Rapid Detection of Alpha-Fetoprotein (AFP) with Lateral Flow Aptasensor
Abstract
:1. Introduction
2. Results
2.1. Characterization of AuNP and AuNP-Det-Apt Conjugates
2.2. Working Principles of the AuNP-Based Lateral Flow Aptasensor
2.3. Optimization of Analytical Parameters
2.4. Analytical Performance
2.5. Specificity Tests
2.6. Testing of Actual Samples
3. Discussion
4. Materials and Methods
4.1. Apparatus
4.2. Reagents and Materials
4.3. Preparation of Gold Nanoparticles (AuNPs)
4.4. Preparation of AuNP-Det-Apt Conjugates
4.5. Preparation of Streptavidin-Biotinylated Cap-Apt and Streptavidin-Biotinylated Con-DNA Conjugates
4.6. Preparation of Lateral Flow Aptasensors
4.7. Assay Procedure
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Siegel, R.L.; Miller, K.D.; Fuchs, H.E.; Jemal, A. Cancer statistics, 2021. CA Cancer J. Clin. 2021, 71, 7–33. [Google Scholar] [CrossRef] [PubMed]
- Wu, J.; Fu, Z.; Yan, F.; Ju, H. Biomedical and clinical applications of immunoassays and immunosensors for tumor markers. TrAC Trends Anal. Chem. 2007, 26, 679–688. [Google Scholar] [CrossRef]
- Rizzo, G.E.M.; Cabibbo, G.; Craxì, A. Hepatitis B virus-associated hepatocellular carcinoma. Viruses 2022, 14, 986. [Google Scholar] [CrossRef] [PubMed]
- Parikh, N.D.; Tayob, N.; Singal, A.G. Blood-based biomarkers for hepatocellular carcinoma screening: Approaching the end of the ultrasound era? J. Hepatol. 2023, 78, 207–216. [Google Scholar] [CrossRef]
- Lakhi, N.A.; Mizejewski, G.J. Alpha-fetoprotein and Fanconi anemia: Relevance to DNA repair and breast cancer susceptibility. Fetal Pediatr. Pathol. 2017, 36, 49–61. [Google Scholar] [CrossRef]
- Klink, F.; Grosspietzsch, R.; Conte, N.; Vallerino, G.; Diani, F. Alpha-fetoprotein and beta-human chorionic gonadotropin in amniotic fluid. Int. J. Biol. Res. Pregnancy 1981, 2, 99–101. [Google Scholar]
- Ruoslahti, E.; Seppala, M. Development of radioimmunoassay for alpha-fetoprotein. Demonstration of alpha-fetoprotein in healthy human adults. Int. J. Cancer 1971, 8, 374. [Google Scholar] [CrossRef]
- Naz, Z.; Usman, S.; Saleem, K.; Ahmed, S.; Bashir, H.; Bilal, M.; Sumrin, A. Alpha-fetoprotein: A fabulous biomarker in hepatocellular, gastric and rectal cancer diagnosis. Biomed. Res 2018, 29, 2478–2483. [Google Scholar] [CrossRef]
- Giannini, E.G.; Sammito, G.; Farinati, F.; Ciccarese, F.; Pecorelli, A.; Rapaccini, G.L.; Di Marco, M.; Caturelli, E.; Zoli, M.; Borzio, F. Determinants of alpha-fetoprotein levels in patients with hepatocellular carcinoma: Implications for its clinical use. Cancer 2014, 120, 2150–2157. [Google Scholar] [CrossRef]
- Kal-Koshvandi, A.T. Recent advances in optical biosensors for the detection of cancer biomarker α-fetoprotein (AFP). TrAC Trends Anal. Chem. 2020, 128, 115920. [Google Scholar] [CrossRef]
