Microsatellites in the Endangered Species Dyckia distachya (Bromeliaceae) and Cross-Amplification in Other Bromeliads
Abstract
:1. Introduction
2. Results and Discussion
2.1. Isolation, Characterization and Cross-Amplification of Microsatellite Loci
2.2. Genetic Diversity of D. distachya
3. Experimental Section
3.1. Isolation of Microsatellite Markers
3.2. Primer Validation
4. Conclusions
Supplementary Information
ijms-13-15859-s001.pdfAcknowledgments
- Conflict of InterestThe authors declare no conflict of interest.
 
References
- Reitz, R. Bromeliáceas e a malária—Bromélia endêmica. Flora Ilustrada Catarinense; Barbosa Rodrigues Herbarium Press: Itajaí, SC, Brazil, 1983; pp. 82–85. [Google Scholar]
 - Reis, A.; Rogalski, J.; Vieira, N.K.; Berkenbrock, I.S. Conservação de espécies reófitas de Dyckia do sul do Brasil: Dyckia distachya; Technical Report; Universidade Federal de Santa Catarina: Florianópolis, SC, Brazil, 2005; pp. 3–7. [Google Scholar]
 - Wiesbauer, M.B.; Reis, A. Conservação ex situ e reintrodução de espécies na natureza: O que aprendemos nas experiências com a reófita Dyckia distachya. In Perspectivas sistêmicas para a conservação e restauração ambiental: do pontual ao contexto; Tres, D.R., Reis, A., Eds.; Barbosa Rodrigues Herbarium Press: Itajaí, SC, Brazil, 2009; pp. 355–3661. [Google Scholar]
 - MMA—Ministério do Meio Ambiente (Ministry of Environment), Normative Statement No. 6; Ministério do Meio Ambiente: Brasília, Brazil, 23 September 2008.
 - Eckert, C.G.; Samis, K.E.; Lougheed, S.C. Genetic variation across species’ geographical ranges: The central–marginal hypothesis and beyond. Mol. Ecol 2008, 17, 1170–1188. [Google Scholar]
 - Palma-Silva, C.; Lexer, C.; Paggi, G.M.; Barbará, T.; Bered, F.; Bodanese-Zanettini, M.H. Range-wide patterns of nuclear and chloroplast DNA diversity in Vriesea gigantea (Bromeliaceae), a neotropical forest species. Heredity 2009, 103, 503–512. [Google Scholar]
 - Doyle, J.J.; Doyle, J.L. Isolation of plant DNA from fresh tissue. Focus 1990, 12, 13–15. [Google Scholar]
 - Kijas, J.M.; Fowler, J.C.; Garbett, C.A.; Thomas, M.R. Enrichment of microsatellites from the citrus genome using biotinylated oligonucleotide sequences bound to streptavidin-coated magnetic particles. BioTechniques 1994, 16, 656–660. [Google Scholar]
 - Billote, N.; Risterucci, A.M.; Baurens, F.C. Microsatellite enriched libraries: Applied methodology for the development of SSR markers in tropical crops. Fruits 1999, 54, 27–288. [Google Scholar]
 - Rozen, S.; Skaletsky, H. Primer3 on the WWW for General Users and for Biologist Programmers. In Bioinformatics Methods and Protocols in the series Methods in Molecular Biology; Krawetz, S., Misener, S., Eds.; Humana Press: Totowa, NJ, USA, 2000; pp. 365–386. [Google Scholar]
