Peptide TaY Attenuates Inflammatory Responses by Interacting with Myeloid Differentiation 2 and Inhibiting NF-κB Signaling Pathway
Abstract
1. Introduction
2. Results and Discussion
2.1. TaY Reduced the Expression of Pro-Inflammatory Cytokines in LPS-Induced RAW264.7 Inflammation
2.2. TaY Inhibited the LPS-Activated TLR4-NF-κB Signaling Pathway
2.3. TaY Exerts Its Anti-Inflammatory Function by Binding to the MD2 Hydrophobic Pocket
3. Materials and Methods
3.1. Synthesis of Peptides
3.2. Cell Culture
3.3. Cytotoxicity Analysis
3.4. Determination of Nitric Oxide Content
3.5. Enzyme-Linked Immunosorbent Assay (ELISA)
3.6. RNA Isolation and Quantitative Real-Time PCR
3.7. Western Blot Analysis
3.8. Molecular Docking
3.9. Molecular Dynamics (MD) Simulations
3.10. Statistical Analysis
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Wolkowicz, P.; White, C.R.; Anantharamaiah, G.M. Apolipoprotein Mimetic Peptides: An Emerging Therapy against Diabetic Inflammation and Dyslipidemia. Biomolecules 2021, 11, 627. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zheng, L.; Zhang, Z.; Sheng, P.; Mobasheri, A. The role of metabolism in chondrocyte dysfunction and the progression of osteoarthritis. Ageing Res. Rev. 2021, 66, 101249. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mantovani, A.; Allavena, P.; Sica, A.; Balkwill, F. Cancer-related inflammation. Nature 2008, 454, 436–444. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ran, S.; Montgomery, K.E. Macrophage-mediated lymphangiogenesis: The emerging role of macrophages as lymphatic endothelial progenitors. Cancers 2012, 4, 618–657. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, S.; Cao, M.; Xu, S.; Zhang, J.; Wang, Z.; Mao, X.; Yao, X.; Liu, C. Effect of luteolin on inflammatory responses in RAW264.7 macrophages activated with LPS and IFN-γ. J. Funct. Foods 2017, 32, 123–130. [Google Scholar] [CrossRef] [Scilit]
- Amir, M.; Somakala, K.; Ali, S. p38 MAP kinase inhibitors as anti inflammatory agents. Mini Rev. Med. Chem. 2013, 13, 2082–2096. [Google Scholar] [CrossRef] [Scilit]
- Sun, Q.; Hu, S.; Lou, Z.; Gao, J. The macrophage polarization in inflammatory dermatosis and its potential drug candidates. Biomed. Pharmacother. 2023, 161, 114469. [Google Scholar] [CrossRef] [Scilit]
- Tang, D.; Cao, F.; Yan, C.; Fang, K.; Ma, J.; Gao, L.; Sun, B.; Wang, G. Extracellular Vesicle/Macrophage Axis: Potential Targets for Inflammatory Disease Intervention. Front. Immunol. 2022, 13, 705472. [Google Scholar] [CrossRef] [Scilit]
- Lu, Y.C.; Yeh, W.C.; Ohashi, P.S. LPS/TLR4 signal transduction pathway. Cytokine 2008, 42, 145–151. [Google Scholar] [CrossRef] [Scilit]
- Ryu, J.K.; Kim, S.J.; Rah, S.H.; Kang, J.I.; Jung, H.E.; Lee, D.; Lee, H.K.; Lee, J.O.; Park, B.S.; Yoon, T.Y.; et al. Reconstruction of LPS Transfer Cascade Reveals Structural Determinants within LBP, CD14, and TLR4-MD2 for Efficient LPS Recognition and Transfer. Immunity 2017, 46, 38–50. [Google Scholar] [CrossRef] [Scilit]
