Biosynthesis of Silver Nanoparticles and Exploring Their Potential of Reducing the Contamination of the In Vitro Culture Media and Inducing the Callus Growth of Rumex nervosus Explants
Abstract
1. Introduction
2. Results
2.1. Characterization of the Synthesized AgNPs
2.2. AgNPs Reduce the Microbial Contamination in the Culture Media
2.3. Identification of the Fungus and Bacteria Isolated from the Contaminated Media
2.4. Quantification of the Antifungal and Antibacterial Effects of AgNPs
2.5. Effect of AgNPs on Callus Growth and Its Genetic Stability
3. Discussion
4. Materials and Methods
4.1. Plant Materials
4.2. Extract Preparation and Nanoparticles (AgNPs) Synthesis
4.3. Characterization of AgNPs
4.4. Effect of AgNPs on Reducing the Contamination of the Culture Media
4.5. Isolation and Identification of the Microbial Contaminants
4.6. AgNPs Antifungal Activity
4.7. AgNPs Antibacterial Activity
4.8. Effect of AgNPs on Callus Growth Induced from Rumex nervosus Explants
4.9. Genetic Stability of the Callus
4.10. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Sample Availability
References
- Benelmekki, M. Introduction to nanoparticles and nanotechnology. In Designing Hybrid Nanoparticles, 2nd ed.; IOP Publishing: Bristol, UK, 2021. [Google Scholar]
- Balashanmugam, P.; Kalaichelvan, P.T. Biosynthesis characterization of silver nanoparticles using Cassia roxburghii DC. aqueous extract, and coated on cotton cloth for effective antibacterial activity. Int. J. Nanomed. 2015, 10, 87. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sathishkumar, M.; Sneha, K.; Won, S.; Cho, C.-W.; Kim, S.; Yun, Y.-S. Cinnamon zeylanicum bark extract and powder mediated green synthesis of nano-crystalline silver particles and its bactericidal activity. Colloids Surf. B Biointerfaces 2009, 73, 332–338. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ghorbani, H.R. Biosynthesis of nanosilver particles using extract of Salmonella typhirium. Arab. J. Chem. 2017, 10, S1699–S1702. [Google Scholar] [CrossRef] [Scilit]
- Marslin, G.; Siram, K.; Maqbool, Q.; Selvakesavan, R.K.; Kruszka, D.; Kachlicki, P.; Franklin, G. Secondary metabolites in the green synthesis of metallic nanoparticles. Materials 2018, 11, 940. [Google Scholar] [CrossRef] [Scilit]
- Mukherjee, S.; Patra, C.R. Biologically synthesized metal nanoparticles: Recent advancement and future perspectives in cancer theranostics. Futur. Sci. OA 2017, 3, FSO203. [Google Scholar] [CrossRef] [Scilit]
- Vanaja, M.; Annadurai, G. Coleus aromaticus leaf extract mediated synthesis of silver nanoparticles and its bactericidal activity. Appl. Nanosci. 2013, 3, 217–223. [Google Scholar] [CrossRef] [Scilit]
- Velmurugan, P.; Anbalagan, K.; Manosathyadevan, M.; Lee, K.-J.; Cho, M.; Lee, S.-M.; Park, J.-H.; Oh, S.-G.; Bang, K.-S.; Oh, B.-T. Green synthesis of silver and gold nanoparticles using Zingiber officinale root extract and antibacterial activity of silver nanoparticles against food pathogens. Bioprocess Biosyst. Eng. 2014, 37, 1935–1943. [Google Scholar] [CrossRef] [Scilit]
