Development of 22 Polymorphic Microsatellite Loci for the Critically Endangered Morato’s Digger Toad, Proceratophrys moratoi
Abstract
:1. Introduction
2. Results and Discussion
2.1. Characterization of the Enriched Microsatellite Library
2.2. Development of Polymorphic Microsatellite Markers
3. Experimental Section
3.1. Construction of Enriched Microsatellite Genomic Library
3.2. Sequencing and Primer Design
3.3. Genotyping
3.4. Characterization of Polymorphic Markers
4. Conclusions
Acknowledgments
References
- Stuart, S.N.; Chanson, J.S.; Cox, N.A.; Young, B.E.; Rodrigues, A.S.L.; Fischman, D.L.; Waller, R.W. Status and trends of amphibian declines and extinctions worldwide. Science 2004, 306, 1783–1786. [Google Scholar]
- Cushman, S.A. Effects of habitat loss and fragmentation on amphibians: A review and prospectus. Biol. Conserv 2006, 128, 231–240. [Google Scholar]
- Hof, C.; Araújo, M.B.; Jetz, W.; Rahbek, C. Additive threats from pathogens, climate and land-use change for global amphibian diversity. Nature 2011, 480, 516–519. [Google Scholar]
- Semlitsch, R.D. Conservation of Pond-Breeding Amphibians. In Amphibian Conservation; Semlitsch, R.D., Ed.; Smithsonian Institution: Washington DC, USA, 2003; pp. 8–23. [Google Scholar]
- Denoël, M.; Ficetola, G.F. Conservation of newt guilds in an agricultural landscape of Belgium: The importance of aquatic and terrestrial habitats. Aquat. Conserv. Mar. Freshw. Ecosyst 2008, 18, 714–728. [Google Scholar]
- Jim, J.; Caramaschi, U. Uma nova espécie de Odontophrynus da região de Botucatu, São Paulo, Brasil (Amphibia, Anura). Rev. Bras. Biol 1980, 40, 357–360. [Google Scholar]
- Brasileiro, C.A.; Martins, I.A.; Jim, J. Amphibia, Anura, Cycloramphidae, Odontophrynus moratoi: Distribution extension and advertisement call. Check List 2008, 4, 382–385. [Google Scholar]
- Instituto Florestal de São Paulo, Inventário Florestal da Vegetação Natural do Estado de São Paulo; Secretaria do Meio Ambiente, Seção de Manejo e Inventário Florestal: São Paulo, Brazil, 2005.
- Secretaria de Estado do Meio Ambiente, Cerrado: Bases Para Conservação e uso Sustentável das Áreas de Cerrado do Estado de São Paulo; Secretaria do Meio Ambiente: São Paulo, Brazil, 1997.
- Rolim, D.C. Bioecologia de Odontophrynus moratoi (Amphibia, Anura, Cycloramphidae). Master Dissertation, State University of São Paulo—UNESP, Botucatu, SP, Brazil, February 2009. [Google Scholar]
- Cruz, C.A.G.; Caramaschi, U. Odontophrynus moratoi. IUCN 2010. IUCN Red List of Threatened Species. Version 2010.1. Available online: http://www.iucnredlist.org accessed on 18 March 2012.
- Ministério do Meio Ambiente, Livro Vermelho da Fauna Brasileira Ameaçada de Extinção, 1st ed; Ministério do Meio Ambiente: Brasília, Brazil; Fundação Biodiversitas: Belo Horizonte, Brazil, 2008; pp. 311–312.
- Secretaria do Meio Ambiente, Fauna Ameaçada de Extinção no Estado de São Paulo: Vertebrados, 1st ed; Secretaria do Meio Ambiente, Fundação Parque Zoológico de São Paulo: São Paulo, Brazil, 2009; pp. 331–337.
- Amaro, R.C.; Pavan, D.; Rodrigues, M.T. On the generic identity of Odontophrynus moratoi Jim & Caramaschi, 1980 (Anura, Cycloramphidae). Zootaxa 2009, 2071, 61–68. [Google Scholar]
- Soma, M.; Jim, J.; Ruiz, I.R.G.; Batistic, R.F. Determination of karyotypes and nuclear DNA content in frogs on the Family Leptodactyldiae. Biol. Gen. Exper 2006, 6, 14–23. [Google Scholar]
- Bikandi, J. Microsatellite Repeats Finder. 2006. Available online: http://biophp.org/minitools/microsatellite_repeats_finder/demo.php accessed on 10 March 2011.
