Development of Microsatellite Markers for the Korean Mussel, Mytilus coruscus (Mytilidae) Using Next-Generation Sequencing
Abstract
1. Introduction
2. Results and Discussion
2.1. 454 Sequencing Results
2.2. Microsatellite Loci Isolation
2.3. Genetic Characterization
3. Experimental Section
3.1. Sample Collection and 454 Sequencing
3.2. Microsatellite Discovery and Primer Screening
3.3. DNA Amplification and Genotyping
3.4. Genetic Analysis
4. Conclusions
Acknowledgments
References
- Choi, B.R.; Park, M.S.; Jeon, I.K.; Park, S.R.; Kim, H.T. Commercial Mollusks from the Freshwater and Continental Shelf in Korea (in Korean); NFRDI Press: Busan, Korea, 1999; p. 100. [Google Scholar]
- MIFAFF—Ministry for Food, Agriculture, Forestry and Fisheries of Korea. Fisheries information service, Annual Statistics of Fisheries Production. Available online: http://www.fips.go.kr accessed on 25 May 2012.
- Je, J.G.; Zhang, C.I.; Lee, S.H. Characteristics of shell morphology and distribution of 3 species belonging to genus Mytilus (Mytilidae: Bivalvia) in Korea. Korean J. Malacol 1990, 6, 22–32. [Google Scholar]
- Reiss, H.; Hoarau, G.; Dickey-Collas, M.; Wolff, W.J. Genetic population structure of marine fish: Mismatch between biological and fisheries management units. Fish Fish 2009, 10, 361–395. [Google Scholar]
- Sunnucks, P. Efficient genetic markers for population biology. Trends Ecol. Evol 2000, 15, 199–203. [Google Scholar]
- Launey, S.; Ledu, C.; Boudry, P.; Bonhomme, F.; Naciri-Graven, Y. Geographic structure in the European Xat oyster (Ostrea edulis L.) as revealed by microsatellite polymorphism. J. Hered 2002, 93, 331–338. [Google Scholar]
- Hedgecock, D.; Li, G.; Hubert, S.; Bucklin, K.; Ribes, V. Wide spread null alleles and poor cross-species amplification of microsatellite DNA loci cloned from the Pacific oyster, Crassostrea gigas. J. Shellfish Res 2004, 23, 379–385. [Google Scholar]
- Kenchington, E.L.; Patwary, M.U.; Zouros, E.; Bird, C.J. Genetic differentiation in relation to marine landscape in a broadcast-spawning bivalve mollusc (Placopecten magellanicus). Mol. Ecol 2006, 15, 1781–1796. [Google Scholar]
- Xu, T.-J.; Sun, Y.-N.; Yuan, Y.-T.; Liao, Z.; Wang, R.-X. Isolation and characterization of polymorphic microsatellite loci in the hard-shelled mussel, Mytilus coruscus (Mytilidae). Genet. Mol. Res 2010, 9, 1388–1391. [Google Scholar]
- Edwards, A.; Civitello, A.; Hammond, H.A.; Caskey, C.T. DNA typing and genetic mapping with trimeric and tetrameric tandem repeats. Am. J. Hum. Genet 1991, 49, 746–756. [Google Scholar]
- Squirrell, J.; Hollingsworth, P.M.; Woodhead, M.; Russell, J.; Lowe, A.J.; Gibby, M.; Powell, W. How much effort is required to isolate nuclear microsatellites from plants? Mol. Ecol 2003, 12, 1339–1348. [Google Scholar]
- Eujayl, I.; Sledge, M.K.; Wang, L.; May, G.D.; Chekhovskiy, K.; Zwonitzer, J.C.; Mian, M.A.R. Medicago truncatula EST-SSRs reveal cross-species genetic markers for Medicago spp. Theor. Appl. Genet 2004, 108, 414–422. [Google Scholar]