- Gumus, E.; Bingol, H.; Zor, E. Lateral flow assays for detection of disease biomarkers. J. Pharm. Biomed. Anal. 2023, 225, 115206. [Google Scholar] [CrossRef] [PubMed]
- Bai, Y.; Tian, C.; Wei, X.; Wang, Y.; Wang, D.; Shi, X. A sensitive lateral flow test strip based on silica nanoparticle/CdTe quantum dot composite reporter probes. RSC Adv. 2012, 2, 1778–1781. [Google Scholar] [CrossRef]
- Lu, L.; Yu, J.; Liu, X.; Yang, X.; Zhou, Z.; Jin, Q.; Xiao, R.; Wang, C. Rapid, quantitative and ultra-sensitive detection of cancer biomarker by a SERRS-based lateral flow immunoassay using bovine serum albumin coated Au nanorods. RSC Adv. 2020, 10, 271–281. [Google Scholar] [CrossRef] [PubMed]
- Deng, J.; Yang, M.; Wu, J.; Zhang, W.; Jiang, X. A self-contained chemiluminescent lateral flow assay for point-of-care testing. Anal. Chem. 2018, 90, 9132–9137. [Google Scholar] [CrossRef]
- Liu, Q.; Cheng, S.; Chen, R.; Ke, J.; Liu, Y.; Li, Y.; Feng, W.; Li, F. Near-infrared lanthanide-doped nanoparticles for a low interference lateral flow immunoassay test. ACS Appl. Mater. Interfaces 2020, 12, 4358–4365. [Google Scholar] [CrossRef]
- Negahdary, M. Aptamers in nanostructure-based electrochemical biosensors for cardiac biomarkers and cancer biomarkers: A review. Biosens. Bioelectron. 2020, 152, 112018. [Google Scholar] [CrossRef]
- Mehmood, S.; Khan, A.; Bilal, M.; Sohail, A.; Iqbal, H. Aptamer-based biosensors: A novel toolkit for early diagnosis of cancer. Mater. Today Chem. 2019, 12, 353–360. [Google Scholar] [CrossRef]
- Sousa, D.A.; Carneiro, M.; Ferreira, D.; Moreira, F.T.; Sales, M.G.F.; Rodrigues, L.R. Recent advances in the selection of cancer-specific aptamers for the development of biosensors. Curr. Med. Chem. 2022, 29, 5850–5880. [Google Scholar] [CrossRef]
- McKeague, M.; DeRosa, M.C. Challenges and opportunities for small molecule aptamer development. J. Nucleic Acids 2012, 2012, 748913. [Google Scholar] [CrossRef]
- Darmostuk, M.; Rimpelova, S.; Gbelcova, H.; Ruml, T. Current approaches in SELEX: An update to aptamer selection technology. Biotechnol. Adv. 2015, 33, 1141–1161. [Google Scholar] [CrossRef]
- Huang, C.-J.; Lin, H.-I.; Shiesh, S.-C.; Lee, G.-B. An integrated microfluidic system for rapid screening of alpha-fetoprotein-specific aptamers. Biosens. Bioelectron. 2012, 35, 50–55. [Google Scholar] [CrossRef] [PubMed]
- Dong, L.; Tan, Q.; Ye, W.; Liu, D.; Chen, H.; Hu, H.; Wen, D.; Liu, Y.; Cao, Y.; Kang, J. Screening and identifying a novel ssDNA aptamer against alpha-fetoprotein using CE-SELEX. Sci. Rep. 2015, 5, 15552. [Google Scholar] [CrossRef] [PubMed]
- Liu, L.; Wang, H.; Xie, B.; Zhang, B.; Lin, Y.; Gao, L. Detection of alpha-fetoprotein using aptamer-based sensors. Biosensors 2022, 12, 780. [Google Scholar] [CrossRef]
- Schmid, F.X. Biological Macromolecules: UV-visible Spectrophotometry. Encycl. Life Sci. 2001. [Google Scholar] [CrossRef]