- Tóth, G.; Gáspári, Z.; Jurka, J. Microsatellites in different eukaryotic genomes: Survey and analysis. Genome Res 2000, 10, 967–981. [Google Scholar]
- Brandstrom, M.; Ellegren, H. Genome-Wide analysis of microsatellite polymorphism circumventing the ascertainment bias. Genome Res 2008, 18, 881–887. [Google Scholar]
- Marshall, T.C.; Slate, J.; Kruuk, L.E.B.; Pemberton, J.M. Statistical confidence for likelihood-based paternity inference in natural populations. Mol. Ecol 1998, 7, 639–655. [Google Scholar]
- Oosterhout, C.V.; Hutchinson, W.F.; Wills, D.P.M.; Shipley, P. Micro-Checker software for identifying and correcting genotyping errors in microsatellite data. Mol. Ecol. Notes 2004, 4, 535–538. [Google Scholar]
- Kijas, J.M.H.; Fowler, J.C.S.; Garbett, C.A.; Thomas, M.R. Enrichment of microsatellites from the citrus genome using biotinylated oligonucleotide sequences bound to streptavidin-coated magnetic particles. Biotechniques 1994, 16, 656–662. [Google Scholar]
- Sambrook, J.; Fritsch, E.F.; Maniatis, T. Molecular Cloning—A Laboratory Manual, 2nd ed; Cold Spring Harbor Laboratory Press: New York, NY, USA, 1989. [Google Scholar]
- Rozen, S.; Skaletsky, H.J. Primer 3 on the WWW for General Users and for Biologist Programmers. In Bioinformatics Methods and Protocols: Methods in Molecular Biology, 1st ed; Krawetz, S., Misener, S., Eds.; Humana Press: Totowa, NJ, USA, 2000; pp. 365–386. [Google Scholar]
- Pidancier, N.; Miguel, C.; Miaud, C. Buccal swabs as a non-destructive tissue sampling method for DNA analysis in amphibians. Herpetol. J 2003, 13, 175–178. [Google Scholar]
- Creste, S.; Tulmann Neto, A.; Figueira, A. Detection of simple sequence repeat polymorphism in denaturing polyacrylamide sequencing gels by silver staining. Plant. Mol. Biol. Rep 2001, 19, 299–306. [Google Scholar]
- Lazar, I.; Lazar, I. Gel Analyzer 2010a: Freeware 1D gel electrophoresis image analysis software. 2010. Available online: http://www.gelanalyzer.com accessed on 10 March 2011.
- Yeh, F.C.; Yang, R.; Boylet, T. POPGENE Version 1.32: Software Microsoft Window-Based Freeware for Population Genetic Analysis; University of Alberta: Edmonton, Canada, 1997. [Google Scholar]
- Rousset, F. GENEPOP’007: A complete re-implementation of the GENEPOP software for Windows and Linux. Mol. Ecol. Resour 2008, 8, 103–106. [Google Scholar]
- Guo, S.W.; Thompson, E.A. Performing the exact test of Hardy–Weinberg proportion for multiple alleles. Biometrics 1992, 48, 361–372. [Google Scholar]