- Fitzgerald, K.A.; Kagan, J.C. Toll-like Receptors and the Control of Immunity. Cell 2020, 180, 1044–1066. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- de Queiroz, N.M.G.P.; Oliveira, L.S.; Gomes, M.T.R.; Carneiro, M.B.H.; Vieira, L.Q.; Oliveira, S.C.; Horta, M.F. Requirement of scavenger receptors for activation of the IRF-3/IFN-β/STAT-1 pathway in TLR4-mediated production of NO by LPS-activated macrophages. Nitric Oxide 2023, 134–135, 61–71. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Miranda, G.M.; Santos, V.; Bessa, J.R.; Teles, Y.C.F.; Yahouédéhou, S.; Goncalves, M.S.; Ribeiro-Filho, J. Inclusion Complexes of Non-Steroidal Anti-Inflammatory Drugs with Cyclodextrins: A Systematic Review. Biomolecules 2021, 11, 361. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Simon, L.S. Role and regulation of cyclooxygenase-2 during inflammation. Am. J. Med. 1999, 106, 37s–42s. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rao, P.; Knaus, E.E. Evolution of nonsteroidal anti-inflammatory drugs (NSAIDs): Cyclooxygenase (COX) inhibition and beyond. J. Pharm. Pharm. Sci. 2008, 11, 81s–110s. [Google Scholar] [CrossRef] [Scilit]
- Karthik, C.S.; Manukumar, H.M.; Ananda, A.P.; Nagashree, S.; Rakesh, K.P.; Mallesha, L.; Qin, H.L.; Umesha, S.; Mallu, P.; Krishnamurthy, N.B. Synthesis of novel benzodioxane midst piperazine moiety decorated chitosan silver nanoparticle against biohazard pathogens and as potential anti-inflammatory candidate: A molecular docking studies. Int. J. Biol. Macromol. 2018, 108, 489–502. [Google Scholar] [CrossRef] [Scilit]
- Wang, S.M.; Zha, G.F.; Rakesh, K.P.; Darshini, N.; Shubhavathi, T.; Vivek, H.K.; Mallesha, N.; Qin, H.L. Synthesis of benzo[d]thiazole-hydrazone analogues: Molecular docking and SAR studies of potential H(+)/K(+) ATPase inhibitors and anti-inflammatory agents. MedChemComm 2017, 8, 1173–1189. [Google Scholar] [CrossRef] [Scilit]
- Li, C.; Sridhara, M.B.; Rakesh, K.P.; Vivek, H.K.; Manukumar, H.M.; Shantharam, C.S.; Qin, H.L. Multi-targeted dihydrazones as potent biotherapeutics. Bioorg. Chem. 2018, 81, 389–395. [Google Scholar] [CrossRef] [Scilit]
- Henninot, A.; Collins, J.C.; Nuss, J.M. The Current State of Peptide Drug Discovery: Back to the Future? J. Med. Chem. 2018, 61, 1382–1414. [Google Scholar] [CrossRef] [Scilit]
- Otvos, L. The latest trends in peptide drug discovery and future challenges. Expert Opin. Drug Discov. 2024, 19, 869–872. [Google Scholar] [CrossRef] [Scilit]
