Resistomycin Suppresses Prostate Cancer Cell Growth by Instigating Oxidative Stress, Mitochondrial Apoptosis, and Cell Cycle Arrest
Abstract
1. Introduction
2. Results
2.1. Antiproliferative Activity of Resistomycin and Its Half Maximal Inhibitory Concentration (IC50)
2.2. Resistomycin Increased the LDH Release in PC3 Cells
2.3. Resistomycin Suppressed the Antioxidant Response of PC3 Cells
2.4. Resistomycin Altered the Oxidant Status of PC3 Cells
2.5. Resistomycin Induced the Levels of Apoptotic Biomarkers in PC3 Cells
2.6. Resistomycin Promoted the Cell-Cycle-Related Biomarkers in PC3 Cells
3. Discussion
4. Materials and Methods
4.1. Production of Resistomycin
4.2. Cell Lines and Culture
4.3. Cytotoxicity Assay
4.4. LDH Release Assay
4.5. Evaluation of Antioxidant Enzymatic Activities
4.6. Assessment of Oxidative-Stress-Related Markers
4.6.1. Intracellular ROS Measurement
4.6.2. GSH Assessment
4.6.3. Malondialdehyde Analysis
4.6.4. Carbonyl Protein (CP) Assessment
4.6.5. Assessment of Oxidative DNA Damage
4.7. Estimation of Apoptosis-Related Biomarkers
4.8. Apoptosis Analysis through Annexin V/Propidium Iodide Assay
4.9. Analysis of Cell-Cycle-Related Markers
4.10. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Seonu, S.-Y.; Kim, M.-J.; Yin, J.; Lee, M.-W. Alnus sibirica Compounds Exhibiting Anti-Proliferative, Apoptosis-Inducing, and GSTP1 Demethylating Effects on Prostate Cancer Cells. Molecules 2021, 26, 3830. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Siegel, R.L.; Miller, K.D.; Jemal, A. Cancer statistics, 2018. CA Cancer J. Clin. 2018, 68, 7–30. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Majid, M.; Farhan, A.; Baig, M.W.; Khan, M.T.; Kamal, Y.; Hassan, S.S.U.; Bungau, S.; Haq, I.-U. Ameliorative Effect of Structurally Divergent Oleanane Triterpenoid, 3-Epifriedelinol from Ipomoea batatas against BPA-Induced Gonadotoxicity by Targeting PARP and NF-κB Signaling in Rats. Molecules 2023, 28, 290. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rawla, P. Epidemiology of prostate cancer. World J. Oncol. 2019, 10, 63. [Google Scholar] [CrossRef] [Scilit]
- Bostwick, D.G.; Burke, H.B.; Djakiew, D.; Euling, S.; Ho, S.M.; Landolph, J.; Morrison, H.; Sonawane, B.; Shifflett, T.; Waters, D.J. Human prostate cancer risk factors. Cancer Interdiscip. Int. J. Am. Cancer Soc. 2004, 101, 2371–2490. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shah, S.L.; Bashir, K.; Rasheed, H.M.; Rahman, J.U.; Ikram, M.; Shah, A.J.; Majrashi, K.A.; Alnasser, S.M.; Menaa, F.; Khan, T. LC-MS/MS-Based Metabolomic Profiling of Constituents from Glochidion velutinum and Its Activity against Cancer Cell Lines. Molecules 2022, 27, 9012. [Google Scholar] [CrossRef] [Scilit]
- El Gaafary, M.; Morad, S.A.F.; Schmiech, M.; Syrovets, T.; Simmet, T. Arglabin, an EGFR receptor tyrosine kinase inhibitor, suppresses proliferation and induces apoptosis in prostate cancer cells. Biomed. Pharmacother. 2022, 156, 113873. [Google Scholar] [CrossRef] [Scilit]
- Komura, K.; Sweeney, C.J.; Inamoto, T.; Ibuki, N.; Azuma, H.; Kantoff, P.W. Current treatment strategies for advanced prostate cancer. Int. J. Urol. 2018, 25, 220–231. [Google Scholar] [CrossRef] [Scilit]