- Rice, W.R. Analyzing tables of statistical tests. Evolution 1989, 43, 223–225. [Google Scholar]
- Brookfield, J.F.Y. A simple new method for estimating null allele frequency from heterozygote deficiency. Mol. Ecol 1996, 5, 453–456. [Google Scholar]
Genbank Accession n° | Locus | Repeat Motif | Primer Sequence (5′→3′) | TA | MgCl2 (mM) |
---|---|---|---|---|---|
JX441952 | Pmoratoiμ1 | (TTTC)9 | Forward: GGTGAACATCCTTTTCGTAGC | 50 °C | 0.6 |
Reverse: CACTCCTTCCCTAATCCAGTTT | |||||
JX441953 | Pmoratoiμ2 | (AC)4AT(AC)7 (AC)4 | Forward: ACACATCGTTCTGCACTACACAC | 63 °C | 1.0 |
Reverse: GCTCCCTTGTCTTGCTGTCT | |||||
JX441954 | Pmoratoiμ3 | (TA)8CACA CAT(AC)8 | Forward: CTAACCGTCCAATAGCCTGTGT | 63 °C | 0.6 |
Reverse: CCTCTTTCCCCTTGTGTGTCT | |||||
JX441955 | Pmoratoiμ4 | (AC)6G(CA)5 | Forward: AAATGAGGTGGCTGTGCTAAAT | 60 °C | 3.5 |
Reverse: ATGCATTAGTGGTCATCACTGG | |||||
JX441956 | Pmoratoiμ5 | (CA)8 | Forward: TATCTGTATTGCCTGCTCCACAC | 68 °C | 3.5 |
Reverse: CCTAGTGAGCTAAAAGTTGTGCTTGT | |||||
JX441957 | Pmoratoiμ6 | (ACAT)4 (AC)15 | Forward: CTGCACCACCCCTTGAATAA | 46 °C | 0.8 |
Reverse: TGCACAGCAGGATCAATCTAAC | |||||
JX441958 | Pmoratoiμ7 | (AC)8 | Forward: ACTTCCAGGTGCCATATCTTCA | 51 °C | 1.0 |
Reverse: AATTCTTGGTCTGCCATACTGTG | |||||
JX441959 | Pmoratoiμ8 | (AC)6 | Forward: GCGAATAATTGGAAAGCACAG | 68 °C | 3.5 |
Reverse: GCCTGAGCCAGAGTTGAATAGTA | |||||
JX441960 | Pmoratoiμ9 | (ATT)4…(TAT)4 | Forward: GATAATTGACCGTTTCCGTCAT | 63 °C | 4.0 |
Reverse: CATGGAACAAACTGAAGAGAACC | |||||
JX441961 | Pmoratoiμ10 | (TA)4(CA)7 | Forward: CTAATAAAGTGGCCGGTGAGTG | 50 °C | 0.8 |
Reverse: ATAGGACTACATTGTGCCCTTGA | |||||
JX441962 | Pmoratoiμ11 | (CA)8 | Forward: TCCAAAGTTCTAGCCTTGTTAG | 57 °C | 4.0 |
Reverse: CGCTACACATACCTTGAGAAA | |||||
JX441963 | Pmoratoiμ12 | (ATCT)7 (CA)5…(CA)4 | Forward: CCTTCCCACCTTCCCTCTC | 66 °C | 2.5 |
Reverse: CGATCAACCTCCTCTTCTGTCTAC | |||||
JX441964 | Pmoratoiμ13 | (CA)7 | Forward: CTGTTTGGACTGCGATTCTT | 50 °C | 1.0 |
Reverse: GCATTTGTGTGTGAGAGTGAA | |||||
JX441965 | Pmoratoiμ14 | (ACAT)8 | Forward: GTCAAATGAGGCGGCTGTG | 63 °C | 1.5 |
Reverse: GCCATTATTGCTTGTATTGCTTCAG | |||||
JX441966 | Pmoratoiμ15 | (GATA)12 (CA)8 | Forward: CTTTAGGGCAGTCCAAGATTA | 50 °C | 1.5 |
Reverse: TGAAGGGGACACATTTTAAG | |||||
JX441967 | Pmoratoiμ16 | (TCA)8 | Forward: CTACACTAAAACGTCTCAATCAATG | 66 °C | 2.5 |
Reverse: ATGATGAAGAACTGGAGGAAGA | |||||
JX441968 | Pmoratoiμ17 | (CAC)7 | Forward: CCCAAAGAGTGCCAAGAAAATA | 60 °C | 0.8 |
Reverse: GGTAACAAACAACAAACCAGTATCAAC | |||||