- Muttenthaler, M.; King, G.F.; Adams, D.J.; Alewood, P.F. Trends in peptide drug discovery. Nat. Rev. Drug Discov. 2021, 20, 309–325. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shanura Fernando, I.P.; Asanka Sanjeewa, K.K.; Samarakoon, K.W.; Lee, W.W.; Kim, H.S.; Ranasinghe, P.; Gunasekara, U.; Jeon, Y.J. Antioxidant and anti-inflammatory functionality of ten Sri Lankan seaweed extracts obtained by carbohydrase assisted extraction. Food Sci. Biotechnol. 2018, 27, 1761–1769. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ishida, K.; Nagatake, T.; Saika, A.; Kawai, S.; Node, E.; Hosomi, K.; Kunisawa, J. Induction of unique macrophage subset by simultaneous stimulation with LPS and IL-4. Front. Immunol. 2023, 14, 1111729. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Coveney, S.; Murphy, S.; Belton, O.; Cassidy, T.; Crowe, M.; Dolan, E.; de Gaetano, M.; Harbison, J.; Horgan, G.; Marnane, M.; et al. Inflammatory cytokines, high-sensitivity C-reactive protein, and risk of one-year vascular events, death, and poor functional outcome after stroke and transient ischemic attack. Int. J. Stroke 2022, 17, 163–171. [Google Scholar] [CrossRef] [Scilit]
- Chen, J.; Xuan, J.; Gu, Y.T.; Shi, K.S.; Xie, J.J.; Chen, J.X.; Zheng, Z.M.; Chen, Y.; Chen, X.B.; Wu, Y.S.; et al. Celastrol reduces IL-1β induced matrix catabolism, oxidative stress and inflammation in human nucleus pulposus cells and attenuates rat intervertebral disc degeneration in vivo. Biomed. Pharmacother. 2017, 91, 208–219. [Google Scholar] [CrossRef] [Scilit]
- Bogdan, C. Nitric oxide and the immune response. Nat. Immunol. 2001, 2, 907–916. [Google Scholar] [CrossRef] [Scilit]
- Alvarez-Suarez, J.M.; Carrillo-Perdomo, E.; Aller, A.; Giampieri, F.; Gasparrini, M.; González-Pérez, L.; Beltrán-Ayala, P.; Battino, M. Anti-inflammatory effect of Capuli cherry against LPS-induced cytotoxic damage in RAW 264.7 macrophages. Food Chem. Toxicol. 2017, 102, 46–52. [Google Scholar] [CrossRef] [Scilit]
- Zhang, H.; Ren, Q.C.; Ren, Y.; Zhao, L.; Yang, F.; Zhang, Y.; Zhao, W.J.; Tan, Y.Z.; Shen, X.F. Ajudecumin A from Ajuga ovalifolia var. calantha exhibits anti-inflammatory activity in lipopolysaccharide-activated RAW264.7 murine macrophages and animal models of acute inflammation. Pharm. Biol. 2018, 56, 649–657. [Google Scholar] [CrossRef] [Scilit]
- Lee, S.M.; Son, K.N.; Shah, D.; Ali, M.; Balasubramaniam, A.; Shukla, D.; Aakalu, V.K. Histatin-1 Attenuates LPS-Induced Inflammatory Signaling in RAW264.7 Macrophages. Int. J. Mol. Sci. 2021, 22, 7856. [Google Scholar] [CrossRef] [Scilit]
- Marques, R.V.; Sestito, S.E.; Bourgaud, F.; Miguel, S.; Cailotto, F.; Reboul, P.; Jouzeau, J.Y.; Rahuel-Clermont, S.; Boschi-Muller, S.; Simonsen, H.T.; et al. Anti-Inflammatory Activity of Bryophytes Extracts in LPS-Stimulated RAW264.7 Murine Macrophages. Molecules 2022, 27, 1940. [Google Scholar] [CrossRef] [Scilit]