- Chahardoli, A.; Karimi, N.; Fattahi, A. Biosynthesis, characterization, antimicrobial and cytotoxic effects of silver nanoparticles using Nigella arvensis seed extract. Iran. J. Pharm. Res. IJPR 2017, 16, 1167. [Google Scholar]
- Rani, P.U.; Laxmi, K.P.; Vadlapudi, V.; Sreedhar, B. Phytofabrication of silver nanoparticles using the mangrove associate, Hibiscus tiliaceus plant and its biological activity against certain insect and microbial pests. J. Biopestic. 2016, 9, 167. [Google Scholar] [CrossRef] [Scilit]
- Alawfi, A.A.; Henari, F.Z.; Younis, A.; Manaa, H. Bio-inspired synthesis of silver nanoparticles using Hibiscus tiliaceus L. flower extracts for improved optical characteristics. J. Mater. Sci. Mater. Electron. 2020, 31, 21073–21081. [Google Scholar] [CrossRef] [Scilit]
- Nandagopalan, V.; Gritto, M.J.; Doss, A. GC-MS analysis of bioactive components of the methanol extract of Hibiscus tiliaceus Linn. Asian J. Plant Sci. Res. 2015, 5, 6–10. [Google Scholar]
- Rosa, R.M.; Melecchi, M.I.S.; da Costa Halmenschlager, R.; Abad, F.C.; Simoni, C.R.; Caramao, E.B.; Henriques, J.A.P.; Saffi, J.; de Paula Ramos, A.L.L. Antioxidant and antimutagenic properties of Hibiscus tiliaceus L. methanolic extract. J. Agric. Food Chem. 2006, 54, 7324–7330. [Google Scholar] [CrossRef] [Scilit]
- Blaser, S.A.; Scheringer, M.; MacLeod, M.; Hungerbühler, K. Estimation of cumulative aquatic exposure and risk due to silver: Contribution of nano-functionalized plastics and textiles. Sci. Total Environ. 2008, 390, 396–409. [Google Scholar] [CrossRef] [Scilit]
- Ibrahim, E.; Fouad, H.; Zhang, M.; Zhang, Y.; Qiu, W.; Yan, C.; Li, B.; Mo, J.; Chen, J. Biosynthesis of silver nanoparticles using endophytic bacteria and their role in inhibition of rice pathogenic bacteria and plant growth promotion. RSC Adv. 2019, 9, 29293–29299. [Google Scholar] [CrossRef] [Scilit]
- Dong, Z.-Y.; Narsing Rao, M.P.; Xiao, M.; Wang, H.-F.; Hozzein, W.N.; Chen, W.; Li, W.-J. Antibacterial activity of silver nanoparticles against Staphylococcus warneri synthesized using endophytic bacteria by photo-irradiation. Front. Microbiol. 2017, 8, 1090. [Google Scholar] [CrossRef] [Scilit]
- Kim, S.W.; Jung, J.H.; Lamsal, K.; Kim, Y.S.; Min, J.S.; Lee, Y.S. Antifungal effects of silver nanoparticles (AgNPs) against various plant pathogenic fungi. Mycobiology 2012, 40, 53–58. [Google Scholar] [CrossRef] [Scilit]
- Mansoor, S.; Zahoor, I.; Baba, T.R.; Padder, S.A.; Bhat, Z.; Koul, A.M.; Jiang, L. Fabrication of silver nanoparticles against fungal pathogens. Front. Nanotechnol. 2021, 3, 679358. [Google Scholar] [CrossRef] [Scilit]
- Parzymies, M. Nano-silver particles reduce contaminations in tissue culture but decrease regeneration rate and slows down growth and development of Aldrovanda vesiculosa Explants. Appl. Sci. 2021, 11, 3653. [Google Scholar] [CrossRef] [Scilit]
- Aghdaei, M.; Sarmast, M.; Salehi, H. Effects of silver nanoparticles on Tecomella undulata (Roxb.) Seem. micropropagation. Adv. Hortic. Sci. 2012, 26, 21–24. [Google Scholar]