JX441969 | Pmoratoiμ18 | (CA)7 | Forward: GTGTAATCCTGGGGTTCAGGTA | 57 °C | 1.0 |
Reverse: TCCCACCTTGGTCAGATATTGT | |||||
JX441970 | Pmoratoiμ19 | (CA)8 | Forward: TATAGTCCAGGCAGCCCCTTTA | 68 °C | 1.0 |
Reverse: GTCCGTGAGTGACGCAAAGT | |||||
JX441971 | Pmoratoiμ20 | (CA)5AG(CA)6 | Forward: GATTCCCAGCAGAACATCAC | 63 °C | 0.8 |
Reverse: GGACTATGGAGCAATGAAAGAA | |||||
JX441972 | Pmoratoiμ21 | (CA)4…(CA)4… (CA)5…(CA)7 | Forward: GGGGCACAGTGTATATGTCAGT | 66 °C | 3.0 |
Reverse: TTGAGCTGGTGAGGCAGTT | |||||
JX441973 | Pmoratoiμ22 | (TTTC)17 | Forward: AAAATTCCGCTCAGTCATTA | 42 °C | 4.0 |
Reverse: ACTCCTTCCCTAATCCAGTTT | |||||
JX441974 | Pmoratoiμ23 | (TA)4(CA)11 | Forward: ACCTGGTCTAACCCTTTGGAAAT | 70 °C | 3.0 |
Reverse: CAGCGTTACCAGACATTTTATGTTC | |||||
JX441975 | Pmoratoiμ24 | (AT)7 | Forward: GCTATTTGTCTACCTATCTATCTTTCAT | 40 °C | 4.0 |
Reverse: CAATAAAACTCTGGACCTTGAAC | |||||
JX441976 | Pmoratoiμ25 | (ACT)11 | Forward: TCTAATGTCCACACTGCTACTACT | 70 °C | 4.0 |
Reverse: GCTAATGGCCGAGTTATTG | |||||
JX441977 | Pmoratoiμ26 | (CA)7 | Forward: ATTTGGCTGTCTGACCTGTCTTA | 63 °C | 4.0 |
Reverse: CCCATATTAGTTCGGATCACAAG | |||||
JX441978 | Pmoratoiμ27 | (TCTA)17 | Forward: CTCTATCTAACCCTTTCATA | 57 °C | 2.0 |
Reverse: AAGATGGATAGATGTGAGA | |||||
JX441979 | Pmoratoiμ28 | (CA)8 | Forward: GAAATGAGAGGCGTGAGAGAT | 51 °C | 1.0 |
Reverse: GCTGTCCGTCAATGGGTAT | |||||
JX441980 | Pmoratoiμ29 | (CA)16 | Forward: GAGGAAAAGTCAAGGAACTAAATGTC | 46 °C | 0.8 |
Reverse: ACAGTCTTCTCAATCTGCATGTCT |
Population Locus | São Carlos (n = 41) | Bauru (n = 27) | Brotas (n = 41) | Avaré (n = 1) | LP (n = 3) | Total | ||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
NA | HO | HE | NA | HO | HE | NA | HO | HE | NA | NA | S | NA | PIC | |
Pmoratoiμ5 | 5 | 0.29 | 0.35 | - | - | - | 3 | 0.06 | 0.06 | - | - | 201–239 | 6 | 0.47 |
Pmoratoiμ6 | 8 | 0.70 | 0.71 | 5 | 0.62 | 0.68 | 9 | 0.59 | 0.68 | 2 | 1 | 208–240 | 10 | 0.78 |
Pmoratoiμ7 | 1 | 0.00 | 0.00 | 1 | 0.00 | 0.00 | 2 | 0.46 | 0.48 | 1 | 1 | 185–187 | 2 | 0.28 |
Pmoratoiμ8 | 2 | 0.17 | 0.16 | 1 | 0.00 | 0.00 | 2 | 0.02 | 0.02 | 1 | 1 | 209–211 | 2 | 0.06 |
Pmoratoiμ10 | 3 | 0.30 | 0.31 | 1 | 0.00 | 0.00 | 3 | 0.12 | 0.12 | 1 | 1 | 109–113 | 3 | 0.15 |
Pmoratoiμ11 | 2 | 0.05 | 0.05 | 1 | 0.00 | 0.00 | 3 | 0.12 | 0.14 | 1 | 1 | 125–129 | 3 | 0.07 |
Pmoratoiμ12 | 6 | 0.80 | 0.77 | 8 | 0.52 | 0.64 | 13 | 0.85 | 0.87 | 3 | 2 | 144–196 | 14 | 0.82 |
Pmoratoiμ13 | 2 | 0.12 | 0.16 | 3 | 0.42 | 0.59 | 2 | 0.05 | 0.05 | 2 | 1 | 162–168 | 4 | 0.34 |
