Abstract
Branched-chain fatty acids (BCFAs) are natural components with a variety of biological activities. However, the regulation of lipid metabolism by BCFAs is unknown. It was dedicated to examining the impacts of BCFAs inferred from yak ghee on the expression of qualities related to lipid metabolism, natural pathways, and intestinal microbiota in mice. The treatment group (purified BCFAs from yak ghee) exhibited a decrease in cholesterol levels; a decrease in HMGCR levels; downregulation of FADS1, FADS2, ACC-α, FAS, GAPT4, GPAM, ACSL1, THRSP, A-FABP, and PPARα gene expression; and upregulation of SCD1, ACSS1, FABP1, CPT1, and DGAT-1 gene expression. Gut microbiota 16S rDNA sequencing analysis showed that the treatment group improved the gut microbiota by increasing the relative abundances and increasing the short-chain fatty acid levels produced by the genera Akkermansia, Clostridium, Lachnospiraceae, Lactobacillus, Anaerotaenia, and Prevotella. After adding BCFAs to cultured breast cancer cells, pathways that were downregulated were found to be related to fatty acid degradation and fatty acid metabolism, while 20 other pathways were upregulated. Our results suggest that BCFAs reduce body fat in mice by modulating intestinal flora and lipid metabolism and modulating fatty acid metabolism in breast cancer cells.
1. Introduction
Yak (Bos grunniens) ghee is a dairy product from traditional yak milk and is usually made by hand with special bulk. Yak ghee is mainly consumed in the diet in milk tea and in zanba made from Qingke wheat in Tibet and Qinghai. Yak ghee is high in calories and rich in functional fatty acids, which is of great importance to herders living in the cold regions of the plateau where vegetables are scarce. Sun et al. [1] determined the composition of yak milk fat by gas chromatography, where most of it was saturated fatty acids (60.56%), and the monounsaturated fatty acid content was 35.05%, of which the contents of polyunsaturated fatty acids and BCFAs [2] were higher than those of ordinary milk. Zheng et al. found that the body weight and abdominal fat of mice with yak ghee added to the diet increased significantly, the level of triglyceride (TG) and total cholesterol (TC) in the blood increased significantly, and the mechanism was perhaps connected to the composition of fatty acids [3]. Jian found that the intake of hydrogenated soybean oil and yak ghee can significantly increase the contents of TC and TG in the liver of mice and speculated that the increase in fat anabolism in the yak ghee group may be related to the high content of saturated fatty acids in mice [4]. BCFAs are a class of fatty acids with one or more branches (mainly methyl groups) on the carbon chain, which are mainly saturated fatty acids. Current studies on BCFAs have focused on the content, identification, and biological activity of different raw materials. The BCFA content varies among samples. Xue et al. studied BCFAs and odd-chain fatty acids (OCFAs) in mammalian milk, dairy products, and vegetable oils and identified and quantified 72 fatty acids, including 16 BCFAs and 10 OCFAs, using GC/TOF-MS [5]. Ma determined the content of BCFAs in milk samples from dairy cows, buffaloes, yaks, Juanshan cattle, goats, camels, and horses by GC–MS [2]. The results showed that the total content of BCFAs in yak milk was the highest. The BCFAs in yak ghee are mainly derived from the de novo fatty acids synthesized by rumen microorganisms. Isobutyric acid, isovaleric acid, and 2-methylbutyric acid are used by rumen microorganisms to synthesize BCFAs [6]. When rumen microbes die and enter the small intestine, these fatty acids are digested, absorbed by the host, and deposited in meat and milk. Fewer BCFAs are de novo synthesized naturally from the diet or in the ruminant’s own tissues [7].
BCFAs have various biological activities, such as anti-inflammatory [8] and anticancer [9] activities. Current research indicates that the function of BCFAs is primarily anticancer. According to Yang et al. [10], iso-15:0 obtained from aged soybeans can halt the development of a number of cancer cells both in vitro and in vivo. BCFAs inhibit the synthesis of fatty acids in breast cancer cells and disrupt the integrity of SKBR-3 mitochondria in breast cancer cells, thereby inducing apoptosis [11]. Yu et al. [12] found that BCFAs can indirectly reduce edema and inflammation, and their mechanism of action is to inhibit the function of platelets and white blood cells. BCFAs have been reported to be beneficial for intestinal health in humans and monogastric animals [13,14]. According to relevant studies, BCFAs have also been shown to prevent and treatment necrotizing enterocolitis (NEC). Ran-Ressler found that BCFAs relieve NEC incidence and alter the microbiota composition [13]. Li found that the BCFAs iso-15:0 and iso-18:0 have significant lipid-lowering effects in vitro, and BCFAs can alleviate the increase in triglyceride content caused by free fatty acids [15]. Zhou et al. found that toxic substances in excessive frying oil can disrupt the body’s fatty acid anabolism by affecting the normal synthesis and metabolism of fatty acids [16]. Body weight and abdominal lipid content were significantly increased in mice fed yak ghee, while iso-15:0 and iso-18:0 significantly reduced triglyceride levels in mice in vitro. There are no studies on the effects of yak ghee BCFAs on lipid anabolism and catabolism in the body, and their regulatory mechanisms on lipid metabolism-related genes in vivo need to be studied in depth.