- Iniguez-Luy, F.L.; Voort, A.V.; Osborn, T.C. Development of a set of public SSR markers derived from genomic sequence of a rapid cycling Brassica oleracea L. genotype. Theor. Appl. Genet 2008, 117, 977–985. [Google Scholar]
- Abdelkrim, J.; Robertson, B.C.; Stanton, J.L.; Gemmell, N.J. Fast, cost-effective development of species specific microsatellite markers by genomic sequencing. Bio Techniques 2009, 46, 185–192. [Google Scholar]
- Santana, Q.; Coetze, M.; SteenKamp, E.; Mlonyeni, O.; Hammond, G.; Wingfield, M.; Wingfield, B. Microsatellite Discovery by deep sequencing of enriched genomic libraries. Biotechniques 2009, 46, 217–223. [Google Scholar]
- Perry, J.C.; Rowe, L. Rapid microsatellite development for water striders by next-generation sequencing. J. Hered 2011, 102, 125–129. [Google Scholar]
- Zhang, D.-X.; Hewitt, G.M. Nuclear DNA analyses in genetic studies of populations: Practice, problems and prospects. Mol. Ecol 2003, 12, 563–584. [Google Scholar]
- Linqvist, A.K.B.; Magnusson, P.K.E.; Balciuniene, J.; Wadelius, C.; Lindholm, E.; Alarcon-Riquelme, M.E.; Gyllensten, U.B. Chromosome-specific panels of tri- and tetranucleotide microsatellite markers for multiplex fluorescent detection and automated genotyping: Evaluation of their utility in pathology and forensics. Genome Res 1996, 6, 1170–1176. [Google Scholar]
- Benson, D.A.; Karsch-Mizrachi, I.; Lipman, D.J.; Ostell, J.; Sayers, E.W. GenBank. Nucleic Acids Res 2011, D32–37. [Google Scholar]
- Botstein, D.; White, R.L.; Skolnick, M.; Davis, R.W. Construction of a genetic linkage map in man using restriction fragment length polymorphisms. Am. J. Hum. Genet 1980, 32, 314–331. [Google Scholar]
- Zhan, A.B.; Bao, Z.M.; Hui, M.; Wang, M.L.; Zhao, H.B.; Lu, W.; Hu, X.L.; Hu, J.J. Inheritance pattern of EST-SSRs in self-fertilized larvae of the bay scallop Argopecten irradians. Ann. Zool. Fenn 2007, 44, 259–268. [Google Scholar]
- Sekino, M.; Kobayashi, T.; Hara, M. Segregation and linkage analysis of 75 novel microsatellite DNA markers in pair crosses of Japanese abalone (Haliotis discus hannai) using the 5′-tailed primer method. Mar. Biotechnol 2006, 8, 453–466. [Google Scholar]
- Qi, H.G.; Liu, X.; Zhang, G.F.; Wu, F.C. Mining expressed sequences for single nucleotide polymorphisms in Pacific abalone Haliotis discus hannai. Aqua Res 2009, 40, 1661–1667. [Google Scholar]
- Li, H.J.; Zhu, D.; Cao, X.G.; Li, Y.F.; Wang, J.; He, C.B. Mining single nucleotide polymorphisms from EST data of hard clam Meretrix meretrix. Conserv. Genet. Res 2010, 2, 69–72. [Google Scholar]
- Excoffier, L.; Laval, G.; Schneider, S. ARLEQUIN version 3.0: An integrated software package for population genetics data analysis. Evol. Bioinforma 2005, 1, 47–50. [Google Scholar]
- Li, G.; Hubert, S.; Bucklin, K.; Ribes, V.; Hedgecock, D. Characterization of 79 microsatellite DNA markers in the Pacific oysters Crassostrea gigas. Mol. Ecol. Notes 2003, 3, 228–232. [Google Scholar]
- An, H.Y.; Park, J.Y. Ten new highly polymorphic microsatellite loci in the blood clam Scapharca broughtonii. Mol. Ecol. Notes 2005, 5, 896–898. [Google Scholar]