- Shore, N.D.; Karsh, L.; Gomella, L.G.; Keane, T.E.; Concepcion, R.S.; Crawford, E.D. Avoiding obsolescence in advanced prostate cancer management: A guide for urologists. BJU Int. 2015, 115, 188–197. [Google Scholar] [CrossRef] [Scilit]
- Satari, A.; Amini, S.A.; Raeisi, E.; Lemoigne, Y.; Heidarian, E. Synergetic Impact of Combined 5-Fluorouracil and Rutin on Apoptosis in PC3 Cancer Cells through the Modulation of P53 Gene Expression. Adv. Pharm. Bull. 2019, 9, 462–469. [Google Scholar] [CrossRef] [Scilit]
- Subramani, R.; Aalbersberg, W. Marine actinomycetes: An ongoing source of novel bioactive metabolites. Microbiol. Res. 2012, 167, 571–580. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Selim, M.S.M.; Abdelhamid, S.A.; Mohamed, S.S. Secondary metabolites and biodiversity of actinomycetes. J. Genet. Eng. Biotechnol. 2021, 19, 72. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nazari, M.T.; Machado, B.S.; Marchezi, G.; Crestani, L.; Ferrari, V.; Colla, L.M.; Piccin, J.S. Use of soil actinomycetes for pharmaceutical, food, agricultural, and environmental purposes. 3 Biotech 2022, 12, 232. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Coll, M.; Piroddi, C.; Steenbeek, J.; Kaschner, K.; Ben Rais Lasram, F.; Aguzzi, J.; Ballesteros, E.; Bianchi, C.N.; Corbera, J.; Dailianis, T. The biodiversity of the Mediterranean Sea: Estimates, patterns, and threats. PLoS ONE 2010, 5, e11842. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lin, M.H.; Islam, A.; Liu, Y.-H.; Weng, C.-W.; Zhan, J.-H.; Liang, R.-H.; Tikhomirov, A.S.; Shchekotikhin, A.E.; Chueh, P.J. Antibiotic heliomycin and its water-soluble 4-aminomethylated derivative provoke cell death in T24 bladder cancer cells by targeting sirtuin 1 (SIRT1). Am. J. Cancer Res. 2022, 12, 1042. [Google Scholar] [PubMed]
- Vijayabharathi, R.; Bruheim, P.; Andreassen, T.; Raja, D.S.; Devi, P.B.; Sathyabama, S.; Priyadarisini, V.B. Assessment of resistomycin, as an anticancer compound isolated and characterized from Streptomyces aurantiacus AAA5. J. Microbiol. 2011, 49, 920–926. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nadysev, G.Y.; Tikhomirov, A.S.; Lin, M.-H.; Yang, Y.-T.; Dezhenkova, L.G.; Chen, H.-Y.; Kaluzhny, D.N.; Schols, D.; Shtil, A.A.; Shchekotikhin, A.E. Aminomethylation of heliomycin: Preparation and anticancer characterization of the first series of semi-synthetic derivatives. Eur. J. Med. Chem. 2018, 143, 1553–1562. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Han, Z.; Zhao, X.; Zhang, E.; Ma, J.; Zhang, H.; Li, J.; Xie, W.; Li, X. Resistomycin Induced Apoptosis and Cycle Arrest in Human Hepatocellular Carcinoma Cells by Activating p38 MAPK Pathway In Vitro and In Vivo. Pharmaceuticals 2021, 14, 958. [Google Scholar] [CrossRef] [Scilit]
- Yu, J.; Li, S.; Zeng, X.; Song, J.; Hu, S.; Cheng, S.; Chen, C.; Luo, H.; Pan, W. Design, synthesis, and evaluation of proliferation inhibitory activity of novel L-shaped ortho-quinone analogs as anticancer agents. Bioorganic Chem. 2021, 117, 105383. [Google Scholar] [CrossRef] [Scilit]
- Gorajana, A.; Venkatesan, M.; Vinjamuri, S.; Kurada, B.V.; Peela, S.; Jangam, P.; Poluri, E.; Zeeck, A. Resistoflavine, cytotoxic compound from a marine actinomycete, Streptomyces chibaensis AUBN1/7. Microbiol. Res. 2007, 162, 322–327. [Google Scholar] [CrossRef] [Scilit]