There are two types of fat metabolism genes related to anabolism and catabolism, which together determine the deposition of fat in animals. (1) Genes related to fatty acid synthesis are mainly fatty acid synthase (FAS), fatty acid desaturase 1 (FADS1), fatty acid desaturase 2 (FADS2), acetyl-CoA carboxylase α (ACC-α), stearyl desaturase 1 (SCD1), and acetyl-CoA synthetase 1 (ACS1). FAS plays a central role in lipid biosynthesis, catalyzing the amalgamation of fatty acids from acetyl-CoA, malonyl-CoA, and nicotinamide adenine dinucleotide phosphate (NADPH) [17]. Its overexpression can lead to the deposition of body fat, which can cause obesity [18]. FADS1 and FADS2 are imperative metabolic rate-limiting proteins within the amalgamation of polyunsaturated fatty acids [19]. ACC-α is the first rate-limiting enzyme in the fatty acid biosynthesis pathway and plays a key role in the biosynthesis of fatty acids [20]. SCD1 is a rate-limiting enzyme that catalyzes the desaturation of saturated fatty acyl groups and the formation of double bonds at the Δ9 position of fatty acids to produce monounsaturated fatty acids [21]. ACS1 is a mitochondrial protein included in the blend of acetyl-CoA amid the tricarboxylic corrosive cycle. Acetyl-CoA may be a precursor of fatty acid and cholesterol synthesis [22]. (2) The genes involved in the synthesis of triacylglycerol are mainly long-chain fatty acyl-CoA synthetase 1 (ACSL1), glycerol-3-phosphate acyltransferase 4 (GPAT4), diacylglycerol acyltransferase 1 (DGAT1), recombinant glycerol-3-phosphate acyltransferase, mitochondrial (GPAM), and thyroid hormone response protein (THRSP). Related reports have indicated that ACSL1 is an enzyme needed for the activation of fatty acid acyl-CoA by fatty acid activation [23]. Both the GPAM and GPAT4 genes are part of the GPAT family, and they catalyze the reaction of glycerol-3-phosphate and fatty acyl-CoA. GPATs are key enzymes in the first step of triglyceride synthesis. GPAM is localized to mitochondria, and GPAT4 is localized to the endoplasmic reticulum. GPATs and DGAT are key enzymes in the phosphoglycerol pathway, which is the major pathway for the synthesis of triglycerides in most cells [24]. THRSP could be a transcriptional controller included in thyroid hormone and carbohydrate-induced adipogenesis by directing the expression of rate-limiting proteins in lipid unions [25]. (3) The gene involved in cholesterol synthesis is mainly recombinant 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGCR). HMGCR is a rate-limiting enzyme for cholesterol synthesis that regulates the synthesis of cholesterol. (4) Genes related to lipid catabolism mainly include adipocyte-type fatty acid binding protein (AFABP) and carnitine palmitoyltransferase 1 (CPT1), of which CPT1 is the rate-limiting enzyme for fatty acid β-oxidation [26]. AFABP is mainly expressed in adipocytes and macrophages. It takes part in the digestion system of immersed and unsaturated long-chain fatty acids and regulates the oxidation of fatty acids and the metabolism of phospholipids and triglycerides [27]. Peroxisome proliferator-activated receptor alpha (PPARα) could be a nuclear receptor protein that is primarily involved in translation. PPARα plays an important role in the metabolism of sugars, lipids, and proteins [28]. Its main function is to control the intake and activation of fatty acids [29]. Hepatic fatty acid-binding protein 1 (FABP1) is the only fatty acid-binding protein expressed in the liver and is closely related to lipid absorption in the small intestine, lipid transport in the liver, and lipoprotein metabolism. Studies have shown that FABP1 is mainly regulated by PPARα. Regarding its regulation, PPAR stimulates fatty acid catabolism by inducing mitochondrial and peroxisome oxidation levels and FABP1 gene expression [30]. FABP1 also affects triglyceride synthesis and fat oxidation in the liver [31]. Studies have shown that the expression of FABP1 greatly enhances the oxidation of BCFAs, which is stronger than absorption or esterification [32].
Currently, most of the research on yak ghee focuses on its composition and overall function, but there is little research on the specific functions of certain components in yak ghee. Yak ghee contains a variety of functional dietary fatty acids (BCFAs). Alterations in fatty acid metabolism can affect the distribution and function of membrane proteins and the level of gene expression, and the structure of fatty acids in the cellular environment can affect the fluidity of cell membranes and can alter cellular integrity and the function of cell membranes. In a previous study, the group found that BCFAs could inhibit the proliferation of obesity-related breast cancer cells but did not explore the expression of related lipid metabolism genes. In the present study, the effects of BCFAs in yak ghee on lipid metabolism were initially investigated through in vivo mouse experiments and in vitro cellular experiments to lay a theoretical foundation for subsequent experiments on obesity inhibition in mice.
The purpose of this study was, first, to add 3% BCFAs (total purity of BCFAs: 16.3%) and 10% yak ghee (total purity of BCFAs: 3.3%) to the diets of mice and to conduct a comparative study of hepatic lipid metabolism in mice with the two dietary interventions. Second, free fatty acids from yak ghee were used as a blank control group (total purity of BCFAs: 3.3%), BCFAs (total purity of BCFAs: 16.3%) were used as an experimental group, which were added into human breast cancer SK-BR-3 cells, and the expression of genes related to the lipid metabolism of breast cancer cells by BCFAs in yak ghee was analyzed by transcriptomics, which further validated the mouse liver lipid metabolism profile.
2. Results
2.1. Effect of Purified BCFAs from Yak Ghee on Body Weight and Food Intake
After feeding for four weeks, the body weight difference among the groups was not significant (p > 0.05), as shown in Table 1. As shown in Table 1, the total food intake of mice in the treatment group was reduced compared with the control and ghee groups, and the food utilization rate of mice in the ghee group and the treatment group was higher than that of the control group (p > 0.05), which indicated that the BCFAs were capable of suppressing the appetite of mice.
Table 1.
Body weight, food intake and food utilization of mice ().
2.2. Effect of Purified BCFAs from Yak Ghee on Serum Biochemical Indices in Mice
Blood was taken from the eyeballs of mice after dissection, and the supernatant was obtained by centrifugation to determine total cholesterol (TC), triglyceride (TG), LDL cholesterol (LDL-C), and HDL cholesterol (HDL-C) levels using a kit, as shown in Table 2.
Table 2.
Total cholesterol, triglyceride, LDL-cholesterol and HDL-cholesterol levels of mice ().
As shown in Table 2, the TC, TG, and LDL-C levels in the treatment group were lower than those in the control group, and the difference was statistically significant (p < 0.01), while HDL-C was significantly higher than that in the control group (p < 0.01). The difference between TC, TG, and LDL-C in the ghee group was higher than that in the control group, and the difference was statistically significant (p < 0.01), while HDL-C was lower than that in the control group (p < 0.01). The differences in TC, TG, LDL-C, and HDL-C between the treatment and ghee groups were statistically significant (p < 0.01). The results indicated that BCFAs from yak ghee could reduce TC, TG, and LDL-C, increase HDL-C, and improve lipid levels in C57BL/6 mice.
2.3. Profile of Gene Expression of Fatty Acid Synthesis-Related Genes
The FAS, FADS1, FADS2, and ACC-α genes were downregulated, except for the SCD1 and ACSS1 genes, which were upregulated in the ghee and treatment groups.
As shown in Figure 1A, this result indicated that the expression of the FAS, ACC-α, FADS1, and FADS2 genes was inhibited in the treatment group, suggesting that purifying BCFAs from yak ghee could inhibit the synthesis of fatty acids and polyunsaturated fatty acids.
Figure 1.