- Hu, D.; Cui, H.; Wang, X.; Luo, F.; Qiu, B.; Cai, W.; Huang, H.; Wang, J.; Lin, Z. Highly sensitive and selective photoelectrochemical aptasensors for cancer biomarkers based on MoS2/Au/GaN photoelectrodes. Anal. Chem. 2021, 93, 7341–7347. [Google Scholar] [CrossRef]
- Wang, Q.; Hu, Y.; Jiang, N.; Wang, J.; Yu, M.; Zhuang, X. Preparation of aptamer responsive DNA functionalized hydrogels for the sensitive detection of α-fetoprotein using SERS method. Bioconjug. Chem. 2020, 31, 813–820. [Google Scholar] [CrossRef]
- Li, W.; Chen, M.; Liang, J.; Lu, C.; Zhang, M.; Hu, F.; Zhou, Z.; Li, G. Electrochemical aptasensor for analyzing alpha-fetoprotein using RGO–CS–Fc nanocomposites integrated with gold–platinum nanoparticles. Anal. Methods 2020, 12, 4956–4966. [Google Scholar] [CrossRef]
- Li, G.; Zeng, J.; Liu, H.; Ding, P.; Liang, J.; Nie, X.; Zhou, Z. A fluorometric aptamer nanoprobe for alpha-fetoprotein by exploiting the FRET between 5-carboxyfluorescein and palladium nanoparticles. Microchim. Acta 2019, 186, 1–9. [Google Scholar] [CrossRef]
- Chen, F.; Zhang, F.; Liu, Y.; Cai, C. Simply and sensitively simultaneous detection hepatocellular carcinoma markers AFP and miRNA-122 by a label-free resonance light scattering sensor. Talanta 2018, 186, 473–480. [Google Scholar] [CrossRef]
- Duong, D.S.T.; Jang, C.-H. Highly sensitive label-free liquid crystal-based aptasensor to detect alpha-fetoprotein. Liq. Cryst. 2022, 49, 709–718. [Google Scholar] [CrossRef]
- Daigo, K.; Sugita, S.; Mochizuki, Y.; Iwanari, H.; Hiraishi, K.; Miyano, K.; Kodama, T.; Hamakubo, T. A simple hybridoma screening method for high-affinity monoclonal antibodies using the signal ratio obtained from time-resolved fluorescence assay. Anal. Biochem. 2006, 351, 219–228. [Google Scholar] [CrossRef] [PubMed]
- Verma, H.N.; Singh, P.; Chavan, R. Gold nanoparticle: Synthesis and characterization. Vet. World 2014, 7, 72. [Google Scholar] [CrossRef]
- Wu, Y.; Yu, Q.; Joung, Y.; Jeon, C.S.; Lee, S.; Pyun, S.H.; Joo, S.-W.; Chen, L.; Choo, J. Highly uniform self-assembly of gold nanoparticles by butanol-induced dehydration and its sers applications in SARS-CoV-2 detection. Anal. Chem. 2023, 95, 12710–12718. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Tang, L.; Yu, Q.; Qiu, W.; Li, K.; Cheng, L.; Zhang, T.; Qian, L.; Zhang, X.; Liu, G. Gold-platinum nanoflowers as colored and catalytic labels for ultrasensitive lateral flow MicroRNA-21 assay. Sens. Actuators B Chem. 2021, 344, 130325. [Google Scholar] [CrossRef]