- Lee, S.R.; Lee, S.; Moon, E.; Park, H.J.; Park, H.B.; Kim, K.H. Bioactivity-guided isolation of anti-inflammatory triterpenoids from the sclerotia of Poria cocos using LPS-stimulated Raw264.7 cells. Bioorg. Chem. 2017, 70, 94–99. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, Q.; Lenardo, M.J.; Baltimore, D. 30 Years of NF-κB: A Blossoming of Relevance to Human Pathobiology. Cell 2017, 168, 37–57. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Akashi, S.; Saitoh, S.; Wakabayashi, Y.; Kikuchi, T.; Takamura, N.; Nagai, Y.; Kusumoto, Y.; Fukase, K.; Kusumoto, S.; Adachi, Y.; et al. Lipopolysaccharide interaction with cell surface toll-like receptor 4-MD-2: Higher affinity than that with MD-2 or CD14. J. Exp. Med. 2003, 198, 1035–1042. [Google Scholar] [CrossRef] [Scilit]
- Zeng, K.W.; Zhang, T.; Fu, H.; Liu, G.X.; Wang, X.M. Schisandrin B exerts anti-neuroinflammatory activity by inhibiting the Toll-like receptor 4-dependent MyD88/IKK/NF-κB signaling pathway in lipopolysaccharide-induced microglia. Eur. J. Pharmacol. 2012, 692, 29–37. [Google Scholar] [CrossRef] [Scilit]
- Shen, J.; Cheng, J.; Zhu, S.; Zhao, J.; Ye, Q.; Xu, Y.; Dong, H.; Zheng, X. Regulating effect of baicalin on IKK/IKB/NF-kB signaling pathway and apoptosis-related proteins in rats with ulcerative colitis. Int. Immunopharmacol. 2019, 73, 193–200. [Google Scholar] [CrossRef] [Scilit]
- Covert, M.W.; Leung, T.H.; Gaston, J.E.; Baltimore, D. Achieving stability of lipopolysaccharide-induced NF-κB activation. Science 2005, 309, 1854–1857. [Google Scholar] [CrossRef] [Scilit]
- Durand, J.K.; Baldwin, A.S. Targeting IKK and NF-κB for Therapy. Adv. Protein Chem. Struct. Biol. 2017, 107, 77–115. [Google Scholar] [CrossRef] [Scilit]
- Sugiyama, K.; Muroi, M.; Tanamoto, K. A novel TLR4-binding peptide that inhibits LPS-induced activation of NF-κB and in vivo toxicity. Eur. J. Pharmacol. 2008, 594, 152–156. [Google Scholar] [CrossRef] [Scilit]
- Qin, X.; Liu, Z.; Nong, K.; Fang, X.; Chen, W.; Zhang, B.; Wu, Y.; Wang, Z.; Shi, H.; Wang, X.; et al. Porcine-derived antimicrobial peptide PR39 alleviates DSS-induced colitis via the NF-κB/MAPK pathway. Int. Immunopharmacol. 2024, 127, 111385. [Google Scholar] [CrossRef] [Scilit]
- Sharp, C.R.; DeClue, A.E.; Haak, C.E.; Honaker, A.R.; Reinero, C.R. Evaluation of the anti-endotoxin effects of polymyxin B in a feline model of endotoxemia. J. Feline Med. Surg. 2010, 12, 278–285. [Google Scholar] [CrossRef] [Scilit]
- Wei, S.; Xu, P.; Yao, Z.; Cui, X.; Lei, X.; Li, L.; Dong, Y.; Zhu, W.; Guo, R.; Cheng, B. A composite hydrogel with co-delivery of antimicrobial peptides and platelet-rich plasma to enhance healing of infected wounds in diabetes. Acta Biomater. 2021, 124, 205–218. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nguyen, H.L.T.; Trujillo-Paez, J.V.; Umehara, Y.; Yue, H.; Peng, G.; Kiatsurayanon, C.; Chieosilapatham, P.; Song, P.; Okumura, K.; Ogawa, H.; et al. Role of Antimicrobial Peptides in Skin Barrier Repair in Individuals with Atopic Dermatitis. Int. J. Mol. Sci. 2020, 21, 7607. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Han, R.; Blencke, H.M.; Cheng, H.; Li, C. The antimicrobial effect of CEN1HC-Br against Propionibacterium acnes and its therapeutic and anti-inflammatory effects on acne vulgaris. Peptides 2018, 99, 36–43. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nagaoka, I.; Tamura, H.; Reich, J. Therapeutic Potential of Cathelicidin Peptide LL-37, an Antimicrobial Agent, in a Murine Sepsis Model. Int. J. Mol. Sci. 2020, 21, 5973. [Google Scholar] [CrossRef] [Scilit]