Effect of yak ghee BCFAs on gene expression in the liver of mice. Expression of genes related to fatty acid synthesis (A). Expression of triacylglycerol synthesis-related genes (B). Expression of the cholesterol synthesis-related gene HMGCR (C). Expression of genes related to lipid metabolism (D). Note: FAS, fatty acid synthase; FADS1, fatty acid desaturase 1; FADS2, fatty acid desaturase 2; ACC-α, acetyl-CoA carboxylase α; SCD1, stearyl desaturase 1; ACSS1, aacetyl-CoA synthetase 1; NADPH, nicotinamide adenine dinucleotide phosphate; ACSL1, acyl-CoA synthetase 1; GPAT4, glycerol-3-phosphate acyltransferase 4; DGAT1, diacylglycerol acyltransferase 1; GPAM, recombinant Glycerol-3-Phosphate Acyltransferase, Mitochondrial; THRSP, thyroid hormone response protein; HMGCR, recombinant 3-Hydroxy-3-Methylglutaryl Coenzyme A Reductase; A-FABP, adipocyte-type fatty acid binding protein; CPT1, carnitine palmitoyltransferase 1; PPARα, Peroxisome proliferator-activated receptor alpha; FABP1, fatty acid-binding protein 1. Lowercase letters indicate significance at the 0.05 level, and uppercase letters indicate significance at the 0.01 level. Different letters indicate significant or highly significant differences between groups.
The relative expression level of the ACSS1 gene in each group was not significantly different but was mildly increased in the ghee and treatment groups (p > 0.05).
The ACSS1 gene is involved in the synthesis of acetyl-CoA in the Krebs cycle [22]. The results indicate that the synthesis of acetyl-CoA can provide the substrate for the synthesis of monounsaturated fatty acids, with a significant upregulation of SCD gene expression.
2.4. Gene Expression of Genes Involved in Triacylglycerol Synthesis
In Figure 1B, the fluorescence quantification of genes showed that the expression levels of GPAT4, GPAM, and THRSP genes in the BCFAs group were much lower than those in the ghee and control groups (p < 0.01). The expression level of the ACSL1 gene was lower than that of the control group and higher than that of the ghee group. The expression level of the DGAT-1 gene was higher than that of the control and ghee groups in both groups.
Both the GPAM and the GPAT4 genes are GPATs, and they are key enzymes in the first step of triglyceride synthesis. GPAM is localized to mitochondria, and GPAT4 is localized to the endoplasmic reticulum [24]. GPATs and DGAT are key enzymes in the glycerol phosphate pathway, indicating that the blood lipid content was reduced by inhibiting the first step of the synthesis of triglycerides by the glycerol phosphate pathway with supplementation with purified BCFAs from yak ghee in the diet of mice.
ACSL1 is related to the activation of the long-chain fatty acid acyl-CoA [23]. The relative expression of ACSL1 in the ghee group was lower than that of the other two groups, indicating that purified BCFAs from yak ghee can be used in the mouse diet to inhibit the production of long-chain fatty acyl-CoA in the body.
The THRSP gene is involved in thyroid hormone and carbohydrate-induced lipogenesis [25]. Studies have shown that the expression level of FAS increases with increasing THRSP expression [33]. The relative expression of the gene in the treatment group was lower than that in the other two groups, indicating that the hypolipidemic effect of the treatment group was related to the downregulation of THRSP. This result suggested that the hypolipidemic effect of purified BCFAs may occur by reducing the synthesis of fat induced by carbohydrates and thyroid hormones.
2.5. Expression of the Cholesterol Synthesis Gene HMGCR
In Figure 1C, the difference in the expression of the HMGCR gene between the control group and the treatment group was extremely significant (p < 0.01).
HMGCR is the rate-limiting enzyme in cholesterol biosynthesis. From the results, the expression of this gene in the treatment group was lower than that in the control group, indicating that the decrease in serum cholesterol levels in the treatment group was related to the downregulation of HMGCR gene expression.
2.6. Gene Expression of Lipid Metabolism-Related Genes
As shown in Figure 1D, according to the relative expression of the A-FABP, CPT1, FABP1, and PPARα genes, the A-FABP and PPARα genes were significantly down-regulated in the BCFAs group compared with the control group (p < 0.01), while the CPT1 and FABP1 genes were up-regulated (p < 0.01).
The A-FABP gene was mainly expressed in adipocytes. From the results, we speculated that the adipocytes in the liver of the treatment group had relatively low lipid synthesis. In Li’s study, nonalcoholic fatty liver was associated with fat accumulation in the liver, while BCFAs played a role in alleviating triglyceride accumulation [15]. It was confirmed that BCFAs alleviate triglyceride accumulation.
The difference in the expression of the CPT1 gene between the control group and the treatment group was extremely significant (p < 0.01). The CPT1 gene is the rate-limiting enzyme in the β-oxidation of fatty acids [26]. The expression of the gene in the treatment group was significantly higher than that in the remaining two groups, indicating that supplementation of the diet of mice with BCFAs purified from yak ghee can increase the β-oxidation of fatty acids, thereby lowering blood lipids.
FABP1 is involved in lipid transport in the liver, and the gene expression of FABP1 greatly enhances the oxidation of the pathway and fatty acid esterification and is mainly regulated by PPARα promoter transcription initiation [31]. From the results, the expression of the FABP1 gene in the treatment group and the ghee group was significantly higher than that in the control group, indicating that purified BCFAs in the diet of mice can improve lipid transport and metabolism in the liver, which, due to the increase in BCFA content, can enhance the expression of FABP1.
PPARα may be related to transcription factors that regulate mitochondrial biogenesis and energy metabolism. The upregulation of PPARα in the midst of lactation concurs with the point-by-point increases in the numbers and turnover rate of mitochondria in lactating mammary tissue [34]; that is, downregulation of PPARα gene expression may reduce lipid synthesis. From the results, the downregulation of PPARα may result in a decrease in lipid synthesis in the treatment group fed purified BCFAs in the diet. In short, the network of the effect of purified BCFAs from yak ghee on the fatty acid metabolism pathway of mice is shown in Figure 2.
Figure 2.
Schematic diagram of the effect of purified BCFAs from yak ghee on the fatty acid metabolism pathways in mice.
2.7. Analysis of the Diversity of Gut Microbiota in Each Group of Mice
Alpha diversity is commonly used to measure species richness in community ecology and is a comprehensive indicator of species richness and uniformity. Differences in the diversity of the mouse gut flora were analyzed by the Chao1, observed species, Shannon, and Simpson indices. The results showed that the differences in the Chao1 and Shannon indices between the control group and the treatment group were also significant (p < 0.05), as shown in Table 3. The Chao1 index and Shannon index were lower in the ghee and treatment groups than in the control group, suggesting a decrease in the number of species in the intestinal flora and lower community diversity in mice after ghee and BCFA interventions.