- Aly, A.A.; Hassan, A.A.; Mohamed, N.K.; Ramadan, M.; Abd El-Aal, A.S.; Bräse, S.; Nieger, M. Synthesis of quinone-based heterocycles of broad-spectrum anticancer activity. J. Chem. Res. 2020, 45, 562–571. [Google Scholar] [CrossRef] [Scilit]
- Kim, M.C.; Cullum, R.; Hebishy, A.M.S.; Mohamed, H.A.; Faraag, A.H.I.; Salah, N.M.; Abdelfattah, M.S.; Fenical, W. Mersaquinone, a New Tetracene Derivative from the Marine-Derived Streptomyces sp. EG1 Exhibiting Activity against Methicillin-Resistant Staphylococcus aureus (MRSA). Antibiotics 2020, 9, 252. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, J.; Han, N.; Zhang, H.; Xie, X.; Zhu, Y.; Zhang, E.; Ma, J.; Shang, C.; Yin, M.; Xie, W.; et al. Saquayamycin B(1) Suppresses Proliferation, Invasion, and Migration by Inhibiting PI3K/AKT Signaling Pathway in Human Colorectal Cancer Cells. Mar. Drugs 2022, 20, 570. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lin, H.-Y.; Lin, Y.-S.; Shih, S.-P.; Lee, S.-B.; El-Shazly, M.; Chang, K.-M.; Yang, Y.-C.S.; Lee, Y.-L.; Lu, M.-C. The anti-proliferative activity of secondary metabolite from the marine Streptomyces sp. against prostate cancer cells. Life 2021, 11, 1414. [Google Scholar] [CrossRef] [Scilit]
- Zhang, L.; Feng, L.L.; Wang, G.F.; Yang, Q.L.; Fu, X.Z.; Li, Z.; Liu, M.; Kou, L.J.; Xu, B.; Xie, Z.P.; et al. Strepyrazinone, a tricyclic diketopiperazine derivative with cytotoxicity from a marine-derived actinobacterium. J. Asian Nat. Prod. Res. 2021, 23, 968–974. [Google Scholar] [CrossRef] [Scilit]
- Bae, M.; An, J.S.; Hong, S.H.; Bae, E.S.; Chung, B.; Kwon, Y.; Hong, S.; Oh, K.B.; Shin, J.; Lee, S.K.; et al. Donghaecyclinones A-C: New Cytotoxic Rearranged Angucyclinones from a Volcanic Island-Derived Marine Streptomyces sp. Mar. Drugs 2020, 18, 121. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Qu, X.-Y.; Ren, J.-W.; Peng, A.-H.; Lin, S.-Q.; Lu, D.-D.; Du, Q.-Q.; Liu, L.; Li, X.; Li, E.-W.; Xie, W.-D. Cytotoxic, anti-migration, and anti-invasion activities on breast cancer cells of angucycline glycosides isolated from a marine-derived Streptomyces sp. Mar. Drugs 2019, 17, 277. [Google Scholar] [CrossRef] [Scilit]
- Gomathi, A.; Alagumuthu, M.; Jgs, P.K.; Madhyastha, H.; Jayaraj, R.; Gothandam, K.M. Apoptosis inducing metabolite from marine mangrove actinobacteria VITGAP173. Anti-Cancer Agents Med. Chem. 2022; ahead of print. [CrossRef] [Scilit]
- Ding, W.-J.; Ji, Y.-Y.; Jiang, Y.-J.; Ying, W.-J.; Fang, Z.-Y.; Gao, T.-T. Gephyromycin C, a novel small-molecule inhibitor of heat shock protein Hsp90, induces G2/M cell cycle arrest and apoptosis in PC3 cells in vitro. Biochem. Biophys. Res. Commun. 2020, 531, 377–382. [Google Scholar] [CrossRef] [Scilit]
- Cai, F.; Zhang, Y.; Li, J.; Huang, S.; Gao, R. Isorhamnetin inhibited the proliferation and metastasis of androgen-independent prostate cancer cells by targeting the mitochondrion-dependent intrinsic apoptotic and PI3K/Akt/mTOR pathway. Biosci. Rep. 2020, 40, BSR20192826. [Google Scholar] [CrossRef] [Scilit]
- Li, J.; Xiong, C.; Xu, P.; Luo, Q.; Zhang, R. Puerarin induces apoptosis in prostate cancer cells via inactivation of the Keap1/Nrf2/ARE signaling pathway. Bioengineered 2021, 12, 402–413. [Google Scholar] [CrossRef] [Scilit]