 - Schuelke, M. An economic method for the fluorescent labeling of PCR fragments. Nat. Biotechnol 2000, 18, 233–234. [Google Scholar]
 - Dieringer, D.; Schlötterer, C. Microsatellite Analyser (MSA): A platform independent analysis tool for large microsatellite data sets. Mol. Ecol. Notes 2003, 3, 167–169. [Google Scholar]
 - Raymond, M.; Rosset, F. Genepop: Population genetics software for exact test and ecumenicism. J. Hered 1995, 86, 248–249. [Google Scholar]
 - Brookfield, J.F.Y. A simple new method for estimating null allele frequency from heterozygote deficiency. Mol. Ecol 1996, 5, 453–455. [Google Scholar]
 - Van Oosterhout, C.; Hutchinson, W.F.; Wills, D.P.M.; Shipley, P. MICRO-CHECKER: Software for identifying and correcting genotyping errors in microsatellite data. Mol. Ecol. Notes 2004, 4, 535–538. [Google Scholar]
 
| Locus | Primer Sequences (5′-3′) | Repeat motif | A | Size (bp) | GeneBank accession No | 
|---|---|---|---|---|---|
| Dd03 | F: TAGGCAGATGCGAATTGAGT R: CTCAGCATAGCTTTCGATGG  | (CA)10 | 6 | 202–212 | JX290116 | 
| Dd04 | F: CGCTTTTCTCGGAATCTTTG R: AGGGCTTCGTCCTCCTAAAA  | (TG)8 | 6 | 227–257 | JX290117 | 
| Dd07 | F: GATTCGGAAGGATGACAAGA R: CGGCACAGGAATACAAAGAG  | (GA)25 | 5 | 201–213 | JX290118 | 
| Dd08 | F: GATCGGTCTTTTACTCCTTGG R: CACGCTAGGATGATGTAGGC  | (AC)6G(GA)9 | 10 | 192–232 | JX845415 | 
| Dd09 | F: ACTCTGCTGCCTCATTCACA R: CACAGCAAAGGCAAACTTGA  | (GA)10 | 10 | 176–228 | JX845416 | 
| Dd10 | F: CTATGGGACTGCTGGACACT R: CTTGCTGGTAATCGTGTTCC  | (TG)7 | 4 | 248–254 | JX290119 | 
| Dd16 | F: AATTGCACCAAACAGGGATT R: GACACGACCCACATAGATGC  | (GT)7 (GC)4 | 7 | 170–190 | JX290120 | 
| Dd19 | F: GTGCCAAACATAAACCGATG R: AACGACCAAAAAGGGTGTTC  | (GT)5 | 6 | 239–278 | JX290121 | 
| Dd20 | F: GGTGGAAATGGTGGGTTACA R: GGCAGGCAAGGTATGAAGAA  | (CA)7 | 6 | 227–253 | JX290122 | 
| Locus | Introduced (N = 22) | Natural (N = 21) | ||||
|---|---|---|---|---|---|---|
| A | HO | HE | A | HO | HE | |
| Dd03 | 6 | 0.636 | 0.724* | 3 | 0.350 | 0.309 | 
| Dd04 | 6 | 0.136 | 0.636* | 3 | 0.214 | 0.659* | 
| Dd07 | 4 | 0.667 | 0.582 | 2 | 0.050 | 0.050 | 
| Dd08 | 10 | 0.300 | 0.877* | 7 | 0.300 | 0.720* | 
| Dd09 | 8 | 0.136 | 0.558* | 8 | 0.167 | 0.811* | 
| Dd10 | 4 | 0.545 | 0.589 | 3 | 0.143 | 0.257 | 
| Dd16 | 6 | 0.545 | 0.601 | 4 | 0.895 | 0.552* | 
| Dd19 | 6 | 0.182 | 0.543* | 2 | 0.048 | 0.136 | 
| Dd20 | 6 | 0.476 | 0.784* | 3 | 0.000 | 0.284* | 
| Mean | 6.2 | 0.402 | 0.591 | 3.8 | 0.241 | 0.188 | 
| Species | Subfamily | Dd03 | Dd04 | Dd07 | Dd08 | Dd09 | Dd10 | Dd16 | Dd19 | Dd20 | 
|---|---|---|---|---|---|---|---|---|---|---|
| Dyckia leptostachya | Pitcairnioideae | + | + | + | + | + | + | + | + | + | 
| Dyckia maritima | Pitcairnioideae | + | + | + | + | + | + | + | − | + | 
| Dyckia tuberosa | Pitcairnioideae | + | + | + | + | + | + | + | + | + | 
| Acanthostachys strobilacea | Bromelioideae | − | − | + | − | − | + | + | − | + | 