- Hosoda, H.; Nakamura, K.; Hu, Z.; Tamura, H.; Reich, J.; Kuwahara-Arai, K.; Iba, T.; Tabe, Y.; Nagaoaka, I. Antimicrobial cathelicidin peptide LL-37 induces NET formation and suppresses the inflammatory response in a mouse septic model. Mol Med. Rep. 2017, 16, 5618–5626. [Google Scholar] [CrossRef] [Scilit]
- Zhang, J.; Sun, Y.; Sun, C.; Shang, D. The antimicrobial peptide LK2(6)A(L) exhibits anti-inflammatory activity by binding to the myeloid differentiation 2 domain and protects against LPS-induced acute lung injury in mice. Bioorg. Chem. 2023, 132, 106376. [Google Scholar] [CrossRef] [Scilit]
- Park, B.S.; Song, D.H.; Kim, H.M.; Choi, B.S.; Lee, H.; Lee, J.O. The structural basis of lipopolysaccharide recognition by the TLR4-MD-2 complex. Nature 2009, 458, 1191–1195. [Google Scholar] [CrossRef] [Scilit]
- Li, Y.; Yu, Z.; Schenk, M.; Lagovsky, I.; Illig, D.; Walz, C.; Rohlfs, M.; Conca, R.; Muise, A.M.; Snapper, S.B.; et al. Human MD2 deficiency-an inborn error of immunity with pleiotropic features. J. Allergy Clin. Immunol. 2023, 151, 791–796.e7. [Google Scholar] [CrossRef] [Scilit]
- Kim, H.M.; Park, B.S.; Kim, J.I.; Kim, S.E.; Lee, J.; Oh, S.C.; Enkhbayar, P.; Matsushima, N.; Lee, H.; Yoo, O.J.; et al. Crystal structure of the TLR4-MD-2 complex with bound endotoxin antagonist Eritoran. Cell 2007, 130, 906–917. [Google Scholar] [CrossRef] [Scilit]
- Roh, E.; Lee, H.S.; Kwak, J.A.; Hong, J.T.; Nam, S.Y.; Jung, S.H.; Lee, J.Y.; Kim, N.D.; Han, S.B.; Kim, Y. MD-2 as the target of nonlipid chalcone in the inhibition of endotoxin LPS-induced TLR4 activity. J. Infect. Dis. 2011, 203, 1012–1020. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.; Shan, X.; Chen, G.; Jiang, L.; Wang, Z.; Fang, Q.; Liu, X.; Wang, J.; Zhang, Y.; Wu, W.; et al. MD-2 as the target of a novel small molecule, L6H21, in the attenuation of LPS-induced inflammatory response and sepsis. Br. J. Pharmacol. 2015, 172, 4391–4405. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gradisar, H.; Keber, M.M.; Pristovsek, P.; Jerala, R. MD-2 as the target of curcumin in the inhibition of response to LPS. J. Leukoc. Biol. 2007, 82, 968–974. [Google Scholar] [CrossRef] [Scilit]
- Peluso, M.R.; Miranda, C.L.; Hobbs, D.J.; Proteau, R.R.; Stevens, J.F. Xanthohumol and related prenylated flavonoids inhibit inflammatory cytokine production in LPS-activated THP-1 monocytes: Structure-activity relationships and in silico binding to myeloid differentiation protein-2 (MD-2). Planta Med. 2010, 76, 1536–1543. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, D.; Li, Y.; Liu, Y.; Xiang, X.; Dong, Z. Paclitaxel ameliorates lipopolysaccharide-induced kidney injury by binding myeloid differentiation protein-2 to block Toll-like receptor 4-mediated nuclear factor-κB activation and cytokine production. J. Pharmacol. Exp. Ther. 2013, 345, 69–75. [Google Scholar] [CrossRef] [Scilit]