- Grub, S.; Persohn, E.; Trommer, W.E.; Wolf, A. Mechanisms of Cyclosporine A-Induced Apoptosis in Rat Hepatocyte Primary Cultures. Toxicol. Appl. Pharmacol. 2000, 163, 209–220. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fu, J.; Zeng, X.; He, N. Comparative Cytotoxicity induced by Zinc Oxide Nanoparticles in Human Prostate Cells. J. Nanosci. Nanotechnol. 2017, 17, 196–202. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Khalil, M.A.; El-Shanshoury, A.E.R.; Alghamdi, M.A.; Sun, J.; Ali, S.S. Streptomyces catenulae as a Novel Marine Actinobacterium Mediated Silver Nanoparticles: Characterization, Biological Activities, and Proposed Mechanism of Antibacterial Action. Front. Microbiol. 2022, 13, 833154. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, P.; Li, Z. Neuroprotective effect of paeoniflorin on H2O2-induced apoptosis in PC12 cells by modulation of reactive oxygen species and the inflammatory response. Exp. Ther. Med. 2015, 9, 1768–1772. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nizami, Z.N.; Aburawi, H.E.; Semlali, A.; Muhammad, K.; Iratni, R. Oxidative Stress Inducers in Cancer Therapy: Preclinical and Clinical Evidence. Antioxidants 2023, 12, 1159. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Othman, M.S.; Aboelnaga, S.M.; Habotta, O.A.; Moneim, A.E.A.; Hussein, M.M. The Potential Therapeutic Role of Green-Synthesized Selenium Nanoparticles Using Carvacrol in Human Breast Cancer MCF-7 Cells. Appl. Sci. 2023, 13, 7039. [Google Scholar] [CrossRef] [Scilit]
- Kim, U.; Kim, C.Y.; Lee, J.M.; Ryu, B.; Kim, J.; Shin, C.; Park, J.H. Pimozide Inhibits the Human Prostate Cancer Cells Through the Generation of Reactive Oxygen Species. Front. Pharmacol. 2019, 10, 1517. [Google Scholar] [CrossRef] [Scilit]
- Miyazato, H.; Taira, J.; Ueda, K. Hydrogen peroxide derived from marine peroxy sesquiterpenoids induces apoptosis in HCT116 human colon cancer cells. Bioorg. Med. Chem. Lett. 2016, 26, 4641–4644. [Google Scholar] [CrossRef] [Scilit]
- Greilberger, J.; Erlbacher, K.; Stiegler, P.; Wintersteiger, R.; Herwig, R. Different RONS Generation in MTC-SK and NSCL Cells Lead to Varying Antitumoral Effects of Alpha-Ketoglutarate + 5-HMF. Curr. Issues Mol. Biol. 2023, 45, 6503–6525. [Google Scholar] [CrossRef] [Scilit]
- Karimian, A.; Majidinia, M.; Moliani, A.; Alemi, F.; Asemi, Z.; Yousefi, B.; Fazlollahpour Naghibi, A. The modulatory effects of two bioflavonoids, quercetin and thymoquinone on the expression levels of DNA damage and repair genes in human breast, lung and prostate cancer cell lines. Pathol. Res. Pract. 2022, 240, 154143. [Google Scholar] [CrossRef] [Scilit]
