Polymorphic Microsatellite Loci Isolated from the Squalidus argentatus Using PCR-Based Isolation of Microsatellite Arrays (PIMA)
Abstract
:1. Introduction
2. Experimental Section
2.1. Isolation of Microsatellite Markers
2.2. Data Analysis
3. Results and Discussion
4. Conclusions
Acknowledgments
References
- Chen, IS; Chang, YC. Taxonomic revision and mitochondrial sequence evolution of the cyprinid genus Squalidus (Teleostei: Cyprinidae) in Taiwan with description of a new species. Raffles Bull Zool 2007, S14, 69–76. [Google Scholar]
- Sinica, Fauna. Osteichthyes. In Cypriniformes III; Yue, QP, Ed.; Science Press: Beijing, China, 2000. [Google Scholar]
- Jarne, P; Lagoda, PJL. Microsatellites, from molecules to populations and back. Trends Ecol Evol 1996, 11, 424–429. [Google Scholar]
- Wang, QQ; Wu, JM; Zhang, FT; Wang, JW. Early Development and Starvation Tolerance of the Larva of Squalidus argentatus in Chishui River. Chin J Zool 2010, 45, 11–20. [Google Scholar]
- Yang, J; He, S; Freyhof, J; Witte, K; Liu, H. The phylogenetic relationships of the Gobioninae (Teleostei: Cyprinidae) inferred from mitochondrial cytochrome b gene sequences. Hydrobiologia 2006, 553, 255–266. [Google Scholar]
- Sambrook, J; Fritsch, EF; Maniatis, T. Molecular Cloning: A Laboratory Manual, 2nd ed; Cold Spring Harbor Laboratory Press: New York, NY, USA, 1989. [Google Scholar]
- Lunt, DH; Hutchinson, WF; Carvalho, GR. An efficient method for PCR-based isolation of microsatellite arrays (PIMA). Mol Ecol 1999, 8, 891–893. [Google Scholar]
- Lin, HD; Lee, TW; Lin, FJ; Lin, CJ; Chiang, TY. Isolation and characterization of microsatellite loci in the endangered freshwater fish Pararasbora moltrechti (Cyprinidae) using PCR-based isolation of microsatellite arrays (PIMA). Conservat Genet 2008, 9, 945–947. [Google Scholar]
- Chiang, TY; Lee, TW; Lin, FJ; Huang, KH; Lin, HD. Isolation and characterization of microsatellite loci in the endangered freshwater fish Varicorhinus alticorpus (Cyprinidae). Conservat Genet 2008, 9, 1399–1401. [Google Scholar]
- Cifarelli, RA; Gallitelli, M; Cellini, F. Random Amplified Hybridization Microsatellites (Rahm)—Isolation of a New Class of Microsatellite-Containing DNA Clones. Nucleic Acids Res 1995, 23, 3802–3803. [Google Scholar]
- Rozen, S; Skaletsky, H. Primer3 on the WWW for General Users and for Biologist Programmers. In Bioinformatics Methods and Protocols; Krawetz, S, Misener, S, Eds.; Humana Press: Totowa, NJ, USA, 2000; pp. 365–386. [Google Scholar]
- Excoffier, L; Lischer, HEL. Arlequin suite ver 3.5: A new series of programs to perform population genetics analyses under Linux and Windows. Mol Ecol Res 2010, 10, 564–567. [Google Scholar]
- Rice, WR. Analyzing tables of statistical tests. Evolution 1989, 43, 223–225. [Google Scholar]
- van Oosterhout, C; Hutchinson, WF; Wills, DPM; Shipley, P. MICRO-CHECKER: Software for identifying and correcting genotyping errors in microsatellite. Mol Ecol Notes 2004, 4, 535–538. [Google Scholar]
- Fu, CZ; Wu, JH; Chen, JK; Qu, QH; Lei, GC. Freshwater fish biodiversity in the Yangtze River basin of China: Patterns, threats and conservation. Biodiversity Conservation 2003, 12, 1649–1685. [Google Scholar]
Locus | Genbank Accession No. | Primer sequence(5′ to 3′) | Repeat motif | Size range (bp) | Tm °C |
---|---|---|---|---|---|
