNA Extraction and First Strand cDNA Synthesis
3.3. Oligonucleotide Microarray Analysis
3.4. Preparation of Biotin-Labeled cDNA Targets and Hybridization
3.5. Weighted Enzymatic Chip Array (WEnCA)
3.6. Immunohistochemistry
3.7. Statistical and Database Analysis
4. Conclusions
Gene | Oligonucleotide sequences (5′ → 3′) |
---|---|
PSG2 | CTCGGAAACTTTTGGTGGCTGGGCTTCAATCGTGACTTGGGCAGT |
TMPO | TGCAGCCCCTTTGATTGGTCTGCGGCAACTAGCACTAATTCCTGT |
CD55 | AGTTGCAGTAAGCAGAAGCCTCGTGGCTCCGCAATACCAGTTAAA |
DVL1 | GAGCGTGACAGTGACGATGTTGAGGGACATGGTGGAGTCGGTTAT |
ELAVL4 | TTGCCCCTGTTTGCATGGGAGAAGGACAGTTTCTGTTGTTGCTGG |
PDX1 | TAGAAAGTTCCGAATATCTTTGGTTTAGTGGTCACCCAGGGGTCC |
CTHRC1 | CAACCCAGATAGCAACATCCACTAATCCAGCACCAATTCCTTCAC |
CA9 | CCTTCCTCAGCGATTTCTTCCAAGCGAGACAGCAACTGCTCATAG |
TK1 | CAGGGAGAACAGAAACTCAGCAGTGAAAGCCGCAGAGGGGAAGAA |
UBE2C | AACTTCACTGTGGGCGCATTGTAAGGGTAGCCACTGGGGAACTCT |
FOXM1 | ACTTGGGGCATTTTGAACAGGAAGGGGCAGCCTCCGTCTTTTGAG |
PDE6D | TGCCAGAGTATCTTCCCTGTCTCAGCATCCCGAAGGTTCATCCAA |
PSAT1 | TTGACCTTGAATCAACAGCCGCTGAACCCAGGAGACCCCACAGAT |
CHRNB1 | TAGGGTCCCAACGCTGGTGAAGATGATGAAAGTCCACAGGAAGAG |
CEA | TGGTGGGCGGGTTCCAGAAGTTTAGAAGTGAGGCTGTGAGCAGAA |
BMI1 | CGAGGTCTATTGGCAAAAGAAGATTGGTGGTTACCGCTGGGGCTG |
CAP2 | ACATGGCGGAGCCCTTTTGTAATTGCTTCTCCCTGGTTAAGTTGG |
MMP13 | AAAGTGGCTTTTGCCGGTGTAGGTGTAGATAGGAAACATGAGTGC |
OLFM4 | AGCAGGTGCCTCATCTACAGATCCTTCTGGGATTTATTTGCCATG |
PTTG1 | TATCTATGTCACAGCAAACAGGTGGCAATTCAACATCCAGGGTCG |
MYC | CTGACCTTTTGCCAGGAGCCTGCCTCTTTTCCACAGAAACAACAT |
MET | CCCGAGTTCTTTCTATTGATGCGTTCATGCTCTTGACCCTGGTAG |
ENO2 | CCTTTCTATGACCCTTCCCATTCTAGCAAGACCTCCCACCCCAGT |
MUC1 | TCTTTCGGCGGCACTGACAGACAGCCAAGGCAATGAGATAGACAA |
KRT19 | ACCTTGGAGGCAGACAAATTGTTGTAGTGATCTTCCTGTCCCTCG |
BIRC5 | CTCTAACCTGCCATTGGAACCTCACCCATAGCCCAGAAGCCTCAT |
HMGB1 | ATTGCAGCCTATCACTAACCCTGCTGTTCGCTTGCATGTATCTTG |
KRT20 | GGGCGTTGGTTTCGTACCACTGCTTGATTTGCACTTCAAGTTTGG |
hTERT | AGGGGTGAACAATGGCGAATCTGGGGATGGACTATTCCTATGTGG |
GCNT1 | GTGTTTGTCAGCTTTCCATTAACGACCTCATACCGCTTCTTCCAC |
NPM1 | TTTGTCTCCCCACCATTTCCATGTCTGACCACCGCTACTACTATG |
Oryza sativa | CTCGGTAACCTCTCATTCCTCTACACCCTCGACCTCACCAACACCAGCCT |
β-actin | ATGCTCGCTCCAACCGACTGCTGTCACCTTCACCGTTCCAGTTTT |
Characteristics | Total cases | Liver metastasis N (%) | No Liver metastasis N (%) | p-Value * |
---|---|---|---|---|
Gender | ||||
Male | 116 | 20 (17.2) | 96 (82.8) | 0.488 |
Female | 98 | 21 (21.4) | 77 (78.6) | |
Age (years) | ||||
<60 | 73 | 15 (20.8) | 58 (80.6) | 0.714 |
≥60 | 141 | 26 (18.3) | 115 (81.0) | |
Tumor size a | ||||
<5 cm | 109 | 20 (18.3) | 89 (81.7) | 0.862 |
≥5 cm | 105 | 21 (20.0) | 84 (80.0) | |
Stage (UICC) b | ||||
I–II | 110 | 19 (17.3) | 91 (82.7) | 0.492 |
III | 104 | 22 (21.2) | 82 (78.8) | |
Vascular invasion | ||||
Positive | 90 | 18 (20.0) | 72 (80.0) | 0.861 |