- Chang, W.-H.; Lee, C.-C.; Yen, Y.-H.; Chen, H.-L. Oxidative damage in patients with benign prostatic hyperplasia and prostate cancer co-exposed to phthalates and to trace elements. Environ. Int. 2018, 121, 1179–1184. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yu, J.; Yang, Y.; Li, S.; Meng, P. Salinomycin triggers prostate cancer cell apoptosis by inducing oxidative and endoplasmic reticulum stress via suppressing Nrf2 signaling. Exp. Ther. Med. 2021, 22, 946. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ramalingam, V.; Rajaram, R.; Archunan, G.; Padmanabhan, P.; Gulyás, B. Structural Characterization, Antimicrobial, Antibiofilm, Antioxidant, Anticancer and Acute Toxicity Properties of N-(2-hydroxyphenyl)-2-phenazinamine From Nocardiopsis exhalans (KP149558). Front. Cell. Infect. Microbiol. 2022, 12, 794338. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pereyra, C.E.; Dantas, R.F.; Ferreira, S.B.; Gomes, L.P.; Silva-Jr, F.P. The diverse mechanisms and anticancer potential of naphthoquinones. Cancer Cell Int. 2019, 19, 207. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- de Abreu, F.C.; De Ferraz, P.A.L.; Goulart, M.O.F. Some applications of electrochemistry in biomedical chemistry. Emphasis on the correlation of electrochemical and bioactive properties. J. Braz. Chem. Soc. 2002, 13, 19–35. [Google Scholar] [CrossRef] [Scilit]
- Lee, H.; Oh, E.T.; Choi, B.H.; Park, M.T.; Lee, J.K.; Lee, J.S.; Park, H.J. NQO1-induced activation of AMPK contributes to cancer cell death by oxygen-glucose deprivation. Sci. Rep. 2015, 5, 7769. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Elganzoury, S.S.; Abdelfattah, M.S.; Habotta, O.A.; El-Khadragy, M.; Abdel Moneim, A.E.; Abdalla, M.S. Neuro-amelioration of Ficus lyrata (fiddle-leaf fig) extract conjugated with selenium nanoparticles against aluminium toxicity in rat brain: Relevance to neurotransmitters, oxidative, inflammatory, and apoptotic events. Environ. Sci. Pollut. Res. Int. 2023, 30, 65822–65834. [Google Scholar] [CrossRef] [Scilit]
- Cao, H.; Feng, Y.; Chen, L.; Yu, C. Lobaplatin Inhibits Prostate Cancer Proliferation and Migration through Regulation of BCL2 and BAX. Dose-Response Publ. Int. Hormesis Soc. 2019, 17, 1559325819850981. [Google Scholar] [CrossRef] [Scilit]
- Li, Y.; Pan, J.; Gou, M. The anti-proliferation, cycle arrest and apoptotic inducing activity of peperomin E on prostate cancer PC-3 cell line. Molecules 2019, 24, 1472. [Google Scholar] [CrossRef] [Scilit]
- Permatasari, H.K.; Wewengkang, D.S.; Tertiana, N.I.; Muslim, F.Z.; Yusuf, M.; Baliulina, S.O.; Daud, V.P.A.; Setiawan, A.A.; Nurkolis, F. Anti-cancer properties of Caulerpa racemosa by altering expression of Bcl-2, BAX, cleaved caspase 3 and apoptosis in HeLa cancer cell culture. Front. Oncol. 2022, 12, 964816. [Google Scholar] [CrossRef] [Scilit]
- Lin, S.Q.; Jia, F.J.; Zhang, C.Y.; Liu, F.Y.; Ma, J.H.; Han, Z.; Xie, W.D.; Li, X. Actinomycin V Suppresses Human Non-Small-Cell Lung Carcinoma A549 Cells by Inducing G2/M Phase Arrest and Apoptosis via the p53-Dependent Pathway. Mar. Drugs 2019, 17, 572. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Park, C.; Shin, H.J.; Kim, G.Y.; Kwon, T.K.; Nam, T.J.; Kim, S.K.; Cheong, J.; Choi, I.W.; Choi, Y.H. Induction of apoptosis by streptochlorin isolated from Streptomyces sp. in human leukemic U937 cells. Toxicol. In Vitro 2008, 22, 1573–1581. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jang, S.Y.; Hong, D.; Jeong, S.Y.; Kim, J.H. Shikonin causes apoptosis by up-regulating p73 and down-regulating ICBP90 in human cancer cells. Biochem. Biophys. Res. Commun. 2015, 465, 71–76. [Google Scholar] [CrossRef] [Scilit]