- Wang, Z.; Chen, G.; Chen, L.; Liu, X.; Fu, W.; Zhang, Y.; Li, C.; Liang, G.; Cai, Y. Insights into the binding mode of curcumin to MD-2: Studies from molecular docking, molecular dynamics simulations and experimental assessments. Mol. Biosyst. 2015, 11, 1933–1938. [Google Scholar] [CrossRef] [Scilit]
- Wang, J.; Zhang, J.; Guo, H.; Cheng, Q.; Abbas, Z.; Tong, Y.; Yang, T.; Zhou, Y.; Zhang, H.; Wei, X.; et al. Optimization of Exopolysaccharide Produced by Lactobacillus plantarum R301 and Its Antioxidant and Anti-Inflammatory Activities. Foods 2023, 12, 2481. [Google Scholar] [CrossRef] [Scilit]
- Lamiable, A.; Thevenet, P.; Rey, J.; Vavrusa, M.; Derreumaux, P.; Tuffery, P. PEP-FOLD3: Faster de novo structure prediction for linear peptides in solution and in complex. Nucleic Acids Res. 2016, 44, W449–W454. [Google Scholar] [CrossRef] [Scilit]
- Zhou, P.; Jin, B.; Li, H.; Huang, S.Y. HPEPDOCK: A web server for blind peptide-protein docking based on a hierarchical algorithm. Nucleic Acids Res. 2018, 46, W443–W450. [Google Scholar] [CrossRef] [Scilit]
- Raveh, B.; London, N.; Schueler-Furman, O. Sub-angstrom modeling of complexes between flexible peptides and globular proteins. Proteins 2010, 78, 2029–2040. [Google Scholar] [CrossRef] [Scilit]
- Georgoulia, P.S.; Glykos, N.M. Molecular simulation of peptides coming of age: Accurate prediction of folding, dynamics and structures. Arch. Biochem. Biophys. 2019, 664, 76–88. [Google Scholar] [CrossRef] [Scilit]
- Al-Karmalawy, A.A.; Dahab, M.A.; Metwaly, A.M.; Elhady, S.S.; Elkaeed, E.B.; Eissa, I.H.; Darwish, K.M. Molecular Docking and Dynamics Simulation Revealed the Potential Inhibitory Activity of ACEIs Against SARS-CoV-2 Targeting the hACE2 Receptor. Front. Chem. 2021, 9, 661230. [Google Scholar] [CrossRef] [Scilit]
- Yu, Z.; Wang, Y.; Shuian, D.; Liu, J.; Zhao, W. Identification and Molecular Mechanism of Novel Immunomodulatory Peptides from Gelatin Hydrolysates: Molecular Docking, Dynamic Simulation, and Cell Experiments. J. Agric. Food Chem. 2023, 71, 2924–2934. [Google Scholar] [CrossRef] [Scilit]





| Name | Distance | Category | From | To |
|---|---|---|---|---|
| B: Lys1:H1-C: Glu92:OE1 | 1.77 | Electrostatic | B: Lys1:H1 | C: Glu92:OE1 |
| C: Lys128:NZ-B: Glu8:OE2 | 4.48 | Electrostatic | C: Lys128:NZ | B: Glu8:OE2 |
| B: Lys1:NZ-C: Glu122:OE1 | 5.49 | Electrostatic | B: Lys1:NZ | C: Glu122:OE1 |
| B: Gly17:OXT-C: Phe104 | 3.74 | Electrostatic | B: Gly17:OXT | C: Phe104 |
| C: Arg90:HE-B: Glu2:O | 2.40 | Hydrogen Bond | C: Arg90:HE | B: Glu2:O |
| C: Arg90:HH21-B: Glu2:O | 1.83 | Hydrogen Bond | C: Arg90:HH21 | B: Glu2:O |
| C: Lys91:H-B: Glu2:OE1 | 1.84 | Hydrogen Bond | C: Lys91:H | B: Glu2:OE1 |