Table 3.
Alpha Diversity Index Analysis ().
Beta diversity mainly utilizes the species composition and abundance information of each sample to reflect the relationship between the samples. Principal coordinate analysis (PCoA) and principal component analysis (PCA) were used to characterize the differences in the structure of the intestinal flora among the three groups of mice. The PCoA and PCA of the gut flora of mice were analyzed. In Figure 3A,B, the distribution of the control group was significantly different from that of the ghee group and the treatment group (p < 0.05).
Figure 3.
Beta-diversity analysis of mouse intestinal flora structure. PCoA analysis of mouse gut flora structure (A). PCA of mouse gut flora structure (B).
2.8. Analysis of the Species Composition of the Intestinal Flora of Mice
2.8.1. Relative Abundance of Major Phyla of the Intestinal Flora
At the phylum level, the intestinal flora consisted of Bacteroidetes, Firmicutes, Proteobacteria, Actinobacteria, Candidatus_Saccharibacteria, Verrucomicrobia, etc., as shown in Figure 4A,B. As shown in Table 4, in the control group, Bacteroidetes and Firmicutes were the major dominant phyla, with relative abundances of 87.601% and 11.052%, respectively. The relative abundance of the Ascomycetes phylum in the ghee and treatment groups was lower than that of the control group, and the difference was significant. Verrucomicrobia in the treatment group showed significant proliferation compared with the control and ghee groups. As shown in the clustered heatmaps in Figure 4C–F, the relative abundance of Bacteroidetes increased and the relative abundance of Firmicutes decreased in the ghee and treatment groups compared with the control group. F/B can reflect the extent to which the flora helps in the absorption of heat in the body. A decreased F/B ratio in the ghee and treatment groups helps the body burn energy and has a positive effect on the treatment of obesity.

Figure 4.
Effect of ghee and BCFAs intervention on the change in relative abundance of intestinal bacterial flora gate levels in mice. Relative abundance at the phylum level (A,B). Relative abundance of Firmicutes (C). Relative abundance of Bacteroidetes (D). F/B values (E). Clustering heatmap at the phylum level (F).
Table 4.
Relative abundance of major phyla in the mouse intestinal microbiota ().
2.8.2. Relative Abundance of Major Genera and Species of Intestinal Flora
As Figure 5A,B show only the top 20 genera with high relative abundance, at the genus level, the gut flora consists of Porphyromonadaceae_unclassified, Lachnospiraceae_unclassified, Alloprevotella, Bacteroides, Lachnoclostridium, Parabacteroides, Bacteroidetes_unclassified, Acetivibrio, Bacteroidales_unclassified, Alistipes, Barnesiella, Prevotella, Ruminococcaceae_unclassified, Clostridium_XlVb, Lactobacillus, Tidjanibacter, Anaerotaenia, Clostridium_XlVa, Oscillibacter, Desulfovibrio, and 111 other genera. In Table S4, the relative abundances of the intestinal flora exhibited more genera that were increased and fewer genera that were decreased in the treatment and ghee groups than in the control group.
Figure 5.
Effect of ghee and BCFAs intervention on changes in relative abundance of intestinal flora genus levels in mice. Relative abundance at the genus level (A,B). Clustering heatmap at the genus level (C). Clustering heatmap at the species level (D).
The results showed that the relative abundance of Helicobacter in the treatment group and the ghee group was lower than that in the control group, and the difference was significant. The relative abundance of Bilophila in the treatment group was higher than that in the control group and the ghee group, and the difference was significant. The relative abundance of Akkermansia in the treatment group was significantly higher than that in the control group and the ghee group. Lactobacillus in the treatment group and the ghee group showed significant differences compared with the control group. Lactobacillus sp. L-YJ and Lactobacillus vaginalis among the Lactobacillus genera were found to have significant differences in the gut flora of the three groups of mice, as shown in Table S5 and Figure 5C,D.
There were significant differences in the gut flora at the genus level among the three groups of mice, such as Helicobacter, Bilophila, Akkermansia, and Lactobacillus, as shown in Table 5.
Table 5.
Relative abundances of the main genera in the intestinal microflora of mice ().
2.9. Analysis of KEGG Pathways in the SK-BR-3 Transcriptome of Breast Cancer Cells
The results are shown in Figure 6. Among the 20 pathways with the most significant difference, the number of genes in the enrichment analysis was close to 60 for six pathways and 20 genes for nine pathways. Pathways with fewer than 20 genes enriched were mainly associated with DNA replication, fatty acid elongation metabolism, fatty acid metabolism (synthesis, transport of fatty acids), and fatty acid degradation. The pathways with almost 60 genes enriched were mainly associated with HTLV infection, ribosomes, and oxidative phosphorylation. Pathways with between 20 and 40 enriched genes were mainly located in the cell lysosome, carbon metabolism, and pyrimidine metabolism, as shown in Table S6 and Figure 6A.
Figure 6.
KEGG enrichment analysis bubble diagram. Metabolic pathways are downregulated in the KEGG enrichment bubble diagram (A). Metabolic pathways are upregulated in the KEGG enrichment bubble diagram (B).
Regarding the results of the upregulated pathways by KEGG enrichment analysis in Figure 6B, the results showed that among the 20 most significant pathways with 80 genes enriched, the pathways were mainly the regulation of metabolism in cancer, cell autophagy, viral carcinogenesis, endocytosis, ferroptosis, and protein processes in the endoplasmic reticulum, as detailed in Table S7 and Figure 6B.
3. Discussion
According to the changes in body weight and cholesterol content among blood lipids before and after feeding, the purified BCFAs from yak ghee can significantly reduce the total cholesterol content in mice. From the analysis results of the HMGCR gene, it can be seen that the mouse diet can lead to a significant reduction in the expression of the HMGCR gene, and it is confirmed at the genetic level that supplementation of the mouse diet with purified BCFAs from yak ghee can inhibit the synthesis of cholesterol in mice. It is suggested that long-term consumption of purified BCFAs from yak ghee may prevent cardiovascular and cerebrovascular diseases.