Negative | 124 | 23 (18.5) | 101 (81.5) | |
Perineural invasion | ||||
Positive | 85 | 11 (12.9) | 74 (87.1) | 0.076 |
Negative | 129 | 30 (23.3) | 99 (76.7) |
Characteristics | Total case | DVL1 | p-Value * | |
---|---|---|---|---|
+ (n = 98) (%) | − (n = 116) (%) | |||
Gender | ||||
Male | 116 | 55 (56.1) | 61 (52.6) | 0.605 |
Female | 98 | 43 (43.9) | 55 (47.4) | |
Age (y/o) | ||||
<60 | 73 | 34 (34.7) | 39 (33.6) | 0.869 |
≥60 | 141 | 64 (65.3) | 77 (66.4) | |
Tumor Size | ||||
<5 cm | 109 | 28 (28.6) | 81 (69.8) | <0.0001 |
≥5 cm | 105 | 70 (71.4) | 35 (30.2) | |
Stage (UICC) a | ||||
I–II | 110 | 39 (39.8) | 71 (61.2) | 0.002 |
III | 104 | 59 (60.2) | 45 (38.8) | |
Vascular invasion | ||||
Positive | 90 | 61 (62.2) | 29 (25.0) | <0.0001 |
Negative | 124 | 37 (37.8) | 87 (75.0) | |
Perineural invasion | ||||
Positive | 85 | 52 (53.1) | 33 (28.4) | <0.0001 |
Negative | 129 | 46 (46.9) | 83 (71.6) | |
Liver metastasis | ||||
Yes | 41 | 32 (32.7) | 9 (7.8) | <0.0001 |
No | 173 | 66 (67.3) | 107 (92.2) |
Parameters | Liver metastasis (n = 41) (%) | No liver metastasis (n = 173) (%) | Multivariate analysis Odd ratio (95% CI) | p-Value * |
---|---|---|---|---|
Sex (Male/Female) | 20 (48.8)/21 (51.2) | 96 (55.5)/77 (44.5) | 0.726 (0.289~1.828) | 0.497 |
Age (≥60/<60) | 26 (63.4)/15 (38.6) | 115 (66.5)/58 (33.5) | 1.241 (0.483~3.186) | 0.654 |
Tumor size (≥5 cm/<5 cm) | 21 (51.2)/20 (48.8) | 84 (48.6)/89 (51.4) | 1.076 (0.416~2.786) | 0.880 |
Stage (UICC) a (III/I–II) | 22 (53.7)/19 (46.3) | 82 (47.4)/91 (52.6) | 0.859 (0.201~3.663) | 0.837 |
Vascular invasion (yes/no) | 18 (43.9)/23 (56.1) | 72 (41.6)/101 (58.4) | 0.168 (0.030~0.929) | 0.641 |
Perineural invasion (yes/no) | 11 (26.8)/30 (73.2) | 74 (42.8)/99 (57.2) | 1.499 (0.439~5.117) | 0.518 |
DVL1 overexpression (yes/no) | 32 (78.0)/9 (22.0) | 66 (38.2)/107 (61.8) | 3.768 (1.469~9.665) | 0.006 |
Characteristics | DVL1 IHC | p-Value | |
---|---|---|---|
High (n = 33) | Low (n = 27) | ||
Gender | |||
Male | 22 | 16 | 0.554 |
Female | 11 | 11 | |
Age (y/o) | |||
<60 | 11 | 6 | 0.342 |
≥60 | 22 | 21 | |
Tumor Location | |||
Colon | 26 | 25 | 0.166 |
Rectum | 7 | 2 | |
Tumor Size | |||
<5 cm | 22 | 12 | 0.084 |
≥5 cm | 11 | 15 | |
Depth | |||
T1 + T2 | 0 | 4 | 0.036 * |
T3 + T4 | 33 | 23 | |
Stage (UICC) a | |||
III | 32 | 26 | 1.000 |
IV | 1 | 2 | |
N stage b | |||
N1 | 19 | 19 | 0.306 |
N2 | 14 | 8 | |
Vascular invasion | |||
Positive | 11 | 10 | 0.765 |
Negative | 22 | 17 | |
Perineural invasion | |||
Positive | 15 | 5 | 0.028 * |
Negative | 18 | 22 | |
Liver metastasis | |||
Yes | 15 | 4 | 0.013 * |
No | 18 | 23 |
Acknowledgments
Conflicts of Interest
References
- Jemal, A.; Bray, F.; Center, M.M.; Ferlay, J.; Ward, E.; Forman, D. Global cancer statistics. CA Cancer J. Clin 2011, 61, 69–90. [Google Scholar]