- Sarmast, M.; Niazi, A.; Salehi, H.; Abolimoghadam, A. Silver nanoparticles affect ACS expression in Tecomella undulata in vitro culture. Plant Cell Tissue Organ Cult. (PCTOC) 2015, 121, 227–236. [Google Scholar] [CrossRef] [Scilit]
- Sharma, P.; Bhatt, D.; Zaidi, M.; Saradhi, P.P.; Khanna, P.; Arora, S. Silver nanoparticle-mediated enhancement in growth and antioxidant status of Brassica juncea. Appl. Biochem. Biotechnol. 2012, 167, 2225–2233. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Al Yahya, N.A.; Alrumman, S.A.; Moustafa, M.F. Phytochemicals and antimicrobial activities of Rumex nervosus natural populations grown in Sarawat Mountains, Kingdom of Saudi Arabia. Arab. J. Sci. Eng. 2018, 43, 3465–3476. [Google Scholar] [CrossRef] [Scilit]
- Gemechu, W.; Woldekidan, S.; Teka, F.; Mohammed, J.; Ashebir, R.; Sisay, B.; Abebe, A.; Meresa, A. Ethnomedicinal uses, phytochemistry and pharmacological activities of Rumex nervosus. JAPLR 2021, 10, 65–69. [Google Scholar] [CrossRef] [Scilit]
- Alfarraj, N.S.; Al-Qurainy, F.; Nadeem, M.; Tarroum, M.; Alansi, S.; Salih, A.M.; Alenezi, N.; Shaikhaldein, H.O.; Alanazi, A.R.; Al-Humaid, L.A. An efficient and improved micropropagation method of rumex nervosus: A valuable medicinal plant from Saudi Arabia. Pak. J. Bot 2022, 54, 1909–1917. [Google Scholar] [CrossRef] [Scilit]
- Firdhouse, M.J.; Lalitha, P. Biosynthesis of silver nanoparticles and its applications. J. Nanotechnol. 2015, 2015, 829526. [Google Scholar] [CrossRef] [Scilit]
- Konduri, V.V.; Kalagatur, N.K.; Nagaraj, A.; Kalagadda, V.R.; Mangamuri, U.K.; Durthi, C.P.; Poda, S. Hibiscus tiliaceus mediated phytochemical reduction of zinc oxide nanoparticles and demonstration of their antibacterial, anticancer, and dye degradation capabilities. Indian J. Biochem. Biophys. 2022, 59, 565–574. [Google Scholar]
- Salih, A.M.; Al-Qurainy, F.; Khan, S.; Nadeem, M.; Tarroum, M.; Shaikhaldein, H.O. Biogenic silver nanoparticles improve bioactive compounds in medicinal plant Juniperus procera in vitro. Front. Plant Sci. 2022, 13, 962112. [Google Scholar] [CrossRef] [Scilit]
- Kahsay, M.H.; RamaDevi, D.; Kumar, Y.P.; Mohan, B.S.; Tadesse, A.; Battu, G.; Basavaiah, K. Synthesis of silver nanoparticles using aqueous extract of Dolichos lablab for reduction of 4-Nitrophenol, antimicrobial and anticancer activities. OpenNano 2018, 3, 28–37. [Google Scholar] [CrossRef] [Scilit]
- Mondal, A.H.; Yadav, D.; Ali, A.; Khan, N.; Jin, J.O.; Haq, Q.M.R. Anti-bacterial and anti-candidal activity of silver nanoparticles biosynthesized using Citrobacter spp. MS5 culture supernatant. Biomolecules 2020, 10, 944. [Google Scholar] [CrossRef] [Scilit]
- Lingegowda, D.C.; Kumar, J.K.; Prasad, A.D.; Zarei, M.; Gopal, S. FTIR spectroscopic studies on cleome gynandra-Comparative analysis of functional group before and after extraction. Rom. J. Biophys. 2012, 22, 137–143. [Google Scholar]