Analysis of the FADS1, FADS2, ACC-α, FAS, and SCD1 genes demonstrated that diets containing yak ghee and purified BCFAs from yak ghee inhibited the synthesis of polyunsaturated fatty acids in mice but improved the synthesis of monounsaturated fatty acids, ultimately reducing the synthesis of fatty acids in the bodies of mice. Analysis of the ACSS1 gene showed that the dietary differences in mice had no effect on the amount of synthesis of acetyl-CoA in the tricarboxylic acid cycle. The ACSL1, GPAT4, GPAM, and DGAT-1 gene expression results indicated that purified BCFAs from yak ghee can be used in the diet of mice to reduce body fat by inhibiting the synthesis of triglycerides in the glycerol phosphate pathway. According to the analysis of the expression of the THRSP gene in mouse liver, it is suggested that purified BCFAs from yak ghee can be used in the diet of mice to reduce body fat synthesis by reducing the synthesis of fat induced by thyroid hormone and carbohydrates. In general, supplementation of the mouse diet with purified BCFAs from yak ghee can reduce body fat synthesis in mice by inhibiting the glycerol pathway and reducing the thyroid hormone and carbohydrate-induced synthesis of fat. The A-FABP gene is mainly expressed in adipocytes. Analysis of the A-FABP and CPT1 genes demonstrated that the use of purified BCFAs from yak ghee as food for mice can improve the β-oxidation of fatty acids, thus reducing the synthesis and accumulation of fat in mice. It has been confirmed from other angles that BCFAs alleviate triglyceride accumulation. According to the results of the FABP1 gene expression analysis, yak ghee and purified BCFAs from yak ghee used in the diets of mice may promote the expression of FABP1 and increase lipid transport and metabolism in the liver due to the increased BCFA content. It appeared that the significance of PPARα within the whole preparation of mammary lipid union may be related to its clear role in the direction of mitochondrial biogenesis and energy metabolism. From the results, it is indicated that yak ghee and purified BCFAs from yak ghee in the diet of mice may lead to a decrease in the number and conversion rate of mitochondria in the liver of mice, thereby reducing lipid synthesis.
Gut flora imbalance is closely related to the health and development of many diseases, such as obesity, diabetes, nonalcoholic fatty liver disease, and cancer [35]. The alpha diversity analysis of the gut flora of mice showed that there was no significant difference between the Shannon and Simpson indices in each group; that is, there were no significant differences in sample richness or uniformity. The analysis of the beta diversity of the gut flora of mice indicated that the effect of diet on the gut flora is important. Studies have shown that Bacteroides are beneficial to human health. It is the most abundant bacteria in the gut flora of healthy people. It can participate in carbohydrate, bile acid, and steroid metabolism, and it can also promote gut mucosal blood vessel formation. The relative abundance of Firmicutes in patients with dyslipidemia, obesity, hypertension, and insulin resistance is higher than that in healthy people [36]. The relative abundances of Bacteroides in the gut flora of the mice in the treatment group were significantly higher than those in the control group; Firmicutes and Proteobacteria were significantly decreased, and the microbiota also proliferated. Proteobacteria are gram-negative bacteria, and most of the bacteria are pathogenic bacteria such as Hemococcus, Salmonella, Klebsiella, and Shigella [37]. Most of the bacteria in Helicobacter are pathogenic bacteria, such as Helicobacter pylori, associated with the development of chronic gastritis, peptic ulcers, and gastric cancer [38]. The relative abundance of Helicobacter in the treatment group and the ghee group was significantly lower than that in the control group. Both Akkermansia and Lactobacillus are beneficial for health. The main strain of Akkermansia is Akkermansia muciniphila, which degrades mucin properties and makes it a key microorganism for maintaining the gut mucosal barrier. The relative abundances of Akkermansia and Lactobacillus were the highest in the treatment group. Lactobacillus are one of the main bacteria in the intestinal tract of humans and animals, which can regulate the balance of intestinal flora, promote the diversity of flora in the intestinal tract, and enhance the body’s immunity and resistance, which is beneficial to health [39]. This result suggested that the enrichment of BCFAs from yak ghee can regulate the gut flora by reducing the relative abundances of Proteobacteria and Helicobacter and increasing the relative abundances of Akkermansia and Lactobacillus.
KEGG is a comprehensive database integrating genomic, chemical, and systemic functional information in metabolic pathways. BCFAs can not only regulate lipid metabolism for fatty acid synthesis, elongation, and degradation but can also biologically regulate carcinoma suppression and upregulation of microRNAs in cancer and the AMPK signaling pathway, which is in accordance with Nan Xu’s investigation showing that β-patchoulene progresses lipid metabolism to lighten nonalcoholic fatty liver illness by enacting the AMPK signaling pathway. Through the intervention experiments on cancer cells, the BCFAs of yak ghee were preliminarily verified to regulate the level of cellular lipid metabolism at the in vivo gene level, which provided the data basis for the subsequent studies on lipid-lowering activity using adipocytes as the carriers.
The diet containing BCFAs purified from yak ghee has a comprehensive regulatory effect on the body that involves biological systems such as lipid metabolism, biological pathways, and intestinal flora. Our results suggest that differences in the gene expression levels of members of lipid metabolism pathways could explain the health benefits as well as probiotic enrichment. The present study provides valuable information for improving yak ghee quality.
4. Materials and Methods
4.1. The Experimental Animals and Materials
Twenty-four SPF C57BL/6J mice were purchased from JiangSu Ji Cui Yao Kang Biotechnology Co., Ltd., Nanjing, China. Pellet feed was purchased from Jiang Su Xie Tong Biological Co., Ltd., Nanjing, China. The human breast cancer cell line SK-BR-3 was acquired from Shanghai Bogu Biotechnology Co., Ltd., Shanghai, China. The powder DMEM culture medium (Gibco, Ultimo, NSW, Australia), fetal bovine serum (Gibco, Ultimo, NSW, Australia), 0.25% trypsin (EDTA Solution), PBS (phosphate-buffered saline), OMEGA DNA/RNA/Protein Isolation Kit (R6734-01) (OMEGA, Biel/Bienne, Switzerland), and inverted fluorescence microscope (DMI4000B) were provided by the cell culture laboratory at Qinghai University, Xining, China.
Yak ghee was purchased from Qinghai local herdsmen in Qinghai Province, China. BCFAs with a concentration of 16.3% were obtained by urea complexation, as detailed in Table S1. The free fatty acids from yak ghee were used as a blank control group for cellular experiments at a concentration of 3.3% BCFAs. Primer sequences were designed by Bioengineering Co., Ltd., Shanghai, China.
