Application of Cinnamomum burmannii Essential Oil in Promoting Wound Healing
Abstract
1. Introduction
2. Results
2.1. Chemical Characterization of Essential Oil
2.2. BEO Network and Shared Targets with Wound Healing
2.3. BEO Promoted Wound Healing In Vitro
2.4. BEO Attenuated Inflammatory Response In Vitro
2.5. BEO Promoted Wound Healing In Vivo
2.6. BEO Reduces the Levels of Inflammatory Factors in the Healing Skin
3. Discussion
4. Materials and Methods
4.1. Materials
4.2. Gas Chromatography–Mass Spectrometry (GC-MS) Characterization of BEO
4.3. Bacterial Strains
4.4. Antimicrobial Activity of the BEO
4.5. MIC and MBC
4.6. Network Construction and Prediction of Genes Associated with Wound Healing
4.7. Cell Culture
4.8. In Vitro Cell Viability and Cytotoxicity Test
4.9. Scratch Assay
4.10. Quantitative Real-Time PCR
4.11. Enzyme-Linked Immunosorbent Assay (ELISA) Measurements
4.12. Flow Cytometry
4.13. Western Blot
4.14. Animal Models and Drug Administration
4.15. Histology and Immunohistochemistry Analysis
4.16. Flow Cytometry Was Used to Detect the Activation of Spleen T Cells
4.17. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Deng, P.; Yao, L.; Chen, J.; Tang, Z.; Zhou, J. Chitosan-based hydrogels with injectable, self-healing and antibacterial properties for wound healing. Carbohydr. Polym. 2022, 276, 118718. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kour, H.; Raina, R.; Verma, P.K.; Khan, A.M.; Bhat, M.A.; Nashiruddullah, N. Evaluation of the wound healing activity of ethanolic extract of Bergenia ciliata (Haw.) Sternb. rhizome with excision wound model in Wistar rats. J. Ethnopharmacol. 2021, 281, 114527. [Google Scholar] [CrossRef] [Scilit]
- Sen, C.K.; Gordillo, G.M.; Roy, S.; Kirsner, R.; Lambert, L.; Hunt, T.K.; Gottrup, F.; Gurtner, G.C.; Longaker, M.T. Human skin wounds: A major and snowballing threat to public health and the economy. Wound Repair Regen. 2009, 17, 763. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Garraud, O.; Hozzein, W.N.; Badr, G. Wound healing: Time to look for intelligent, ‘natural’ immunological approaches? BMC Immunol. 2017, 18 (Suppl. S1), 23. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stan, D.; Tanase, C.; Avram, M.; Apetrei, R.; Mincu, N.B.; Mateescu, A.L.; Stan, D. Wound healing applications of creams and “smart” hydrogels. Exp. Dermatol. 2021, 30, 1218. [Google Scholar] [CrossRef] [Scilit]
- Tottoli, E.M.; Dorati, R.; Genta, I.; Chiesa, E.; Pisani, S.; Conti, B. Skin Wound Healing Process and New Emerging Technologies for Skin Wound Care and Regeneration. Pharmaceutics 2020, 12, 735. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ridiandries, A.; Tan, M.J.T.; Bursill, C.A. The Role of Chemokines in Wound Healing. Int. J. Mol. Sci. 2018, 19, 3217. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rodrigues, M.; Kosaric, N.; Bonham, C.A.; Gurtner, G.C. Wound Healing: A Cellular Perspective. Physiol. Rev. 2019, 99, 665. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Clark, R.A.F. Fibrin Is a Many Splendored Thing. J. Investig. Dermatol. 2003, 121, 21. [Google Scholar] [CrossRef] [Scilit]