- Gallagher, D.J.; Kemeny, N. Metastatic colorectal cancer: From improved survival to potential cure. Oncology 2010, 78, 237–248. [Google Scholar]
- Obrand, D.I.; Gordon, P.H. Incidence and patterns of recurrence following curative resection for colorectal carcinoma. Dis. Colon Rectum 1997, 40, 15–24. [Google Scholar]
- Greenlee, R.T.; Murray, T.; Bolden, S.; Wingo, P.A. Cancer statistics, 2000. CA Cancer J. Clin 2000, 50, 7–33. [Google Scholar]
- Ghossein, R.A.; Bhattacharya, S.; Rosai, J. Molecular detection of micrometastases and circulating tumor cells in solid tumors. Clin. Cancer Res 1999, 5, 1950–1960. [Google Scholar]
- Ghossein, R.A.; Bhattacharya, S. Molecular detection and characterisation of circulating tumour cells and micrometastases in solid tumours. Eur. J. Cancer 2000, 36, 1681–1694. [Google Scholar]
- Kinzler, K.W.; Vogelstein, B. Lessons from hereditary colorectal cancer. Cell 1996, 87, 159–170. [Google Scholar]
- Ashworth, T.R. A case of cancer in which cells similar to those in the tumours were seen in the blood after death. Aust. Med. J 1869, 14, 146–147. [Google Scholar]
- Allan, A.L.; Keeney, M. Circulating tumor cell analysis: Technical and statistical considerations for application to the clinic. J. Oncol 2010, 2010. [Google Scholar] [CrossRef]
- Wang, J.Y.; Yeh, C.S.; Chen, Y.F.; Wu, C.H.; Hsieh, J.S.; Huang, T.J.; Huang, S.Y.; Lin, S.R. Development and evaluation of a colorimetric membrane-array method for the detection of circulating tumor cells in the peripheral blood of Taiwanese patients with colorectal cancer. Int. J. Mol. Med 2006, 17, 737–747. [Google Scholar]
- Uen, Y.H.; Lu, C.Y.; Tsai, H.L.; Yu, F.J.; Huang, M.Y.; Cheng, T.L.; Lin, S.R.; Wang, J.Y. Persistent presence of postoperative circulating tumor cells is a poor prognostic factor for patients with stage I–III colorectal cancer after curative resection. Ann. Surg. Oncol 2008, 15, 2120–2128. [Google Scholar]
- Lu, C.Y.; Uen, Y.H.; Tsai, H.L.; Chuang, S.C.; Hou, M.F.; Wu, D.C.; Juo, S.H.; Lin, S.R.; Wang, J.Y. Molecular detection of persistent postoperative circulating tumour cells in stages II and III colon cancer patients via multiple blood sampling: Prognostic significance of detection for early relapse. Br. J. Cancer 2011, 104, 1178–1184. [Google Scholar]
- Huang, M.Y.; Wang, H.M.; Tok, T.S.; Chang, H.J.; Chang, M.S.; Cheng, T.L.; Wang, J.Y.; Lin, S.R. EVI2B, ATP2A2, S100B, TM4SF3, and OLFM4 as potential prognostic markers for postoperative Taiwanese colorectal cancer patients. DNA Cell Biol 2012, 31, 625–635. [Google Scholar]
- Ohira, T.; Gemmill, R.M.; Ferguson, K.; Kusy, S.; Roche, J.; Brambilla, E.; Zeng, C.; Baron, A.; Bemis, L.; Erickson, P.; et al. WNT7a induces E-cadherin in lung cancer cells. Proc. Natl. Acad. Sci. USA 2003, 100, 10429–10434. [Google Scholar]