4.2. Animals and Tissue Sampling
After one week of feeding during the acclimation period, the experimental SPF mice were randomly assigned to three groups, each with eight mice: the control group, fed normal maintenance feedstuffs with the nutrient composition shown in Table S2; the ghee group, fed normal maintenance feedstuffs substituted with 10% w/w yak ghee; and the treatment group, fed normal maintenance feedstuffs substituted with 10% w/w purified yak ghee, in which BCFAs accounted for 16.3%, fed to mice at fixed times every day for 4 weeks. The experiments with the mice were approved by the ethics committee of Qinghai University (approval number SL-2021019). All experiments were performed in accordance with Chinese laws and regulations. Eyeball blood from mice was collected 12 h after the last administration of feed at the end of feeding. After standing at room temperature for 2 to 3 h, the serum was separated at 1150× g for 15 min in a low-temperature centrifuge, and serum samples were frozen at −80 °C. Samples of liver and feces from colon sites were collected and stored at −80 °C (liquid nitrogen freezing). Livers were collected from each group of eight for PCR experiments, and three colon fecal samples were taken from each of the three groups of mice for 16S rDNA gene sequencing.
4.3. Measurement of Serum Biochemical Indicators
TC, TG, LDL-C, and HDL-C were measured using kits supplied by Nanjing Jiancheng Bio-Engineering Institute Co., Ltd. (Nanjing, China) [32].
4.4. RNA Preparation and Quantitative Real-Time PCR
Total RNA from the liver was extracted using an RNA-solv reagent (OMEGA Bio-Tek, Norcross, GA, USA) in accordance with the manufacturer’s instructions. The quality and purity of total RNA were assessed using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Shanghai, China). cDNA was synthesized from 2 μL of total RNA using a cDNA Reverse Transcription Kit (Accurate Biotechnology Co., Ltd., Danyang, China). The reaction conditions were as follows: 37 °C for 15 min, followed by 85 °C for 5 s. Quantitative real-time PCR was performed using iTaq Universal SYBR Green Supermix (Bio-Rad, Hercules, CA, USA) on a CFX 96 real-time PCR detection system (Bio-Rad). Reactions were incubated in a 96-well optical plate at 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s, 58 °C for 30 s, 95 °C for 10 s, 65 °C for 5 s, and 95 °C for 5 s. The gene expression levels were normalized to those of GAPDH, and relative mRNA expression was analyzed using the 2−ΔΔCT method. The primer sequences are listed in Table S3.
4.5. 16S rDNA Gene Sequencing
4.5.1. Total DNA of the Microbe Preparation
Total DNA from the fecal sample taken from the mouse colon was extracted utilizing the E.Z.N.A.® Stool DNA Kit (Omega, Norcross, GA, USA). The procedure used followed the specifications of the instructions, and the extracted DNA was stored at −80 °C. The quality of the extracted DNA was measured by agarose gel electrophoresis, and the DNA was quantified by ultraviolet spectrophotometry.
4.5.2. 16S rDNA High-Throughput Sequencing Analysis
The 16S rDNA gene variable region (V3 + V4) was subjected to PCR amplification. The bacterial 16S rDNA V3 + V4 region universal primers 338F: ACTCCTACGGGAGGCAGCAG and 806R: GGACTACHVGGGTWTCTAAT were used. The obtained PCR products were constructed into sequencing libraries and sequenced using the Illumina MiSeq platform for bioinformatics analysis of high-quality sequencing data.
4.6. Cell Culture
Free fatty acids from yak ghee were added to SK-BR-3 human breast cancer cells as a blank control group (total purity of BCFAs: 3.3%), and BCFAs (total purity of BCFAs: 16.3%) were added to human breast cancer cells as an experimental group. The free fatty acids of yak ghee were prepared by saponification, and the mixed fatty acids were obtained by urea complexation to purify the BCFAs. The human breast cancer cell line SK-BR-3 was passaged after full growth (80%~90%). The medium was filtered through a 0.22 μm membrane, and 15% fetal bovine serum and 1% double antibody were added at a volume ratio of 1:2 to 1:3. Culture flasks with a fuller growth of human breast cancer cells were selected for the experiment. Yak ghee-free fatty acids (total purity of BCFAs: 3.3%) were added to the full-grown culture flasks as a blank group, BCFAs (total purity of BCFAs: 16.3%) were added to the culture flasks as an experimental group, and the cells were incubated in an incubator at 37 °C with 5% CO2 for 24 h. The cells were then subjected to Illumina sequencing.
4.7. Illumina Sequencing
After sequencing, clean reads were collected by evacuating low-quality peruses and peruses with adapter/poly-N arrangements. Altogether, Q20, Q30, and the GC substance of the clean peruses were obtained, and advanced examinations were performed on the premise of clean reads. Sequencing was completed by Beijing Nuohezhiyuan Technology Co., Ltd. (Beijing, China). A KEGG pathway enrichment examination of differentially communicated genes was performed to decide which biological functions or pathways the differentially communicated genes beneath diverse conditions were related to.
4.8. Statistical Analysis
A one-way ANOVA was performed utilizing SPSS 22.0, and the fluctuation was analyzed by the Tamhane method. Lowercase letters indicate significance at the 0.05 level, and uppercase letters indicate significance at the 0.01 level. Different letters indicate significant or highly significant differences between groups. The Alpha diversity analysis indices of microbial communities were calculated using a taxonomic operational unit (OTU) table. Beta diversity analysis was performed by Principal Coordinate Analysis (PCoA) and Principal Component Analysis (PCA).
5. Conclusions
In conclusion, BCFAs purified from yak ghee could reduce body fat by inhibiting glycerophosphate metabolism, reducing lipid synthesis by thyroid hormones and carbohydrates, and increasing β-oxidation of fatty acids. Gut microbiota 16S rDNA sequencing analysis showed that BCFAs purified from yak ghee could increase the relative abundance of Bacteroidetes, Verrucomicrobia, Akkermansia, and Lactobacillus, decrease the relative abundance of Firmicutes, and lower the F/B ratio, which could contribute to the body’s consumption of energy and play a role in lipid metabolism regulation. The addition of BCFAs purified from yak ghee to cultured SK-BR-3 breast cancer cells altered the expression of biological metabolic pathways in SK-BR-3 breast cancer cells. The addition of BCFAs purified from yak ghee to cultured breast cancer cells SK-BR-3 altered the expression of lipid metabolic pathways in breast cancer cells SK-BR-3.