Pmoratoiμ14 | 7 | 0.75 | 0.76 | 1 | 0.00 | 0.00 | 5 | 0.68 | 0.71 | 1 | 2 | 190–218 | 8 | 0.71 |
Pmoratoiμ15 | 10 | 0.67 | 0.80 | 9 | 0.83 | 0.79 | 12 | 0.73 | 0.85 | 2 | 2 | 177–241 | 18 | 0.84 |
Pmoratoiμ16 | 3 | 0.62 | 0.55 | 3 | 0.75 | 0.64 | 2 | 0.10 | 0.10 | 2 | 1 | 146–158 | 4 | 0.48 |
Pmoratoiμ17 | 3 | 0.08 | 0.08 | 2 | 0.04 | 0.04 | 1 | 0.00 | 0.00 | 1 | 1 | 092–098 | 3 | 0.09 |
Pmoratoiμ18 | 1 | 0.00 | 0.00 | 1 | 0.00 | 0.00 | 1 | 0.00 | 0.00 | 2 | 1 | 163–165 | 2 | 0.02 |
Pmoratoiμ19 | 2 | 0.50 | 0.51 | 2 | 0.46 | 0.49 | 2 | 0.36 | 0.43 | 2 | 1 | 167–169 | 2 | 0.40 |
Pmoratoiμ21 | 1 | 0.00 | 0.00 | 2 | 0.40 | 0.47 | 2 | 0.17 | 0.16 | 1 | 1 | 242–246 | 3 | 0.25 |
Pmoratoiμ23 | 9 | 0.72 | 0.86 | 4 | 0.29 | 0.61 | 7 | 0.76 | 0.81 | 3 | 1 | 225–251 | 12 | 0.87 |
Pmoratoiμ24 | 3 | 0.26 | 0.66 * | 2 | 0.30 | 0.47 | 2 | 0.10 | 0.09 | 1 | 2 | 148–174 | 8 | 0.72 |
Pmoratoiμ25 | 3 | 0.60 | 0.55 | 3 | 0.57 | 0.58 | 2 | 0.54 | 0.51 | 1 | 2 | 246–252 | 3 | 0.53 |
Pmoratoiμ26 | 2 | 0.13 | 0.12 | 2 | 0.42 | 0.38 | 2 | 0.41 | 0.46 | 1 | 1 | 119–133 | 4 | 0.38 |
Pmoratoiμ27 | 8 | 0.45 | 0.77 * | 8 | 0.87 | 0.84 | 9 | 0.69 | 0.85 | 4 | 2 | 196–244 | 12 | 0.86 |
Pmoratoiμ28 | 2 | 0.45 | 0.49 | 3 | 0.58 | 0.58 | 3 | 0.61 | 0.62 | 1 | 1 | 195–203 | 3 | 0.48 |
Pmoratoiμ29 | 8 | 0.90 | 0.84 | 7 | 0.96 | 0.77 | 6 | 0.47 | 0.64 * | 3 | 1 | 154–198 | 11 | 0.80 |
© 2012 by the authors; licensee Molecular Diversity Preservation International, Basel, Switzerland. This article is an open-access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).
Share and Cite
Arruda, M.P.; Costa, W.P.; Silva, C.C.; Pimentel, S.M.R. Development of 22 Polymorphic Microsatellite Loci for the Critically Endangered Morato’s Digger Toad, Proceratophrys moratoi. Int. J. Mol. Sci. 2012, 13, 12259-12267. https://doi.org/10.3390/ijms131012259
Arruda MP, Costa WP, Silva CC, Pimentel SMR. Development of 22 Polymorphic Microsatellite Loci for the Critically Endangered Morato’s Digger Toad, Proceratophrys moratoi. International Journal of Molecular Sciences. 2012; 13(10):12259-12267. https://doi.org/10.3390/ijms131012259
Chicago/Turabian StyleArruda, Maurício Papa, William Pinheiro Costa, Carla Cristina Silva, and Shirlei Maria Recco Pimentel. 2012. "Development of 22 Polymorphic Microsatellite Loci for the Critically Endangered Morato’s Digger Toad, Proceratophrys moratoi" International Journal of Molecular Sciences 13, no. 10: 12259-12267. https://doi.org/10.3390/ijms131012259