- Giles, R.H.; van Es, J.H.; Clevers, H. Caught up in a Wnt storm: Wnt signaling in cancer. Biochim. Biophys. Acta 2003, 1653, 1–24. [Google Scholar]
- Uematsu, K.; Kanazawa, S.; You, L.; He, B.; Xu, Z.; Li, K.; Peterlin, B.M.; McCormick, F.; Jablons, D.M. Wnt pathway activation in mesothelioma: Evidence of Dishevelled overexpression and transcriptional activity of beta-catenin. Cancer Res 2003, 63, 4547–4551. [Google Scholar]
- Okino, K.; Nagai, H.; Hatta, M.; Nagahata, T.; Yoneyama, K.; Ohta, Y.; Jin, E.; Kawanami, O.; Araki, T.; Emi, M. Up-regulation and overproduction of DVL-1, the human counterpart of the Drosophila dishevelled gene, in cervical squamous cell carcinoma. Oncol. Rep 2003, 10, 1219–1223. [Google Scholar]
- Dennis, G., Jr.; Sherman, B.T.; Hosack, D.A.; Yang, J.; Gao, W.; Lane, H.C.; Lempicki, R.A. DAVID: Database for annotation, visualization, and integrated discovery. Genome Biol 2003, 4, 3. [Google Scholar]
- Gayowski, T.J.; Iwatsuki, S.; Madariaga, J.R.; Selby, R.; Todo, S.; Irish, W.; Starzl, T.E. Experience in hepatic resection for metastatic colorectal cancer: Analysis of clinical and pathologic risk factors. Surgery 1994, 116, 703–710. [Google Scholar]
- Baker, M.K.; Mikhitarian, K.; Osta, W.; Callahan, K.; Hoda, R.; Brescia, F.; Kneuper-Hall, R.; Mitas, M.; Cole, D.J.; Gillanders, W.E. Molecular detection of breast cancer cells in the peripheral blood of advanced-stage breast cancer patients using multimarker real-time reverse transcription-polymerase chain reaction and a novel porous barrier density gradient centrifugation technology. Clin. Cancer Res 2003, 9, 4865–4871. [Google Scholar]
- Sher, Y.P.; Shih, J.Y.; Yang, P.C.; Roffler, S.R.; Chu, Y.W.; Wu, C.W.; Yu, C.L.; Peck, K. Prognosis of non-small cell lung cancer patients by detecting circulating cancer cells in the peripheral blood with multiple marker genes. Clin. Cancer Res 2005, 11, 173–179. [Google Scholar]
- Chen, Y.F.; Wang, J.Y.; Wu, C.H.; Chen, F.M.; Cheng, T.L.; Lin, S.R. Detection of circulating cancer cells with K-ras oncogene using membrane array. Cancer Lett 2005, 229, 115–122. [Google Scholar]
- Wang, J.Y.; Lin, S.R.; Wu, D.C.; Lu, C.Y.; Yu, F.J.; Hsieh, J.S.; Cheng, T.L.; Koay, L.B.; Uen, Y.H. Multiple molecular markers as predictors of colorectal cancer in patients with normal perioperative serum carcinoembryonic antigen levels. Clin. Cancer Res 2007, 13, 2406–2413. [Google Scholar]
- Wang, J.Y.; Wu, C.H.; Lu, C.Y.; Hsieh, J.S.; Wu, D.C.; Huang, S.Y.; Lin, S.R. Molecular detection of circulating tumor cells in the peripheral blood of patients with colorectal cancer using RT-PCR: Significance of the prediction of postoperative metastasis. World J. Surg 2006, 30, 1007–1013. [Google Scholar]