- Su, L.; Zheng, J.; Wang, Y.; Zhang, W.; Hu, D. Emerging progress on the mechanism and technology in wound repair. Biomed. Pharmacother. 2019, 117, 109191. [Google Scholar] [CrossRef] [Scilit]
- Bhubhanil, S.; Talodthaisong, C.; Khongkow, M.; Namdee, K.; Wongchitrat, P.; Yingmema, W.; Hutchison, J.A.; Lapmanee, S.; Kulchat, S. Enhanced wound healing properties of guar gum/curcumin-stabilized silver nanoparticle hydrogels. Sci. Rep. 2021, 11, 21836. [Google Scholar] [CrossRef] [Scilit]
- Diegelmann, R.F.; Evans, M.C. Wound healing: An overview of acute, fibrotic and delayed healing. Front. Biosci. 2004, 9, 283. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Landén, N.X.; Li, D.; Ståhle, M. Transition from inflammation to proliferation: A critical step during wound healing. Cell Mol. Life Sci. 2016, 73, 3861. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- de Sousa, D.P.; Silva, R.H.N.; Silva, E.F.D.; Gavioli, E.C. Essential Oils and Their Constituents: An Alternative Source for Novel Antidepressants. Molecules 2017, 22, 1290. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xie, J.; Wu, X.; Zheng, S.; Lin, K.; Su, J. Aligned electrospun poly(L-lactide) nanofibers facilitate wound healing by inhibiting macrophage M1 polarization via the JAK-STAT and NF-κB pathways. J. Nanobiotechnol. 2022, 20, 342. [Google Scholar] [CrossRef] [Scilit]
- Tu, Z.L.; Chen, M.; Wang, M.; Shao, Z.X.; Jiang, X.Q.; Wang, K.Y.; Yao, Z.; Yang, S.W.; Zhang, X.X.; Gao, W.Y.; et al. Engineering Bioactive M2 Macrophage-Polarized Anti-Inflammatory, Antioxidant, and Antibacterial Scaffolds for Rapid Angiogenesis and Diabetic Wound Repair. Adv. Funct. Mater. 2021, 31, 2100924. [Google Scholar] [CrossRef] [Scilit]
- Ma, Q.; Ma, R.; Su, P.; Jin, B.; Guo, J.; Tang, J.; Chen, T.; Zeng, W.; Lai, C.; Ling, F.; et al. Elucidation of the essential oil biosynthetic pathways in Cinnamomum burmannii through identification of six terpene synthases. Plant Sci. 2022, 317, 111203. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Singh, N.; Rao, A.S.; Nandal, A.; Kumar, S.; Yadav, S.S.; Ganaie, S.A.; Narasimhan, B. Phytochemical and pharmacological review of Cinnamomum verum J. Presl-a versatile spice used in food and nutrition. Food Chem. 2021, 338, 127773. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Al-Dhubiab, B.E. Pharmaceutical applications and phytochemical profile of Cinnamomum burmannii. Pharmacogn. Rev. 2012, 6, 125. [Google Scholar] [CrossRef] [Scilit]
- Kumar, S.; Kumari, R.; Mishra, S. Pharmacological properties and their medicinal uses of Cinnamomum: A review. J. Pharm. Pharmacol. 2019, 71, 1735. [Google Scholar] [CrossRef] [Scilit]
- de Sousa, D.P.; Damasceno, R.O.S.; Amorati, R.; Elshabrawy, H.A.; de Castro, R.D.; Bezerra, D.P.; Nunes VR, V.; Gomes, R.C.; Lima, T.C. Essential Oils: Chemistry and Pharmacological Activities. Biomolecules 2023, 13, 1144. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- de Sousa, D.P.; de Almeida Soares Hocayen, P.; Andrade, L.N.; Andreatini, R. A Systematic Review of the Anxiolytic-Like Effects of Essential Oils in Animal Models. Molecules 2015, 20, 18620. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Long, Y.; Li, D.; Yu, S.; Zhang, Y.L.; Liu, S.Y.; Wan, J.Y.; Shi, A.; Deng, J.; Wen, J.; Li, X.Q.; et al. Natural essential oils: A promising strategy for treating cardio-cerebrovascular diseases. J. Ethnopharmacol. 2022, 297, 115421. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, J.; Chen, W.; Liu, H.; Liu, H.; Xiang, S.; You, F.; Jiang, Y.; Lin, J.; Zhang, D.; Zheng, C. Pharmacologic effects approach of essential oils and their components on respiratory diseases. J. Ethnopharmacol. 2023, 304, 115962. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pérez-Recalde, M.; Ruiz Arias, I.E.; Hermida, É.B. Could essential oils enhance biopolymers performance for wound healing? A systematic review. Phytomedicine 2018, 38, 57. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Salas-Oropeza, J.; Jimenez-Estrada, M.; Perez-Torres, A.; Castell-Rodriguez, A.E.; Becerril-Millan, R.; Rodriguez-Monroy, M.A.; Canales-Martinez, M.M. Wound Healing Activity of the Essential Oil of Bursera morelensis, in Mice. Molecules 2020, 25, 1795. [Google Scholar] [CrossRef] [Scilit]
- Pandey, V.K.; Tripathi, A.; Srivastava, S.; Dar, A.H.; Singh, R.; Farooqui, A.; Pandey, S. Exploiting the bioactive properties of essential oils and their potential applications in food industry. Food Sci. Biotechnol. 2023, 32, 885. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ming, Z.; Han, L.; Bao, M.; Zhu, H.; Qiang, S.; Xue, S.; Liu, W. Living Bacterial Hydrogels for Accelerated Infected Wound Healing. Adv. Sci. 2021, 8, e2102545. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, M.; Zhang, Y.; Zhou, P.; Liu, X.; Zhao, H.; Zhou, X.; Gu, Q.; Li, B.; Zhu, X.; Shi, Q. Substrate stiffness modulates bone marrow-derived macrophage polarization through NF-κB signaling pathway. Bioact. Mater. 2020, 5, 880. [Google Scholar] [CrossRef] [Scilit]
- Liu, X.; Zhou, S.; Huang, Y.; Chen, M.; Wang, W.; Wang, J.; Hao, E.; Wu, H.; Li, Y. Chemical composition, antioxidant activity, and anti-bacterial activity of essential oils from different organs of Cinnamomum burmanni. J. Essent. Oil Bear. Plants 2023, 26, 787. [Google Scholar] [CrossRef] [Scilit]
- Smiljanić, K.; Prodić, I.; Trifunovic, S.; Krstić Ristivojević, M.; Aćimović, M.; Stanković Jeremić, J.; Lončar, B.; Tešević, V. Multistep Approach Points to Compounds Responsible for the Biological Activity and Safety of Hydrolates from Nine Lamiaceae Medicinal Plants on Human Skin Fibroblasts. Antioxidants 2023, 12, 1988. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rehman, A.; Iqbal, M.; Khan, B.A.; Khan, M.K.; Huwaimel, B.; Alshehri, S.; Alamri, A.H.; Alzhrani, R.M.; Bukhary, D.M.; Safhi, A.Y.; et al. Fabrication, In Vitro, and In Vivo Assessment of Eucalyptol-Loaded Nanoemulgel as a Novel Paradigm for Wound Healing. Pharmaceutics 2022, 14, 1971. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sharifi-Rad, J.; Dey, A.; Koirala, N.; Shaheen, S.; El Omari, N.; Salehi, B.; Goloshvili, T.; Cirone Silva, N.C.; Bouyahya, A.; Vitalini, S.; et al. Cinnamomum Species: Bridging Phytochemistry Knowledge, Pharmacological Properties and Toxicological Safety for Health Benefits. Front. Pharmacol. 2021, 12, 600139. [Google Scholar] [CrossRef] [Scilit]