Supplementary Materials
The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/molecules28207222/s1, Table S1: FA composition(%, w/w) of yak butter, BCFA purified with urea (urea/FAs, adduction temperature and adduction time at 2:1, 4 °C and 8 h, respectively); Table S2: Nutrient composition and calorie content of general maintenance feeds; Table S3: Primer sequence information; Table S4: Relative abundance of the main genus of the gut microbiota in mice; Table S5: Relative abundance of the main species in the intestinal microflora in mice; Table S6: Down-regulated the significant metabolic pathway; Table S7: Up-regulated the significant metabolic pathway of the expressed gene.
Author Contributions
Conceptualization, T.T. and Y.L.; methodology, T.T., X.L. and W.S.; software, T.T.; validation, T.T. and Y.L.; formal analysis, T.T.; investigation, T.T.; resources, Y.L. and W.S.; data curation, W.S.; writing—original draft preparation, T.T.; writing—review and editing, Y.L.; visualization, T.T. and X.L.; supervision, Y.L. and W.S.; project administration, Y.L.; funding acquisition, W.S. All authors have read and agreed to the published version of the manuscript.
Funding
This research was supported by grants from the National Natural Science Foundation of China (22167020).
Institutional Review Board Statement
The study was conducted according to the guidelines of the Declaration of Helsinki and was approved by the Animal Ethics Committee of Qinghai University (approval number SL-2021019).
Informed Consent Statement
Not applicable.
Data Availability Statement
The data generated from the study are clearly presented and discussed in the manuscript.
Conflicts of Interest
The authors declare no conflict of interest.
Sample Availability
Not applicable.
References
- Sun, M.Q.; Ma, Y.; Cheng, J.J. Study on physical and chemical properties of yak ghee. China Dairy Ind. 2016, 44, 9–11. [Google Scholar]
- Ma, L. Characterization of Milk Components of Dairy Cows, Buffaloes, Yaks, Juanshan Cows, Goats, Camels and Horses. Ph.D. Thesis, Inner Mongolia Agricultural University, Hohhot, China, 2015. [Google Scholar]
- Zheng, Y.C.; Gong, W.H.; Du, X.; Yang, M.; Jing, S.Y.; Hong, J. Fatty acid composition of yak ghee and its effect on blood lipids in mice. China Dairy Ind. 2009, 37, 18–20. [Google Scholar]
- Jane, L.Y. Effects of Different Edible Fats and Oils Intake on Fatty Acid Composition and Lipid Metabolism of Liver and Blood in Mice. Ph.D. Thesis, Dalian University of Technology, Dalian, China, 2018. [Google Scholar]
- Yang, X.; Karrar, E.; Cong, F.; Lu, H.; Jin, Q.; Xu, X.; Huppertz, T.; Wei, W.; Wang, X. Identification and quantification of branched-chain fatty acids and odd-chain fatty acids of mammalian milk, dairy products, and vegetable oils using GC/TOF-MS. Int. Dairy J. 2023, 140, 105587. [Google Scholar] [CrossRef]
- Sutton, J.D.; Dhanoa, M.S.; Morant, S.V.; France, J.; Napper, D.J.; Schuller, E. Rates of production of acetate, propionate, and butyrate in the rumen of lactating dairy cows given normal and low-roughage diets. J. Dairy Sci. 2003, 86, 3620–3633. [Google Scholar] [CrossRef] [PubMed]
- Jin, L.; Wang, L.Z.; Wang, Z.S.; Xue, B.; Peng, Q.H. Relationship between rumen microorganisms and fatty acid composition of ruminant products. Feed Ind. 2018, 9, 51–55. [Google Scholar]
- Picklo, M.J.; Kalscheur, K.F.; Magnuson, A.; Bukowski, M.R.; Harnly, J.; Fukagawa, N.K.; Finley, J.W. Identification of High and Low Branched-Chain Fatty Acid-Producing Phenotypes in Holstein Cows following High-Forage and Low-Forage Diets in a Crossover Designed Trial. Curr. Dev. Nutr. 2022, 28, 154. [Google Scholar] [CrossRef] [PubMed]
- Roy, R.; Roseblade, A.; Rawling, T. Expansion of the structure-activity relationship of branched chain fatty acids: Effect of unsaturation and branching group size on anticancer activity. Chem. Phys. Lipids 2020, 232, 104952. [Google Scholar] [CrossRef] [PubMed]
- Yang, Z.; Liu, S.; Chen, X.; Chen, H.; Huang, M.; Zheng, J. Induction of apoptotic cell death and in vivo growth inhibition of human cancer cells by a saturated branched-chain fatty acid 13-methyltetradecanoic acid. Cancer Res. 2000, 60, 505–509. [Google Scholar]
- Wongtangtintharn, S.; Oku, H.; Iwasaki, H.; Toda, T. Effect of branched-chain fatty acids on fatty acid biosynthesis of human breast cancer cells. J. Nutr. Sci. Vitaminol. 2004, 50, 137–143. [Google Scholar] [CrossRef]
- Yu, J.; Yang, L.N.; Wu, Y.Y.; Lee, B.H.; Weng, S.M.; Hu, C.L.; Han, Y.L. 13-Methyltetradecanoic acid mitigates cerebral ischemia/reperfusion injury. Neural Regen. Res. 2016, 11, 1431–1437. [Google Scholar] [CrossRef]
- Ran-Ressler, R.R.; Khailova, L.; Arganbright, K.M.; Adkins-Rieck, C.K.; Jouni, Z.E.; Koren, O.; Ley, R.E.; Brenna, J.T.; Dvorak, B. Branched Chain Fatty Acids Reduce the Incidence of Necrotizing Enterocolitis and Alter Gastrointestinal Microbial Ecology in a Neonatal Rat Model. PLoS ONE 2011, 6, e29032. [Google Scholar] [CrossRef]
- Yan, Y.; Wang, Z.; Greenwald, J.; Kothapalli, K.S.D.; Park, H.G.; Liu, R.; Mendralla, E.; Lawrence, P.; Wang, X.; Brenna, J.T. BCFA suppresses LPS induced IL-8 mRNA expression in human intestinal epithelial cells. Prostaglandins Leukot. Essent. Fat. Acids 2017, 116, 27. [Google Scholar] [CrossRef]