- Liang, R.-L.; Xu, X.-P.; Liu, T.-C.; Zhou, J.-W.; Wang, X.-G.; Ren, Z.-Q.; Hao, F.; Wu, Y.-S. Rapid and sensitive lateral flow immunoassay method for determining alpha fetoprotein in serum using europium (III) chelate microparticles-based lateral flow test strips. Anal. Chim. Acta 2015, 891, 277–283. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Sun, J.; Xianyu, Y.; Yin, B.; Niu, Y.; Wang, S.; Cao, F.; Zhang, X.; Wang, Y.; Jiang, X. A dual-readout chemiluminescent-gold lateral flow test for multiplex and ultrasensitive detection of disease biomarkers in real samples. Nanoscale 2016, 8, 15205–15212. [Google Scholar] [CrossRef]
- Lu, X.; Mei, T.; Guo, Q.; Zhou, W.; Li, X.; Chen, J.; Zhou, X.; Sun, N.; Fang, Z. Improved performance of lateral flow immunoassays for alpha-fetoprotein and vanillin by using silica shell-stabilized gold nanoparticles. Microchim. Acta 2019, 186, 1–7. [Google Scholar] [CrossRef]
- Shen, W.; Wang, C.; Yang, X.; Wang, C.; Zhou, Z.; Liu, X.; Xiao, R.; Gu, B.; Wang, S. Synthesis of raspberry-like nanogapped Fe3O4@Au nanocomposites for SERS-based lateral flow detection of multiple tumor biomarkers. J. Mater. Chem. C 2020, 8, 12854–12864. [Google Scholar] [CrossRef]
- Li, Y.; Ke, J.; Liu, Q.; Yuan, W.; Su, Q.; Kong, M.; Wu, N.; Feng, W.; Huang, C.; Li, F. NIR-II emitting rare-earth nanoparticles for a lateral flow immunoassay in hemolysis. Sens. Actuators B Chem. 2021, 345, 130380. [Google Scholar] [CrossRef]
- Chen, R.; Zhou, X.; Wu, Y.; Liu, Q.; Liu, Q.; Huang, J.; Li, F. NIR-II emissive lateral flow immunoassay for accurate determination of tumor marker in hemolysis. Sens. Actuators B Chem. 2021, 328, 129050. [Google Scholar] [CrossRef]
- Hu, X.; Wan, J.; Peng, X.; Zhao, H.; Shi, D.; Mai, L.; Yang, H.; Zhao, Y.; Yang, X. Calorimetric lateral flow immunoassay detection platform based on the photothermal effect of gold nanocages with high sensitivity, specificity, and accuracy. Int. J. Nanomed. 2019, 14, 7695–7705. [Google Scholar] [CrossRef]
Note | Sequence (5′–3′) |
---|---|
AP-Taiwan | GGCAGGAAGACAAACAAGCTTGGCGGCGGGAAGG TGTTTAAATTCCCGGGTCTGCGTGGTCTGTGGTGCTGT |
AP-273 | GTGACGCTCCTAACGCTGACTCAGGTGCAGTTCTCGA CTCGGTCTTGATGTGGGTCCTGTCCGTCCGAACCAATC |
AP-3 | TCAGGTGCAGTTCTCGACTCGGTCTTGATGTGGGT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ma, M.; Zhang, M.; Wang, J.; Zhou, Y.; Zhang, X.; Liu, G. Rapid Detection of Alpha-Fetoprotein (AFP) with Lateral Flow Aptasensor. Molecules 2025, 30, 484. https://doi.org/10.3390/molecules30030484
Ma M, Zhang M, Wang J, Zhou Y, Zhang X, Liu G. Rapid Detection of Alpha-Fetoprotein (AFP) with Lateral Flow Aptasensor. Molecules. 2025; 30(3):484. https://doi.org/10.3390/molecules30030484
Chicago/Turabian StyleMa, Meijing, Min Zhang, Jiahui Wang, Yurui Zhou, Xueji Zhang, and Guodong Liu. 2025. "Rapid Detection of Alpha-Fetoprotein (AFP) with Lateral Flow Aptasensor" Molecules 30, no. 3: 484. https://doi.org/10.3390/molecules30030484
APA StyleMa, M., Zhang, M., Wang, J., Zhou, Y., Zhang, X., & Liu, G. (2025). Rapid Detection of Alpha-Fetoprotein (AFP) with Lateral Flow Aptasensor. Molecules, 30(3), 484. https://doi.org/10.3390/molecules30030484