| Aechmea caudata | Bromelioideae | − | − | + | − | − | + | + | − | + | 
| Aechmea coelestis | Bromelioideae | − | − | − | − | − | + | + | − | + | 
| Aechmea comata | Bromelioideae | w | − | + | − | − | + | + | − | + | 
| Aechmea gamosepala | Bromelioideae | − | − | + | + | − | + | + | − | + | 
| Aechmea recurvata | Bromelioideae | + | − | + | − | − | + | + | − | + | 
| Aechmea winkleri | Bromelioideae | w | − | + | w | − | + | + | − | + | 
| Billbergia amoena | Bromelioideae | − | − | w | − | + | + | + | − | + | 
| Bromelia antiacantha | Bromelioideae | − | − | + | − | + | + | + | + | + | 
| Edmundoa lindenii | Bromelioideae | − | − | − | − | − | + | + | − | + | 
| Hohenbergia augusta | Bromelioideae | − | − | − | w | + | + | + | − | + | 
| Neoregelia guttata | Bromelioideae | + | − | + | + | + | + | + | − | + | 
| Nidularium procerum | Bromelioideae | + | − | + | + | − | + | + | w | + | 
| Quesnelia quesneliana | Bromelioideae | − | − | + | w | − | + | + | − | + | 
| Alcantarea extensa | Tillandsioideae | + | − | + | w | − | + | + | − | + | 
| Vriesea carinata | Tillandsioideae | + | − | + | − | − | + | w | + | + | 
| Vriesea gigantea | Tillandsioideae | + | − | + | − | − | + | − | − | + | 
| Vriesea incurvata | Tillandsioideae | + | − | + | − | − | + | − | − | + | 
| Vriesea reitzii | Tillandsioideae | + | − | + | − | − | + | − | − | + | 
| Total = 22 | 13 | 3 | 19 | 10 | 7 | 22 | 19 | 5 | 22 | 
© 2012 by the authors; licensee Molecular Diversity Preservation International, Basel, Switzerland. This article is an open-access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).
Share and Cite
Zanella, C.M.; Janke, A.; Paggi, G.M.; Goetze, M.; Reis, M.S.; Bered, F. Microsatellites in the Endangered Species Dyckia distachya (Bromeliaceae) and Cross-Amplification in Other Bromeliads. Int. J. Mol. Sci. 2012, 13, 15859-15866. https://doi.org/10.3390/ijms131215859
Zanella CM, Janke A, Paggi GM, Goetze M, Reis MS, Bered F. Microsatellites in the Endangered Species Dyckia distachya (Bromeliaceae) and Cross-Amplification in Other Bromeliads. International Journal of Molecular Sciences. 2012; 13(12):15859-15866. https://doi.org/10.3390/ijms131215859
Chicago/Turabian StyleZanella, Camila M., Aline Janke, Gecele M. Paggi, Márcia Goetze, Mauricio S. Reis, and Fernanda Bered. 2012. "Microsatellites in the Endangered Species Dyckia distachya (Bromeliaceae) and Cross-Amplification in Other Bromeliads" International Journal of Molecular Sciences 13, no. 12: 15859-15866. https://doi.org/10.3390/ijms131215859
APA StyleZanella, C. M., Janke, A., Paggi, G. M., Goetze, M., Reis, M. S., & Bered, F. (2012). Microsatellites in the Endangered Species Dyckia distachya (Bromeliaceae) and Cross-Amplification in Other Bromeliads. International Journal of Molecular Sciences, 13(12), 15859-15866. https://doi.org/10.3390/ijms131215859
        