- Wu, Z.; Wu, L.; Li, L.; Tashiro, S.; Onodera, S.; Ikejima, T. p53-mediated cell cycle arrest and apoptosis induced by shikonin via a caspase-9-dependent mechanism in human malignant melanoma A375-S2 cells. J. Pharmacol. Sci. 2004, 94, 166–176. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Khaw, A.K.; Sameni, S.; Venkatesan, S.; Kalthur, G.; Hande, M.P. Plumbagin alters telomere dynamics, induces DNA damage and cell death in human brain tumour cells. Mutat. Res. Genet. Toxicol. Env. Mutagen. 2015, 793, 86–95. [Google Scholar] [CrossRef] [Scilit]
- Hwang, G.H.; Ryu, J.M.; Jeon, Y.J.; Choi, J.; Han, H.J.; Lee, Y.M.; Lee, S.; Bae, J.S.; Jung, J.W.; Chang, W.; et al. The role of thioredoxin reductase and glutathione reductase in plumbagin-induced, reactive oxygen species-mediated apoptosis in cancer cell lines. Eur. J. Pharmacol. 2015, 765, 384–393. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Choudhari, J.; Nimma, R.; Nimal, S.K.; Totakura Venkata, S.K.; Kundu, G.C.; Gacche, R.N. Prosopis juliflora (Sw.) DC phytochemicals induce apoptosis and inhibit cell proliferation signaling pathways, EMT, migration, invasion, angiogenesis and stem cell markers in melanoma cell lines. J. Ethnopharmacol. 2023, 312, 116472. [Google Scholar] [CrossRef] [Scilit]
- Cho, J.J.; Chae, J.I.; Kim, K.H.; Cho, J.H.; Jeon, Y.J.; Oh, H.N.; Yoon, G.; Yoon, D.Y.; Cho, Y.S.; Cho, S.S.; et al. Manumycin A from a new Streptomyces strain induces endoplasmic reticulum stress-mediated cell death through specificity protein 1 signaling in human oral squamous cell carcinoma. Int. J. Oncol. 2015, 47, 1954–1962. [Google Scholar] [CrossRef] [Scilit]
- Shah, A.M.; Wani, A.; Qazi, P.H.; Rehman, S.U.; Mushtaq, S.; Ali, S.A.; Hussain, A.; Shah, A.; Qazi, A.K.; Makhdoomi, U.S.; et al. Isolation and characterization of alborixin from Streptomyces scabrisporus: A potent cytotoxic agent against human colon (HCT-116) cancer cells. Chem. Biol. Interact. 2016, 256, 198–208. [Google Scholar] [CrossRef] [Scilit]
- Wang, C.-D.; Huang, J.-G.; Gao, X.; Li, Y.; Zhou, S.-Y.; Yan, X.; Zou, A.; Chang, J.-L.; Wang, Y.-S.; Yang, G.-X. Fangchinoline induced G1/S arrest by modulating expression of p27, PCNA, and cyclin D in human prostate carcinoma cancer PC3 cells and tumor xenograft. Biosci. Biotechnol. Biochem. 2010, 74, 488–493. [Google Scholar] [CrossRef] [Scilit]
- Zhu, M.; Zheng, Z.; Huang, J.; Ma, X.; Huang, C.; Wu, R.; Li, X.; Liang, Z.; Deng, F.; Wu, J. Modulation of miR-34a in curcumin-induced antiproliferation of prostate cancer cells. J. Cell. Biochem. 2019, 120, 15616–15624. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ye, L.; Yao, X.D.; Wan, F.N.; Qu, Y.Y.; Liu, Z.Y.; Shen, X.X.; Li, S.; Liu, X.J.; Yue, F.; Wang, N. MS4A8B promotes cell proliferation in prostate cancer. Prostate 2014, 74, 911–922. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Qiao, X.; Gan, M.; Wang, C.; Liu, B.; Shang, Y.; Li, Y.; Chen, S. Tetracenomycin X Exerts Antitumour Activity in Lung Cancer Cells through the Downregulation of Cyclin D1. Mar. Drugs 2019, 17, 63. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kouroshnia, A.; Zeinali, S.; Irani, S.; Sadeghi, A. Induction of apoptosis and cell cycle arrest in colorectal cancer cells by novel anticancer metabolites of Streptomyces sp. 801. Cancer Cell Int. 2022, 22, 235. [Google Scholar] [CrossRef] [Scilit]