- Mistry, H.; Thakor, R.; Patil, C.; Trivedi, J.; Bariya, H. Biogenically proficient synthesis and characterization of silver nanoparticles employing marine procured fungi Aspergillus brunneoviolaceus along with their antibacterial and antioxidative potency. Biotechnol. Lett. 2021, 43, 307–316. [Google Scholar] [CrossRef] [Scilit]
- Mickymaray, S. One-step synthesis of silver nanoparticles using Saudi Arabian desert seasonal plant Sisymbrium irio and antibacterial activity against multidrug-resistant bacterial strains. Biomolecules 2019, 9, 662. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Coates, J. Interpretation of infrared spectra, a practical approach. In Encyclopedia of Analytical Chemistry: Applications, Theory, and Instrumentation; Wiley: Hoboken, NJ, USA, 2000. [Google Scholar]
- Nandiyanto, A.B.D.; Oktiani, R.; Ragadhita, R. How to read and interpret FTIR spectroscope of organic material. Indones. J. Sci. Technol. 2019, 4, 97–118. [Google Scholar] [CrossRef] [Scilit]
- Jyoti, K.; Baunthiyal, M.; Singh, A. Characterization of silver nanoparticles synthesized using Urtica dioica Linn. leaves and their synergistic effects with antibiotics. J. Radiat. Res. Appl. Sci. 2016, 9, 217–227. [Google Scholar] [CrossRef] [Scilit]
- Dubey, S.P.; Lahtinen, M.; Sillanpää, M. Tansy fruit mediated greener synthesis of silver and gold nanoparticles. Process Biochem. 2010, 45, 1065–1071. [Google Scholar] [CrossRef] [Scilit]
- Kumar, D.; Singh, K.; Verma, V.; Bhatti, H. Microwave-assisted synthesis and characterization of silver nanowires by polyol process. Appl. Nanosci. 2015, 5, 881–890. [Google Scholar] [CrossRef] [Scilit]
- Baran, A.; Baran, M.F.; Keskin, C.; Kandemir, S.I.; Valiyeva, M.; Mehraliyeva, S.; Khalilov, R.; Eftekhari, A. Ecofriendly/rapid synthesis of silver nanoparticles using extract of waste parts of artichoke (Cynara scolymus L.) and evaluation of their cytotoxic and antibacterial activities. J. Nanomater. 2021, 2021, 2270472. [Google Scholar] [CrossRef] [Scilit]
- Meng, Y. A sustainable approach to fabricating Ag nanoparticles/PVA hybrid nanofiber and its catalytic activity. Nanomaterials 2015, 5, 1124–1135. [Google Scholar] [CrossRef] [Scilit]
- Sowmyya, T.; Lakshmi, G.V. Soymida febrifuga aqueous root extract maneuvered silver nanoparticles as mercury nanosensor and potential microbicide. World Sci. News 2018, 114, 84–105. [Google Scholar]
- Shaikhaldein, H.O.; Al-Qurainy, F.; Nadeem, M.; Khan, S.; Tarroum, M.; Salih, A.M.; Alansi, S.; Al-Hashimi, A.; Alfagham, A.; Alkahtani, J. Assessment of the Impacts of Green Synthesized Silver Nanoparticles on Maerua oblongifolia Shoots under In Vitro Salt Stress. Materials 2022, 15, 4784. [Google Scholar] [CrossRef] [Scilit]
- Alenezi, N.A.; Al-Qurainy, F.; Tarroum, M.; Nadeem, M.; Khan, S.; Salih, A.M.; Shaikhaldein, H.O.; Alfarraj, N.S.; Gaafar, A.-R.Z.; Al-Hashimi, A. Zinc Oxide Nanoparticles (ZnO NPs), Biosynthesis, Characterization and Evaluation of Their Impact to Improve Shoot Growth and to Reduce Salt Toxicity on Salvia officinalis In Vitro Cultivated. Processes 2022, 10, 1273. [Google Scholar] [CrossRef] [Scilit]