| B: Lys4:HZ2-C: Pro88:O | 2.19 | Hydrogen Bond | B: Lys4:HZ2 | C: Pro88:O |
| B: Lys4:HZ3-C: Pro88:O | 2.21 | Hydrogen Bond | B: Lys4:HZ3 | C: Pro88:O |
| B: Ser13:HG-C: Glu92:OE1 | 1.77 | Hydrogen Bond | B: Ser13:HG | C: Glu92:OE1 |
| C: Arg90:HA-B: Glu2:OE1 | 2.53 | Hydrogen Bond | C: Arg90:HA | B: Glu2:OE1 |
| C: Lys128:HE1-B: Glu8:OE1 | 3.03 | Hydrogen Bond | C: Lys128:HE1 | B: Glu8:OE1 |
| B: Lys1:HA-C: Glu92:OE1 | 3.09 | Hydrogen Bond | B: Lys1:HA | C: Glu92:OE1 |
| C: Phe151-B: Tyr16 | 5.25 | Hydrophobic | C: Phe151 | B: Tyr16 |
| C: Phe119-B: Tyr14 | 5.40 | Hydrophobic | C: Phe119 | B: Tyr14 |
| C: Pro88-B: Lys4 | 4.30 | Hydrophobic | C: Pro88 | B: Lys4 |
| C: Pro88-B: Val6 | 5.46 | Hydrophobic | C: Pro88 | B: Val6 |
| C: Cys133-B: Pro11 | 4.41 | Hydrophobic | C: Cys133 | B: Pro11 |
| B: Lys4-C: Leu87 | 5.17 | Hydrophobic | B: Lys4 | C: Leu87 |
| B: Val6-C: Leu87 | 4.43 | Hydrophobic | B: Val6 | C: Leu87 |
| B: Pro11-C: Ile80 | 5.03 | Hydrophobic | B: Pro11 | C: Ile80 |
| B: Tyr16-C: Ile46 | 5.20 | Hydrophobic | B: Tyr16 | C: Ile46 |
| Gene | Sequence (5′-3′) | Length | |
|---|---|---|---|
| Tnf-α | F | GGCCAACGGCATGGATCTCAAA | 22 |
| R | TAGCAAATCGGCTGACGGTGTG | 22 | |
| IL-1β | F | AATCTCGCAGCAGCACATCAACA | 23 |
| R | ACACCAGCAGGTTATCATCATCATCC | 26 | |
| Inos | F | TGGAGCGAGTTGTGGATTGTCCTA | 24 |
| R | GCCTCTTGTCTTTGACCCAGTAGC | 24 | |
| Il-6 | F | TCTTGGGACTGATGCTGGTGA | 21 |
| R | TTGGGAGTGGTATCCTCTGTGAA | 23 | |
| β-Actin | F | TCACTATTGGCAACGAGCGGTTC | 23 |
| R | CAGCACTGTGTTGGCATAGAGGTC | 24 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, J.; Zhou, Y.; Zhang, J.; Tong, Y.; Abbas, Z.; Zhao, X.; Li, Z.; Zhang, H.; Chen, S.; Si, D.; et al. Peptide TaY Attenuates Inflammatory Responses by Interacting with Myeloid Differentiation 2 and Inhibiting NF-κB Signaling Pathway. Molecules 2024, 29, 4843. https://doi.org/10.3390/molecules29204843
Wang J, Zhou Y, Zhang J, Tong Y, Abbas Z, Zhao X, Li Z, Zhang H, Chen S, Si D, et al. Peptide TaY Attenuates Inflammatory Responses by Interacting with Myeloid Differentiation 2 and Inhibiting NF-κB Signaling Pathway. Molecules. 2024; 29(20):4843. https://doi.org/10.3390/molecules29204843
Chicago/Turabian StyleWang, Junyong, Yichen Zhou, Jing Zhang, Yucui Tong, Zaheer Abbas, Xuelian Zhao, Zhenzhen Li, Haosen Zhang, Sichao Chen, Dayong Si, and et al. 2024. "Peptide TaY Attenuates Inflammatory Responses by Interacting with Myeloid Differentiation 2 and Inhibiting NF-κB Signaling Pathway" Molecules 29, no. 20: 4843. https://doi.org/10.3390/molecules29204843
APA StyleWang, J., Zhou, Y., Zhang, J., Tong, Y., Abbas, Z., Zhao, X., Li, Z., Zhang, H., Chen, S., Si, D., Zhang, R., & Wei, X. (2024). Peptide TaY Attenuates Inflammatory Responses by Interacting with Myeloid Differentiation 2 and Inhibiting NF-κB Signaling Pathway. Molecules, 29(20), 4843. https://doi.org/10.3390/molecules29204843