- Ma, R.; Lu, D.; Wang, J.; Xie, Q.; Guo, J. Comparison of pharmacological activity and safety of different stereochemical configurations of borneol: L-borneol, D-borneol, and synthetic borneol. Biomed. Pharmacother. 2023, 164, 114668. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zeng, J.; Xue, Y.; Shu, P.; Qian, H.; Sa, R.; Xiang, M.; Li, X.N.; Luo, Z.; Yao, G.; Zhang, Y. Diterpenoids with Immunosuppressive Activities from Cinnamomum cassia. J. Nat. Prod. 2014, 77, 1948. [Google Scholar] [CrossRef] [Scilit]
- Yuan, X.; Han, L.; Fu, P.; Zeng, H.; Lv, C.; Chang, W.; Runyon, R.S.; Ishii, M.; Han, L.; Liu, K.; et al. Cinnamaldehyde accelerates wound healing by promoting angiogenesis via up-regulation of PI3K and MAPK signaling pathways. Lab. Investig. 2018, 98, 783. [Google Scholar] [CrossRef] [Scilit]
- Liao, J.C.; Deng, J.S.; Chiu, C.S.; Hou, W.C.; Huang, S.S.; Shie, P.H.; Huang, G.J. Anti-Inflammatory Activities of Cinnamomum cassia Constituents In Vitro and In Vivo. Evid. Based Complement Altern. Med. 2012, 2012, 429320. [Google Scholar] [CrossRef] [Scilit]
- Farias, A.P.P.; Monteiro, O.D.S.; da Silva, J.K.R.; Figueiredo, P.L.B.; Rodrigues, A.A.C.; Monteiro, I.N.; Maia, J.G.S. Chemical composition and biological activities of two chemotype-oils from Cinnamomum verum J. Presl growing in North Brazil. J. Food Sci. Technol. 2020, 57, 3176. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Seyed Ahmadi, S.G.; Farahpour, M.R.; Hamishehkar, H. Topical application of Cinnamon verum essential oil accelerates infected wound healing process by increasing tissue antioxidant capacity and keratin biosynthesis. Kaohsiung J. Med. Sci. 2019, 35, 686. [Google Scholar] [CrossRef] [Scilit]
- Grasman, J.M.; Williams, M.D.; Razis, C.G.; Bonzanni, M.; Golding, A.S.; Cairns, D.M.; Levin, M.; Kaplan, D.L. Hyperosmolar potassium inhibits myofibroblast conversion and reduces scar tissue formation. ACS Biomater. Sci. Eng. 2019, 5, 5327. [Google Scholar] [CrossRef] [Scilit]













| Number | Rt (min) | Abundance (%) | Compound | SI (%) |
|---|---|---|---|---|
| 1 | 3.2 | 0.53 | Propylene Glycol | 90 |
| 2 | 6.09 | 1.57 | (+)-α-Pinene | 96 |
| 3 | 6.52 | 0.86 | Camphene | 97 |
| 4 | 7.34 | 0.59 | β-Thujene | 93 |
| 5 | 7.4 | 1.19 | β-Pinene | 97 |
| 6 | 8.02 | 0.52 | β-Myrcene | 87 |
| 7 | 8.61 | 0.26 | α-Thujene | 87 |
| 8 | 9.16 | 1.56 | o-Cymene | 97 |
| 9 | 9.28 | 1.49 | D-Limonene | 99 |
| 10 | 9.36 | 8.42 | Eucalyptol | 97 |
| 11 | 11.89 | 0.19 | (+)-4-Carene | 97 |
| 12 | 12.77 | 11.91 | Linalyl propionate | 97 |
| 13 | 13.31 | 0.28 | Linalyl acetate | 84 |
| 14 | 13.93 | 3.8 | (+)-2-Bornanone | 98 |
| 15 | 15.16 | 43.34 | endo-Borneol | 96 |
| 16 | 15.69 | 1.69 | Terpinen-4-ol | 96 |
| 17 | 16.59 | 2.03 | α-Terpineol | 91 |
| 18 | 20.1 | 10.48 | Isobornyl acetate | 99 |
| 19 | 25.56 | 1.84 | Caryophyllene | 99 |
| 20 | 27.0 | 0.67 | 1,5,9,9-Tetramethyl-1,4,7-cycloundecatriene | 98 |
| 21 | 27.28 | 0.01 | Humulene | 81 |
| 22 | 28.21 | 0.13 | β-copaene | 93 |
| 23 | 28.42 | 0.13 | β-Selinene | 99 |
| 24 | 28.78 | 0.29 | Bicyclogermacrene | 93 |