- Danish, M.; Altaf, M.; Robab, M.I.; Shahid, M.; Manoharadas, S.; Hussain, S.A.; Shaikh, H. Green synthesized silver nanoparticles mitigate biotic stress induced by Meloidogyne incognita in Trachyspermum ammi (L.) by improving growth, biochemical, and antioxidant enzyme activities. ACS Omega 2021, 6, 11389–11403. [Google Scholar] [CrossRef] [Scilit]
- Kaur, R.; Avti, P.; Kumar, V.; Kumar, R. Effect of various synthesis parameters on the stability of size controlled green synthesis of silver nanoparticles. Nano Express 2021, 2, 020005. [Google Scholar] [CrossRef] [Scilit]
- Ismail, M.; Khan, M.; Khan, S.B.; Khan, M.A.; Akhtar, K.; Asiri, A.M. Green synthesis of plant supported CuAg and CuNi bimetallic nanoparticles in the reduction of nitrophenols and organic dyes for water treatment. J. Mol. Liq. 2018, 260, 78–91. [Google Scholar] [CrossRef] [Scilit]
- Rani, P.U.; Yasur, J.; Loke, K.S.; Dutta, D. Effect of synthetic and biosynthesized silver nanoparticles on growth, physiology and oxidative stress of water hyacinth: Eichhornia crassipes (Mart) Solms. Acta Physiol. Plant. 2016, 38, 58. [Google Scholar] [CrossRef] [Scilit]
- Erdogan, O.; Abbak, M.; Demirbolat, G.M.; Birtekocak, F.; Aksel, M.; Pasa, S.; Cevik, O. Green synthesis of silver nanoparticles via Cynara scolymus leaf extracts: The characterization, anticancer potential with photodynamic therapy in MCF7 cells. PLoS ONE 2019, 14, e0216496. [Google Scholar] [CrossRef] [Scilit]
- Ahlawat, J.; Sehrawat, A.R.; Choudhary, R.; Yadav, S.K. Biologically synthesized silver nanoparticles eclipse fungal and bacterial contamination in micropropagation of Capparis decidua (FORSK.) Edgew: A substitute to toxic substances. Indian J. Exp. Biol. 2020, 58, 336–343. [Google Scholar]
- Arab, M.M.; Yadollahi, A.; Hosseini-Mazinani, M.; Bagheri, S. Effects of antimicrobial activity of silver nanoparticles on in vitro establishment of G × N15 (hybrid of almond × peach) rootstock. J. Genet. Eng. Biotechnol. 2014, 12, 103–110. [Google Scholar] [CrossRef] [Scilit]
- Nilsson, R.H.; Tedersoo, L.; Ryberg, M.; Kristiansson, E.; Hartmann, M.; Unterseher, M.; Porter, T.M.; Bengtsson-Palme, J.; Walker, D.M.; De Sousa, F. A comprehensive, automatically updated fungal ITS sequence dataset for reference-based chimera control in environmental sequencing efforts. Microbes Environ. 2015, 30, 145–150. [Google Scholar] [CrossRef] [Scilit]
- Bukin, Y.S.; Galachyants, Y.P.; Morozov, I.; Bukin, S.; Zakharenko, A.; Zemskaya, T. The effect of 16S rRNA region choice on bacterial community metabarcoding results. Sci. Data 2019, 6, 190007. [Google Scholar] [CrossRef] [Scilit]
- Narayanan, K.B.; Park, H.H. Antifungal activity of silver nanoparticles synthesized using turnip leaf extract (Brassica rapa L.) against wood rotting pathogens. Eur. J. Plant Pathol. 2014, 140, 185–192. [Google Scholar] [CrossRef] [Scilit]
- Burduniuc, O.; Bostanaru, A.-C.; Mares, M.; Biliuta, G.; Coseri, S. Synthesis, Characterization, and Antifungal Activity of Silver Nanoparticles Embedded in Pullulan Matrices. Materials 2021, 14, 7041. [Google Scholar] [CrossRef] [Scilit]