MISA01 | JN582002 | F: TCTGACCCAACGGTTTCTGC | (TG)10 | 222–252 | 63 |
R: GGACACCTGCTGACGCTCTT | |||||
MISA02 | JN582003 | F: AGCTAACTGAGCTGCATACAAC | (AG)18 | 262–280 | 59 |
R: GGTGGTGGAACATAAAGTGACA | |||||
MISA03 | JN582004 | F: AGCCAACCTGCGTCGTTATCTAC | (TG)14 | 186–222 | 63 |
R: GGGACTCACAACCAGTTTTGGTT | |||||
MISA04 | JN582005 | F: ATCAAAGGTAAGAGAACATCAGCG | (CT)21 | 212–308 | 61 |
R: TCAATTAAATCCTTCCCGGTGTAC | |||||
MISA05 | JN582006 | F: TTGAGCATGACAGAGCACACAGAATC | (AG)8G(GA)27 | 298–370 | 63 |
R: CGAAACCAGTGAATGCCAAAGTCTC | |||||
MISA06 | JN582007 | F: TGGCTCCTTTCACACCCGT | (CAT)6…(TC)10…(TC)6…(TG)6 | 202–280 | 63 |
R: AGGCAGGAGAGGAAGAGCG | |||||
MISA07 | JN582008 | F: AGGACACCTGCTGACGCTCTT | (AC)9 | 224–246 | 65 |
R: CTCTGACCCAACGGTTTCTGC | |||||
MISA08 | JN582009 | F: TGACACAGTGTAGACTTTCCAAAC | (TC)15(TG)9 | 202–278 | 61 |
R: GAACTCAGCAGAAATAGAAACCAT | |||||
MISA09 | JN582010 | F: ATCGCTTCAGACTCACCTCATC | (TG)31 | 326–380 | 63 |
R: AAACCTCAAATTCGACCAAAAT | |||||
MISA10 | JN582011 | F: ACACTGAGGAGTTCAAATAAAGCC | (TG)5…(TG)6 | 182–194 | 61.5 |
R: TCATCTTCTAAGAGAGCAGGAGTG | |||||
MISA11 | JN582012 | F: CGATCATCATGGTGTTTCCTGC | (AC)9…(CA)15 | 246–346 | 61 |
R: TCGGGTTGTATTGCTCTTCAGT |
Yangtze River | Qiantang River | |||||||
---|---|---|---|---|---|---|---|---|
NA | Ho | HE | HWE P-value | NA | Ho | HE | HWE P-value | |
MISA01 | 6 | 0.73333 | 0.81839 | 0.11512 | 6 | 0.68182 | 0.80655 | 0.05309 |
MISA02 | 4 | 0.64706 | 0.75758 | 0.23241 | 4 | 0.95455 | 0.74947 | 0.12959 |
MISA03 | 7 | 0.81250 | 0.73185 | 0.03699 | 6 | 0.70588 | 0.82353 | 0.32288 |
MISA04 | 8 | 0.85714 | 0.88153 | 0.13961 | 14 | 0.81818 | 0.92812 | 0.29437 |
MISA05 | 11 | 0.82353 | 0.91979 | 0.32180 | 14 | 0.90909 | 0.91966 | 0.02107 |
MISA06 | 11 | 0.71429 | 0.92328 | 0.11708 | 12 | 0.72727 | 0.87844 | 0.29985 |
MISA07 | 4 | 0.63158 | 0.66145 | 0.12610 | 5 | 0.81818 | 0.71776 | 0.51218 |
MISA08 | 7 | 0.66667 | 0.84762 | 0.38511 | 13 | 0.77273 | 0.92600 | 0.06433 |
MISA09 | 5 | 0.46667 | 0.69885 | 0.22965 | 8 | 0.81818 | 0.85095 | 0.47429 |
MISA10 | 4 | 0.66667 | 0.71661 | 0.00038 | 4 | 0.54545 | 0.74841 | 0.00152 |
MISA11 | 3 | 0.33333 | 0.48046 | 0.03974 | 9 | 0.47619 | 0.78513 | 0.00000 |
mean | 6.364 | 0.66843 | 0.76704 | 8.636 | 0.74796 | 0.83037 |
© 2011 by the authors; licensee MDPI, Basel, Switzerland. This article is an open-access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).
Share and Cite
Sun, Y.; Lin, H.-D.; Tang, W.-Q.; Ju, Y.-M.; Liu, Z.-Z.; Liu, D.; Yang, J.-Q. Polymorphic Microsatellite Loci Isolated from the Squalidus argentatus Using PCR-Based Isolation of Microsatellite Arrays (PIMA). Int. J. Mol. Sci. 2011, 12, 5666-5671. https://doi.org/10.3390/ijms12095666
Sun Y, Lin H-D, Tang W-Q, Ju Y-M, Liu Z-Z, Liu D, Yang J-Q. Polymorphic Microsatellite Loci Isolated from the Squalidus argentatus Using PCR-Based Isolation of Microsatellite Arrays (PIMA). International Journal of Molecular Sciences. 2011; 12(9):5666-5671. https://doi.org/10.3390/ijms12095666
Chicago/Turabian StyleSun, Yang, Hung-Du Lin, Wen-Qiao Tang, Yu-Min Ju, Zhi-Zhi Liu, Dong Liu, and Jin-Quan Yang. 2011. "Polymorphic Microsatellite Loci Isolated from the Squalidus argentatus Using PCR-Based Isolation of Microsatellite Arrays (PIMA)" International Journal of Molecular Sciences 12, no. 9: 5666-5671. https://doi.org/10.3390/ijms12095666