- Yeh, C.S.; Wang, J.Y.; Wu, C.H.; Chong, I.W.; Chung, F.Y.; Wang, Y.H.; Yu, Y.P.; Lin, S.R. Molecular detection of circulating cancer cells in the peripheral blood of patients with colorectal cancer by using membrane array with a multiple mRNA marker panel. Int. J. Oncol 2006, 28, 411–420. [Google Scholar]
- Tsao, D.A.; Yang, M.J.; Chang, H.J.; Yen, L.C.; Chiu, H.H.; Hsueh, E.J.; Chen, Y.F.; Lin, S.R. A fast and convenient new technique to detect the therapeutic target, K-ras mutant, from peripheral blood in non-small cell lung cancer patients. Lung Cancer 2010, 68, 51–57. [Google Scholar]
- Yang, M.J.; Chiu, H.H.; Wang, H.M.; Yen, L.C.; Tsao, D.A.; Hsiao, C.P.; Chen, Y.F.; Wang, J.Y.; Lin, S.R. Enhancing detection of circulating tumor cells with activating KRAS oncogene in patients with colorectal cancer by weighted chemiluminescent membrane array method. Ann. Surg. Oncol 2010, 17, 624–633. [Google Scholar]
- Doucas, H.; Garcea, G.; Neal, C.P.; Manson, M.M.; Berry, D.P. Changes in the Wnt signalling pathway in gastrointestinal cancers and their prognostic significance. Eur. J. Cancer 2005, 41, 365–379. [Google Scholar]
- Nagahata, T.; Shimada, T.; Harada, A.; Nagai, H.; Onda, M.; Yokoyama, S.; Shiba, T.; Jin, E.; Kawanami, O.; Emi, M. Amplification, up-regulation and over-expression of DVL-1, the human counterpart of the Drosophila disheveled gene, in primary breast cancers. Cancer Sci 2003, 94, 515–518. [Google Scholar]
- Oishi, Y.; Nagasaki, K.; Miyata, S.; Matsuura, M.; Nishimura, S.; Akiyama, F.; Iwai, T.; Miki, Y. Functional pathway characterized by gene expression analysis of supraclavicular lymph node metastasis-positive breast cancer. J. Hum. Genet 2007, 52, 271–279. [Google Scholar]
© 2013 by the authors; licensee MDPI, Basel, Switzerland This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).
Share and Cite
Huang, M.-Y.; Yen, L.-C.; Liu, H.-C.; Liu, P.-P.; Chung, F.-Y.; Wang, T.-N.; Wang, J.-Y.; Lin, S.-R. Significant Overexpression of DVL1 in Taiwanese Colorectal Cancer Patients with Liver Metastasis. Int. J. Mol. Sci. 2013, 14, 20492-20507. https://doi.org/10.3390/ijms141020492
Huang M-Y, Yen L-C, Liu H-C, Liu P-P, Chung F-Y, Wang T-N, Wang J-Y, Lin S-R. Significant Overexpression of DVL1 in Taiwanese Colorectal Cancer Patients with Liver Metastasis. International Journal of Molecular Sciences. 2013; 14(10):20492-20507. https://doi.org/10.3390/ijms141020492
Chicago/Turabian StyleHuang, Ming-Yii, Li-Chen Yen, Hsueh-Chiao Liu, Po-Ping Liu, Fu-Yen Chung, Tsu-Nai Wang, Jaw-Yuan Wang, and Shiu-Ru Lin. 2013. "Significant Overexpression of DVL1 in Taiwanese Colorectal Cancer Patients with Liver Metastasis" International Journal of Molecular Sciences 14, no. 10: 20492-20507. https://doi.org/10.3390/ijms141020492