- Akpinar, I.; Unal, M.; Sar, T. Potential antifungal effects of silver nanoparticles (AgNPs) of different sizes against phytopathogenic Fusarium oxysporum f. sp. radicis-lycopersici (FORL) strains. SN Appl. Sci. 2021, 3, 506. [Google Scholar] [CrossRef] [Scilit]
- Darwesh, O.M.; Elshahawy, I.E. Silver nanoparticles inactivate sclerotial formation in controlling white rot disease in onion and garlic caused by the soil borne fungus Stromatinia cepivora. Eur. J. Plant Pathol. 2021, 160, 917–934. [Google Scholar] [CrossRef] [Scilit]
- Dakal, T.C.; Kumar, A.; Majumdar, R.S.; Yadav, V. Mechanistic basis of antimicrobial actions of silver nanoparticles. Front. Microbiol. 2016, 7, 1831. [Google Scholar] [CrossRef] [Scilit]
- Ahmad, S.A.; Das, S.S.; Khatoon, A.; Ansari, M.T.; Afzal, M.; Hasnain, M.S.; Nayak, A.K. Bactericidal activity of silver nanoparticles: A mechanistic review. Mater. Sci. Energy Technol. 2020, 3, 756–769. [Google Scholar] [CrossRef] [Scilit]
- Ocsoy, I.; Gulbakan, B.; Chen, T.; Zhu, G.; Chen, Z.; Sari, M.M.; Peng, L.; Xiong, X.; Fang, X.; Tan, W. DNA-guided metal-nanoparticle formation on graphene oxide surface. Adv. Mater. 2013, 25, 2319–2325. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, D.H.; Gopal, J.; Sivanesan, I. Nanomaterials in plant tissue culture: The disclosed and undisclosed. RSC Adv. 2017, 7, 36492–36505. [Google Scholar] [CrossRef] [Scilit]
- Manickavasagam, M.; Pavan, G.; Vasudevan, V. A comprehensive study of the hormetic influence of biosynthesized AgNPs on regenerating rice calli of indica cv. IR64. Sci. Rep. 2019, 9, 8821. [Google Scholar] [CrossRef] [Scilit]
- Ali, A.; Mohammad, S.; Khan, M.A.; Raja, N.I.; Arif, M.; Kamil, A.; Mashwani, Z.-u.-R. Silver nanoparticles elicited in vitro callus cultures for accumulation of biomass and secondary metabolites in Caralluma tuberculata. Artif. Cells Nanomed. Biotechnol. 2019, 47, 715–724. [Google Scholar] [CrossRef] [Scilit]
- Labeeb, M.; Badr, A.; Haroun, S.A.; Mattar, M.Z.; El-Kholy, A.S. Ultrastructural and molecular implications of ecofriendly made silver nanoparticles treatments in pea (Pisum sativum L.). J. Genet. Eng. Biotechnol. 2022, 20, 5. [Google Scholar] [CrossRef] [Scilit]
- An, H.; Jin, B. Prospects of nanoparticle–DNA binding and its implications in medical biotechnology. Biotechnol. Adv. 2012, 30, 1721–1732. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Galal, O.; Thabet, A. Cytological and molecular effects of silver nanoparticles (AgNPs) on Vicia faba M1 plants. J. Agric. Chem. Biotechnol. 2018, 9, 269–275. [Google Scholar] [CrossRef] [Scilit]
- Tymoszuk, A.; Kulus, D. Silver nanoparticles induce genetic, biochemical, and phenotype variation in chrysanthemum. Plant Cell Tissue Organ Cult. (PCTOC) 2020, 143, 331–344. [Google Scholar] [CrossRef] [Scilit]