| 25 | 30.05 | 0.03 | Cadina-1(10),4-diene | 91 |
| 26 | 32.41 | 0.32 | (−)-Spathulenol | 91 |
| 27 | 32.92 | 0.63 | Guaiol | 99 |
| 28 | 34.2 | 0.04 | (+/−)-Cadinene | 89 |
| 29 | 34.36 | 0.39 | 1H-Cycloprop[e]azulen-7-ol, decahydro-1,1,7-trimethyl-4-methylene-, [1ar-(1aalpha,4aalpha,7beta,7abeta,7balpha)]- | 86 |
| 30 | 35.05 | 0.1 | (−)-α-Gurjunene | 96 |
| 31 | 35.13 | 0.06 | Oxo-Tremorine | 90 |
| 32 | 35.45 | 0.09 | β-Eudesmene | 93 |
| Microorganisms | Diameters of Inhibition Zone (mm) | MIC | MBC | ||||
|---|---|---|---|---|---|---|---|
| EGF | 10 mg/mL | 30 mg/mL | 50 mg/mL | 70 mg/mL | BEO (mg/mL) | ||
| S. aureus | 6.0 | 6.0 | 9.6 ± 0.42 | 11.2 ± 0.28 | 14.79 ± 0.45 | 16 | 32 |
| E. coli | 6.0 | 7.34 ± 0.21 | 8.56 ± 0.53 | 10.16 ± 0.45 | 13.8 ± 0.38 | 16 | 32 |
| Cinnamum Plant | Phytochemicals | Pharmacological Activity |
|---|---|---|
| C. burmaannii | α-Terpineol Eucalyptol Borneol | Increased fibroblast viability and/or proliferation [33]. Antioxidant and anti-inflammatory [31]. Antibacterial and anti-inflammatory [32]. |
| C. cassia | Cinncassiol G and cinnacasol Cinnamaldehyde | Inhibitory effects against proliferation of T cells and B cells [34]. Stimulates angiogenesis, promotes blood circulation [35]. Anti-inflammatory and analgesic [36]. |
| C. verum | Cinnamaldehyde benzyl benzoate | Antifungal and antioxidant [37]. Increasing cell proliferation, collagen synthesis, and reepithelialization ratio [38]. |
| C. loureiroi | Tannins and saponins | Astringents, healing, antiexudative, anti-irritative, anti-inflammatory, antiseptic, anesthetic and antioxidant [39]. |
| Gene | Forward Primer Sequence 5′–3′ | Reverse Primer Sequence 5′–3′ |
|---|---|---|
| Mouse β-actin | GGCTGTATTCCCCTCCATCG | CCAGTTGGTAACAATGCCATGT |
| Mouse IL-1β | GAAATGCCACCTTT TGACAGTG | TGGATGCTCTCAT CAGGACAG |
| Mouse IL-6 | CTGCAAGAGACT TCCATCCAG | AGTGGTATAGACAGG TCTGTTGG |
| Mouse TNF-α CD80 CD206 | CTGAACTTCGGGGTGATCGG CCTCAAGTTTCCATGTCCAAGGC AAACACAGACTGACCCTTCCC | GGCTTGYCACTCGAA TTTTGAGA GAGGAGAGTTGTAACGGCAAGG GTTAGTGTACCGCACCCTCC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, X.; Lin, X.; Cao, J.; Xie, G.; Yang, X.; Liu, B.; Xu, X.; Cheng, F.; Chen, H.; Pang, Y. Application of Cinnamomum burmannii Essential Oil in Promoting Wound Healing. Molecules 2024, 29, 2080. https://doi.org/10.3390/molecules29092080
Zhang X, Lin X, Cao J, Xie G, Yang X, Liu B, Xu X, Cheng F, Chen H, Pang Y. Application of Cinnamomum burmannii Essential Oil in Promoting Wound Healing. Molecules. 2024; 29(9):2080. https://doi.org/10.3390/molecules29092080
Chicago/Turabian StyleZhang, Xiangsheng, Xueyi Lin, Jiayuan Cao, Guofeng Xie, Xinrui Yang, Bingnan Liu, Xin Xu, Fang Cheng, Hongbo Chen, and Yuxin Pang. 2024. "Application of Cinnamomum burmannii Essential Oil in Promoting Wound Healing" Molecules 29, no. 9: 2080. https://doi.org/10.3390/molecules29092080
APA StyleZhang, X., Lin, X., Cao, J., Xie, G., Yang, X., Liu, B., Xu, X., Cheng, F., Chen, H., & Pang, Y. (2024). Application of Cinnamomum burmannii Essential Oil in Promoting Wound Healing. Molecules, 29(9), 2080. https://doi.org/10.3390/molecules29092080

