Isolation and Characterization of Nine Microsatellite Loci for a Parasitoid Wasp, Encarsia smithi (Silvestri) (Hymenoptera: Aphelinidae)
Abstract
:1. Introduction
2. Results and Discussion
3. Experimental Section
4. Conclusions
Acknowledgments
- Conflict of InterestThe authors declare no conflict of interest.
References
- Marutani, M.; Muniappan, R. Biological control of the orange spiny whitefly, Aluerocanthus spiniferus (Homoptera: Aleyrodidae) on Chuuk and Yap in Micronesia. J. Biol. Control 1991, 5, 64–69. [Google Scholar]
- Nakao, H.K.; Funasaki, G.Y. Introductions for biological control in Hawaii: 1975 and 1976. Proc. Hawaii. Entomol. Soc 1979, 23, 125–128. [Google Scholar]
- Ohgushi, R. Ecology of Citrus Pests; Rural Culture Association: Tokyo, Japan, 1969; p. 244. [Google Scholar]
- van den Berg, M.A.; Greenland, J. Classical biological control of aleurocanthus spiniferus (Hem.: Aleyrodidae), on citrus in Southern Africa. Entomophaga 1997, 42, 459–465. [Google Scholar]
- Kuwana, I. Notes on a Newly Imported Parasite of the Spiny White Fly Attacking Citrus in Japan. Proceedings of the 5th Pacific Science Congress; University of Toronto Press: Toronto, ON, Canada, 1933; pp. 3521–3523. [Google Scholar]
- Phillips, C.B.; Baird, D.B.; Iline, I.I.; McNeill, M.R.; Proffitt, J.R.; Goldson, S.L.; Kean, J.M. East meets west: Adaptive evolution of an insect introduced for biological control. J. Appl. Ecol 2008, 45, 948–956. [Google Scholar]
- Reed, D.H.; Frankham, R. Correlation between fitness and genetic diversity. Conserv. Biol 2003, 17, 230–237. [Google Scholar]
- Untergasser, A.; Nijveen, H.; Rao, X.Y.; Bisseling, T.; Geurts, R.; Leunissen, J.A.M. Primer3Plus, an enhanced web interface to Primer3. Nucleic Acids Res 2007, 35, W71–W74. [Google Scholar]
- Osakabe, M.; Goka, K.; Toda, S.; Shintaku, T.; Amano, H. Significance of habitat type for the genetic population structure of Panonychus citri (Acari: Tetranychidae). Exp. Appl. Acarol 2005, 36, 25–40. [Google Scholar]
- FSTAT, version 2.9.3; A Program to Estimate and Test Gene Diversities and Fixation Indices; Institut d’Ecologie, Bâtiment de Biologie, Université de Lausanne: Lausanne, Switzerland, 2001.
- van Oosterhout, C.; Hutchinson, W.F.; Wills, D.P.M.; Shipley, P. Micro-checker: Software for identifying and correcting genotyping errors in microsatellite data. Mol. Ecol. Notes 2004, 4, 535–538. [Google Scholar]
- de León, J.H.; Neumann, G.; Follett, P.A.; Hollingsworth, R.G. Molecular markers discriminate closely related species Encarsia diaspidicola and Encarsia berlesei (Hymenoptera: Aphelinidae): Biocontrol candidate agents for white peach scale in Hawaii. J. Econ. Entomol 2010, 103, 908–916. [Google Scholar]
Locus Designation (Accession No.) | Primer Sequence (5′-3′) a | Annealing Templature | No. of PCR Cycles | Repeat Motif | Sequence Size (bp) | Size Range of Allele (bp) | NAb | HOc | HEd | Fe |
---|---|---|---|---|---|---|---|---|---|---|
Es002 (AB715240) | F: GAGGATTCAATTCGCACCTA R: GTAGCCCGCCAATAAATTAC | 58 °C | 26 | (CA)12 | 201 | 201–221 | 5 | 0.438 | 0.490 | 0.107 |
Es011 (AB715241) | F: CGACACGAACAACCCTAAAC R: GCGAAGAGACACGACTTGAT | 55 °C | 29 | (GT)12 | 217 | 217–237 | 2 | 0.375 | 0.308 | −0.216 |
Es014 (AB715242) | F: TATCACCAGGAGCATCATCA R: GGAGCCTCTTATCGGTCTCT | 58 °C | 33 | (CA)11 | 251 | 249–283 | 6 | 0.720 | 0.759 | 0.052 |
Es051 (AB715243) | F: TCGTAAAATTATGCGAGCTG R: GATCCGAGTGGTACTGTGCT | 58 °C | 31 | (GT)10 | 130 | 128–130 | 2 | 0.531 | 0.503 | −0.056 |
Es056 (AB715244) | F: ACCGTGTATCATCCGTTGAC R: GTGCGTGCGAGTATCTTCC | 58 °C | 31 | (GT)9 | 183 | 180–185 | 5 | 0.750 | 0.780 | 0.039 |
Es060 (AB715245) | F: TGCAACGTCTTCAAGTCCAG R: ATGCACGTCAATTTGTTTCG | 58 °C | 33 | (GT)9 | 183 | 183–193 | 4 | 0.218 | 0.203 | −0.077 |
Es064 (AB715246) | F: CGAACCGATAAGAAGCCTGT R: CGTACACGCAACAATCGAAG | 55 °C | 26 | (GT)10 | 155 | 143–155 | 3 | 0.687 | 0.555 | −0.239 |
Es082 (AB715247) | F: CAATAATTCCACCCAGCAC R: TGTTAAACACGGTGGAAAGAG | 55 °C | 28 | (CA)15 | 126 | 104–126 | 5 | 0.749 | 0.729 | −0.028 |
Es083 (AB715248) | F: ATCCTCCGCGTTAGTACATC R: CATGACTACACACCCACGTC | 55 °C | 26 | (GT)9 | 131 | 131–139 | 2 | 0.312 | 0.503 | 0.379 |
© 2013 by the authors; licensee Molecular Diversity Preservation International, Basel, Switzerland. This article is an open-access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).
Share and Cite
Uesugi, R.; Sato, Y. Isolation and Characterization of Nine Microsatellite Loci for a Parasitoid Wasp, Encarsia smithi (Silvestri) (Hymenoptera: Aphelinidae). Int. J. Mol. Sci. 2013, 14, 527-531. https://doi.org/10.3390/ijms14010527
Uesugi R, Sato Y. Isolation and Characterization of Nine Microsatellite Loci for a Parasitoid Wasp, Encarsia smithi (Silvestri) (Hymenoptera: Aphelinidae). International Journal of Molecular Sciences. 2013; 14(1):527-531. https://doi.org/10.3390/ijms14010527
Chicago/Turabian StyleUesugi, Ryuji, and Yasushi Sato. 2013. "Isolation and Characterization of Nine Microsatellite Loci for a Parasitoid Wasp, Encarsia smithi (Silvestri) (Hymenoptera: Aphelinidae)" International Journal of Molecular Sciences 14, no. 1: 527-531. https://doi.org/10.3390/ijms14010527
APA StyleUesugi, R., & Sato, Y. (2013). Isolation and Characterization of Nine Microsatellite Loci for a Parasitoid Wasp, Encarsia smithi (Silvestri) (Hymenoptera: Aphelinidae). International Journal of Molecular Sciences, 14(1), 527-531. https://doi.org/10.3390/ijms14010527