- Li, J. In Vitro Hypolipidemic Effects and Mechanisms of Branched-Chain Fatty Acids iso-15:0 and iso-18:0. Ph.D. Thesis, Hunan Agricultural University, Changsha, China, 2018. [Google Scholar]
- Zhou, Z.K.; Wang, Y.Y.; Diao, Y.J.; Wang, F. Effects of excessive frying oil on glucose and lipid metabolism and related gene expression in rats. J. Chin. Cereals Oils Assoc. 2017, 32, 70–73. [Google Scholar]
- Xing, J.Y.; Zhang, Y.J.; Zhang, N.B.; Jing, W.Q.; Lee, Z.; Wang, X.Z.; Xu, Y.C. Effects of folic acid addition levels on expression and methylation of fat metabolism related genes in liver of broilers. J. Anim. Nutr. 2019, 31, 2098–2106. [Google Scholar]
- Zhang, R.; Chen, S.Y. Review of fatty acid synthase (FAS) research. Rural. Econ. Technol. 2018, 29, 111–113. [Google Scholar]
- Kang, J.; Zou, M.Y.; Ma, Y.J.; Song, X.H.; Sun, C.H.; Hao, Y.Q.; Xia, W.; Wu, L.J. Association between FADS1, FADS2 gene polymorphism and Chinese Hanautism spectrum disorder. Chin. J. Child Health 2017, 25, 14–17. [Google Scholar]
- Long, S.; Zhou, Y.; Bai, D.; Hao, W.; Fang, L. Fatty Acids Regulate Porcine Reproductive and Respiratory Syndrome Virus Infection via the AMPK-ACC1 Signaling Pathway. Viruses 2019, 11, 1145. [Google Scholar] [CrossRef] [PubMed]
- Luo, Y.H.; Sun, W.C. Cloning and analysis of yak desaturated lipase 1 (SCD1) gene. Heilongjiang Anim. Husb. Vet. Med. 2017, 9, 237–240. [Google Scholar]
- Cai, L.J.; Su, R.; Lee, N.N. Discussion on the effect of acetyl-CoA synthetase 2 on tumor metastasis. J. Guangzhou Med. Univ. 2018, 46, 103–106. [Google Scholar]
- Cao, Y.; Jin, H.G.; Yu, Y.S.; Zhang, L.C. Effects of ACSL1 gene on fat metabolism in sheep. Chin. J. Vet. Med. 2018, 38, 218–221. [Google Scholar]
- Tian, Z.Y.; Li, K.J.; Men, X.L.; Wu, J. Research progress of glycerol-3-phosphate acyltransferases (GPATs). Prog. Physiol. Sci. 2015, 46, 5. [Google Scholar]
- Compe, E.; Sousa, J.D.; Franccois, K.; Roche, R.; Rahmani, R.; Torresani, J.; Raymondjean, M.; Planells, R. Spot 14 protein interacts and cooperates with chicken ovalbumin upstream promoter-transcription factor 1 in the transcription of the L-type pyruvate kinase gene through a specificity protein 1 (Sp1) binding Site. Biochem. J. 2001, 358, 175–183. [Google Scholar] [CrossRef] [PubMed]
- Liang, J.J.; Lin, Y.Q.; Yu, Y.Y.; Wang, Y.; Zhu, J.J. Clonal expression of goat CPT1A gene and correlation analysis of intramuscular fat content. J. North China Agric. 2019, 34, 231–238. [Google Scholar]
- Jin, J.; Peng, D.Q. Advances in research of adipocyte-type fatty acid binding protein and atherosclerosis. Chin. J. Arterioscler. 2009, 17, 82–85. [Google Scholar]
- Liu, Q.; Mo, Z.C.; Guo, B.B.; Qu, L.H.; Liao, H.Q.; Xie, Y.J.; Zhang, M.X. Effect of palmitate on the expression of SR-BI and lipid contenzt in KGN cells via oxidase proliferator-activated receptor alpha. J. Pract. Med. 2019, 35, 49–54. [Google Scholar]
- Wang, J.T.; Cao, W.N.; Huo, Z.M.; Yan, X.W. Characterization of PPAR gene family in C. philippinarum and expression changes under dry dew stress. J. Dalian Ocean Univ. 2019, 34, 19–29. [Google Scholar]
- Storch, J.; McDermott, L. Structural and functional analysis of fatty acid-binding proteins. J. Lipid. Res. 2009, 50, 126–131. [Google Scholar] [CrossRef]
- Newberry, E.P.; Xie, Y.; Kennedy, S.; Han, X.L.; Buhman, K.K.; Luo, J.Y.; Gross, R.W.; Davidson, N. Decreased hepatic triglyceride accumulation and altered fatty acid uptake in mice with deletion of the liver fatty acid-binding protein-encoding gene. J. Biol. Chem. 2003, 278, 51664–51672. [Google Scholar] [CrossRef]
- Atshaves, B.P.; Story, S.M.; Huang, H.; Schroeder, F. Liver fatty acid binding protein expression enhances branched-chain fatty acid metabolism. Mol. Cell. Biochem. 2004, 259, 115–129. [Google Scholar] [CrossRef]
- Cogburn, L.A.; Wang, X.; Carre, W.; Rejto, L.; Porter, T.E.; Aggray, S.E.; Simon, J. Systems-wide chicken DNA microarrays, gene expression profiling and discovery of functional genes. Poultry Sci. 2003, 82, 6378–6383. [Google Scholar] [CrossRef]
- Bionaz, M.; Loor, J.J. Gene networks driving bovine milk fat synthesis during the lactation cycle. BMC Genom. 2008, 9, 366. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.Q.; Ding, Z.X.; Zhang, M.; Chen, H.Q.; Qin, H.L.; Jiang, Y.Q. Effects of probiotics on gut flora disturbance and bacterial translocation in mice with inflammatory bowel disease. J. Shanghai Jiaotong. Univ. 2010, 30, 74–78. [Google Scholar]
- Lee, J.Y.; Sun, Z.Y.; Yuan, Y. Correlation between gut flora and coronary heart disease based on high-channel sequencing. Chin. Gen. Pract. 2019, 22, 3554–3560. [Google Scholar]
- Huang, W.X.; Wang, H.P.; Wang, Y.L.; Dai, W.K.; Zheng, Y.J. High-throughput sequencing reveals the change of gut microbiota in infants with pneumonia following antibiotic treatment. Chin. J. Microecol. 2016, 28, 497–500. [Google Scholar]
- Zhang, H.H.; Jiang, J.X. Overview of bacterial infection and pathogenesis of Helicobacter. China Natl. Poult. 2017, 39, 44–48. [Google Scholar]
- Wang, S.M.; Zhang, S.; Zhang, L.L.; Zhang, G.S. Research progress on the role of lactic acid bacteria in regulating organism immunity. Cereals Oils 2022, 35, 16–27. [Google Scholar]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).