- Tolosa, L.; Donato, M.T.; Gomez-Lechon, M.J. General Cytotoxicity Assessment by Means of the MTT Assay. Methods Mol. Biol. 2015, 1250, 333–348. [Google Scholar] [CrossRef] [Scilit]
- Misra, H.P.; Fridovich, I. The role of superoxide anion in the autoxidation of epinephrine and a simple assay for superoxide dismutase. J. Biol. Chem. 1972, 247, 3170–3175. [Google Scholar] [CrossRef] [Scilit]
- Aebi, H. Catalase in vitro. Methods Enzymol. 1984, 105, 121–126. [Google Scholar]
- Paglia, D.E.; Valentine, W.N. Studies on the quantitative and qualitative characterization of erythrocyte glutathione peroxidase. J. Lab. Clin. Med. 1967, 70, 158–169. [Google Scholar]
- Wang, X.; Roper, M.G. Measurement of DCF fluorescence as a measure of reactive oxygen species in murine islets of Langerhans. Anal. Methods 2014, 6, 3019–3024. [Google Scholar] [CrossRef] [Scilit]
- Ellman, G.L. Tissue sulfhydryl groups. Arch. Biochem. Biophys. 1959, 82, 70–77. [Google Scholar] [CrossRef] [Scilit]
- Ohkawa, H.; Ohishi, N.; Yagi, K. Assay for lipid peroxides in animal tissues by thiobarbituric acid reaction. Anal. Biochem. 1979, 95, 351–358. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Levine, R.L.; Garland, D.; Oliver, C.N.; Amici, A.; Climent, I.; Lenz, A.G.; Ahn, B.W.; Shaltiel, S.; Stadtman, E.R. Determination of carbonyl content in oxidatively modified proteins. Methods Enzym. 1990, 186, 464–478. [Google Scholar]









| Gene | Accession Number | Forward (5′-3′) | Reverse (5′-3′) |
|---|---|---|---|
| Cyclin D1 | NM_053056.3 | GAGGCGGAGGAGAACAAACA | GGAGGGCGGATTGGAAATGA |
| β-actin | NM_001101.5 | AGCCTCGCCTTTGCCG | CGCGGCGATATCATCATCCA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Aloufi, A.S.; Habotta, O.A.; Abdelfattah, M.S.; Habib, M.N.; Omran, M.M.; Ali, S.A.; Abdel Moneim, A.E.; Korany, S.M.; Alrajhi, A.M. Resistomycin Suppresses Prostate Cancer Cell Growth by Instigating Oxidative Stress, Mitochondrial Apoptosis, and Cell Cycle Arrest. Molecules 2023, 28, 7871. https://doi.org/10.3390/molecules28237871
Aloufi AS, Habotta OA, Abdelfattah MS, Habib MN, Omran MM, Ali SA, Abdel Moneim AE, Korany SM, Alrajhi AM. Resistomycin Suppresses Prostate Cancer Cell Growth by Instigating Oxidative Stress, Mitochondrial Apoptosis, and Cell Cycle Arrest. Molecules. 2023; 28(23):7871. https://doi.org/10.3390/molecules28237871
Chicago/Turabian StyleAloufi, Abeer S., Ola A. Habotta, Mohamed S. Abdelfattah, Marina N. Habib, Mohamed M. Omran, Sally A. Ali, Ahmed E. Abdel Moneim, Shereen M. Korany, and Aisha M. Alrajhi. 2023. "Resistomycin Suppresses Prostate Cancer Cell Growth by Instigating Oxidative Stress, Mitochondrial Apoptosis, and Cell Cycle Arrest" Molecules 28, no. 23: 7871. https://doi.org/10.3390/molecules28237871
APA StyleAloufi, A. S., Habotta, O. A., Abdelfattah, M. S., Habib, M. N., Omran, M. M., Ali, S. A., Abdel Moneim, A. E., Korany, S. M., & Alrajhi, A. M. (2023). Resistomycin Suppresses Prostate Cancer Cell Growth by Instigating Oxidative Stress, Mitochondrial Apoptosis, and Cell Cycle Arrest. Molecules, 28(23), 7871. https://doi.org/10.3390/molecules28237871