- Tymoszuk, A.; Kulus, D. Effect of Silver Nanoparticles on the In Vitro Regeneration, Biochemical, Genetic, and Phenotype Variation in Adventitious Shoots Produced from Leaf Explants in Chrysanthemum. Int. J. Mol. Sci. 2022, 23, 7406. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Murashige, T.; Skoog, F. A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiol. Plant. 1962, 15, 473–497. [Google Scholar] [CrossRef] [Scilit]
- Thomas, P. Isolation of Bacillus pumilus from in vitro grapes as a long-term alcohol-surviving and rhizogenesis inducing covert endophyte. J. Appl. Microbiol. 2004, 97, 114–123. [Google Scholar] [CrossRef] [Scilit]
- Ebadzadsahrai, G.; Higgins Keppler, E.A.; Soby, S.D.; Bean, H.D. Inhibition of fungal growth and induction of a novel volatilome in response to Chromobacterium vaccinii volatile organic compounds. Front. Microbiol. 2020, 11, 1035. [Google Scholar] [CrossRef] [Scilit]
- Li, J.; Ma, Q.; Shao, H.; Zhou, X.; Xia, H.; Xie, J. Biosynthesis, characterization, and antibacterial activity of silver nanoparticles produced from rice straw biomass. BioResources 2017, 12, 4897–4911. [Google Scholar] [CrossRef] [Scilit]







| Primer | Sequence (5′--------- 3′) |
|---|---|
| ITS1-F | TCCGTAGGTGAACCTGCG |
| ITS4-R | TCCTCCGCTTATTGATATGC |
| 27-F | AGAGTTTGATCCTGGCTCAG |
| 1492-R | GGTTACCTTGTTACGACTT |
| OP-A16 | AGCCAGCGAA |
| OP-A46 | GAACGGACTC |
| OP-A49 | CTCACCGTCC |
| OP-A65 | TGAGCGGACA |
| OP-A73 | GGGGTGACGA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Alfarraj, N.S.; Tarroum, M.; Al-Qurainy, F.; Nadeem, M.; Khan, S.; Salih, A.M.; Shaikhaldein, H.O.; Al-Hashimi, A.; Alansi, S.; Perveen, K. Biosynthesis of Silver Nanoparticles and Exploring Their Potential of Reducing the Contamination of the In Vitro Culture Media and Inducing the Callus Growth of Rumex nervosus Explants. Molecules 2023, 28, 3666. https://doi.org/10.3390/molecules28093666
Alfarraj NS, Tarroum M, Al-Qurainy F, Nadeem M, Khan S, Salih AM, Shaikhaldein HO, Al-Hashimi A, Alansi S, Perveen K. Biosynthesis of Silver Nanoparticles and Exploring Their Potential of Reducing the Contamination of the In Vitro Culture Media and Inducing the Callus Growth of Rumex nervosus Explants. Molecules. 2023; 28(9):3666. https://doi.org/10.3390/molecules28093666
Chicago/Turabian StyleAlfarraj, Norah S., Mohamed Tarroum, Fahad Al-Qurainy, Mohammad Nadeem, Salim Khan, Abdalrhaman M. Salih, Hassan O. Shaikhaldein, Abdulrahman Al-Hashimi, Saleh Alansi, and Kahkashan Perveen. 2023. "Biosynthesis of Silver Nanoparticles and Exploring Their Potential of Reducing the Contamination of the In Vitro Culture Media and Inducing the Callus Growth of Rumex nervosus Explants" Molecules 28, no. 9: 3666. https://doi.org/10.3390/molecules28093666
APA StyleAlfarraj, N. S., Tarroum, M., Al-Qurainy, F., Nadeem, M., Khan, S., Salih, A. M., Shaikhaldein, H. O., Al-Hashimi, A., Alansi, S., & Perveen, K. (2023). Biosynthesis of Silver Nanoparticles and Exploring Their Potential of Reducing the Contamination of the In Vitro Culture Media and Inducing the Callus Growth of Rumex nervosus Explants. Molecules, 28(9), 3666. https://doi.org/10.3390/molecules28093666