- DeWoody, J.A.; Avise, J.C. Microsatellite variation in marine, freshwater and anadromous fishes compared with other animals. J. Fish. Biol 2000, 56, 461–473. [Google Scholar]
- Launey, S.; Hedgecock, D. High genetic load in the Pacific oyster Crassostrea gigas. Genetics 2001, 159, 255–265. [Google Scholar]
- Peakall, R.; Gilmore, S.; Keys, W.; Morgante, M.; Rafalski, A. Cross-species amplification of soybean (Glycine max) simple sequence repeats within the genus and other legume genera: Implications for the transferability of SSRs in plants. Mol. Biol. Evol 1998, 15, 1275–1287. [Google Scholar]
- Xu, Q.; Liu, R. Development and characterization of microsatellite markers for genetic analysis of the swimming crab, Portunus trituberculatus. Biochem. Genet 2011, 49, 202–212. [Google Scholar]
- Asahida, T.; Kobayashi, T.; Saitoh, K.; Nakayama, I. Tissue preservation and total DNA extraction from fish stored at ambient temperature using buffers containing high concentrations of urea. Fish Sci 1996, 62, 727–730. [Google Scholar]
- Van Oosterhout, C.; Hutchinson, W.F.; Wills, D.P.M.; Shipley, P. MICRO-CHECKER: Software for identifying and correcting genotyping errors in microsatellite data. Mol. Ecol. Notes 2004, 4, 535–538. [Google Scholar]
- Kalinowski, S.T.; Taper, M.L.; Marshall, T.C. Revising how the computer program CERVUS accommodates genotyping error increases success in paternity assignment. Mol. Ecol 2007, 16, 1099–1106. [Google Scholar]
- Greenley, A.P.; Muguia-Vega, A.; Saenz-Arroyo, A.; Micheli, F. New tetranucleotide microsatellite loci in pink abalone (Haliotis corrugate) isolated via 454 pyrosequencing. Conserv. Genet. Resour 2012, 4, 265–268. [Google Scholar]
- Wang, J.; Yu, X.; Zhao, K.; Zhang, Y.; Tong, J.; Peng, Z. Microsatellite development for an endangered bream Megalobrama pellegrini (Teleostei, Cyprinidae) using 454 sequencing. Int. J. Mol. Sci 2012, 13, 3009–3021. [Google Scholar]
| Locus | Repeat motif | Primer sequence (5′-3′) a | Ta (°C) | Population (N = 30) | Cross-amplification(N = 30) | |||||
|---|---|---|---|---|---|---|---|---|---|---|
| F | R | NA | Ho | He | PIC | GeneBank Accession No. | M. galloprovincialis | |||
| KMc1 † | (AT)11 | GCAGCTCTTACGTGTTGATC 6-fam | ATACACGCATGTAGATGCAC | 54 | 24 | 0.83 * | 0.95 | 0.94 | JQ678740 | F |
| KMc2 † | (ATC)30 | GGCTCAGTGTGTCAATCATC hex | TATGTAGGTTCTGCAAAGTGG | 54 | 19 | 0.71 * | 0.93 | 0.91 | JQ678741 | F |
| KMc3 | (TGA)12 | ATGTTCGAACTGCGCTGATG 6-fam | CGCTCAAACTAGTTGGGTTA | 54 | 18 | 0.90 | 0.93 | 0.91 | JQ678742 | F |
| KMc4 † | (TA)13 | CTGCGATGCTTTCAGATGTC hex | AAGCTTAAAATAGCCCGCGA | 54 | 24 | 0.47 * | 0.96 | 0.94 | JQ678743 | F |
| KMc5 | (GATT)17 | CCTAGTGTCTCTCTAGTCCA hex | CATAAGGAATTTCCAGCCACA | 54 | 14 | 0.59 * | 0.91 | 0.88 | JQ678744 | F |
| KMc6 | (AC)13 | CCACATCAAGTGAGAGAGAG 6-fam | GACAAATGTAGTGAACGACG | 54 | 12 | 0.70 | 0.84 | 0.81 | JQ678745 | F |
| KMc7 | (TCAA)13 | ACGTAGCGTGAAACCTTCAC 6-fam | CTATGCAAATCACGTTGCTG | 54 | 20 | 0.89 * | 0.95 | 0.93 | JQ678746 | F |
| KMc8 | (TA)11 | CCCGATGGAGAAAGTTTGTC hex | ATATGATCCATCGCCCCGTA | 54 | 10 | 0.63 | 0.83 | 0.79 | JQ678747 | F |
| KMc9 | (TA)11 | CGGTGTGGGAAGAACGTAAA 6-fam | ATTCGTGCATATTCAGGACG | 54 | 17 | 0.76 * | 0.92 | 0.90 | JQ678748 | F |
| KMc10 † | (GAT)19 | ATGACGGGTAGAACCTGACA hex | CTCAATGTGTCGGTCTAGTA | 54 | 19 | 0.53 * | 0.95 | 0.93 | JQ678749 | F |
| KMc11 | (ATCA)12 | AGGGGCTGTTAAGACTGTCG hex | ATTCCACAGTCATTGGTCC | 54 | 19 | 0.89 | 0.93 | 0.90 | JQ678750 | F |
| KMc12 | (TA)12 | GTTAAGTGCACACCTGTGAG hex | AATTCACCAGGAGCATTGTG | 54 | 13 | 0.22 * | 0.76 | 0.73 | JQ678751 | F |
| KMc13 | (GAT)22 | TGGAAGTGTGTACTGGGCTA 6-fam | AAGAAATGGAACAGGAGCAG | 54 | 21 | 0.87 | 0.95 | 0.93 | JQ678752 | F |
| KMc14 | (CAT)12 | AAACATTTTGCCGCTGGACG hex | ATGCTTCCCCAACTTGTTAC | 54 | 22 | 0.90 | 0.93 | 0.91 | JQ678753 | F |
| KMc15 | (ATT)16 | GAGGGCCTTAGGGAAGATTA hex | ACGTCTATCAACCTCAGAAG | 54 | 21 | 0.87 | 0.93 | 0.91 | JQ678754 | F |
| KMc16 † | (TG)12 | CCCTACACTCGGACTTTACA 6-fam | CCGTTACGAACGATTACTAG | 54 | 6 | 0.10 * | 0.69 | 0.65 | JQ678755 | F |
| KMc17 † | (ATA)11 | GATCACCCTGTTTCAGAGTC 6-fam | ATTGTATATGAGGGCCTCAG | 54 | 12 | 0.57 * | 0.89 | 0.86 | JQ678756 | F |
| KMc18 † | (AT)14 | GCCCAAACGACGTGTATTCA 6-fam | GTATGATCCATCGCCCCGTA | 54 | 18 | 0.31 * | 0.88 | 0.86 | JQ678757 | F |
| KMc19 † | (AG)16 | GGTCGTGTCCAAAGGAATTG 6-fam | CTAAATAACTGCACGACTCG | 54 | 21 | 0.73 * | 0.95 | 0.93 | JQ678758 | F |
| KMc20 † | (AT)12 | TGATCCTTTCACACAGCAGG hex | CTTCTCGTGCTCCATGTACA | 54 | 13 | 0.87 * | 0.90 | 0.87 | JQ678759 | F |
| KMc21 † | (TG)11 | GGGTCAGATGACTCTGGAAA hex | CTTTATGGCGTGTCAAATCG | 54 | 22 | 0.63 * | 0.89 | 0.87 | JQ678760 | F |
| KMc22 | (AG)11 | GGCAATCATACCACATCACC hex | CGGTATGTGCTGCCCTTTTA | 54 | 16 | 0.73 | 0.89 | 0.86 | JQ678761 | F |
© 2012 by the authors; licensee Molecular Diversity Preservation International, Basel, Switzerland. This article is an open-access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).
Share and Cite
An, H.S.; Lee, J.W. Development of Microsatellite Markers for the Korean Mussel, Mytilus coruscus (Mytilidae) Using Next-Generation Sequencing. Int. J. Mol. Sci. 2012, 13, 10583-10593. https://doi.org/10.3390/ijms130810583
An HS, Lee JW. Development of Microsatellite Markers for the Korean Mussel, Mytilus coruscus (Mytilidae) Using Next-Generation Sequencing. International Journal of Molecular Sciences. 2012; 13(8):10583-10593. https://doi.org/10.3390/ijms130810583
Chicago/Turabian StyleAn, Hye Suck, and Jang Wook Lee. 2012. "Development of Microsatellite Markers for the Korean Mussel, Mytilus coruscus (Mytilidae) Using Next-Generation Sequencing" International Journal of Molecular Sciences 13, no. 8: 10583-10593. https://doi.org/10.3390/ijms130810583
APA StyleAn, H. S., & Lee, J. W. (2012). Development of Microsatellite Markers for the Korean Mussel, Mytilus coruscus (Mytilidae) Using Next-Generation Sequencing. International Journal of Molecular Sciences, 13(8), 10583-10593. https://doi.org/10.3390/ijms130810583
