Icariin Alleviates Nonalcoholic Fatty Liver Disease in Polycystic Ovary Syndrome by Improving Liver Fatty Acid Oxidation and Inhibiting Lipid Accumulation
Abstract
1. Introduction
2. Results
2.1. Rat Model and Sex Hormone Levels
2.2. Icariin Improves Liver Steatosis and Liver Function in Rats
2.3. Effects of Icariin on NAFLD in PCOS Models as Revealed by RNA-Sequence Analysis
2.4. Icariin Improves NAFLD in PCOS by Promoting Fatty Acids Oxidation in the Liver
2.5. Icariin Alleviates NAFLD in PCOS by Increasing CD36 Content in Mitochondria
2.6. Icariin Improves Liver Steatosis by Reducing the Expression of Genes Associated with Fatty Acid Synthesis
3. Materials and Methods
3.1. Experimental Animals, Drugs, and Reagents
3.2. Estrous Cycle Determination
3.3. Plasma Sex Hormones, Fasting Blood Glucose and the Homeostasis Model Assessment of the IR Index
3.4. Measurement of Serum and Liver Biochemical Markers
3.5. Histopathology
3.6. Gene Expression Differences Are Identified through RNA-Sequence Analysis
3.7. Quantitative Real-Time PCR
3.8. Western Blot
3.9. Data and Statistical Analysis
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Cui, P.; Hu, W.; Ma, T.; Hu, M.; Tong, X.; Zhang, F.; Shi, J.; Xu, X.; Li, X.; Shao, L.R.; et al. Long-term androgen excess induces insulin resistance and non-alcoholic fatty liver disease in PCOS-like rats. J. Steroid Biochem. Mol. Biol. 2021, 208, 105829. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, C.; Ding, C.; Hua, Z.; Chen, C.; Yu, J. Cangfudaotan Decoction Alleviates Insulin Resistance and Improves Follicular Development in Rats with Polycystic Ovary Syndrome via IGF-1-PI3K/Akt-Bax/Bcl-2 Pathway. Mediat. Inflamm. 2020, 2020, 8865647. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Paschou, S.A.; Polyzos, S.A.; Anagnostis, P.; Goulis, D.G.; Kanaka-Gantenbein, C.; Lambrinoudaki, I.; Georgopoulos, N.A.; Vryonidou, A. Nonalcoholic fatty liver disease in women with polycystic ovary syndrome. Endocrine 2020, 67, 412–417. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kamal, D.; Ibrahim, S.; Ugusman, A.; Mokhtar, M.J.A. Kelulut Honey Ameliorates Oestrus Cycle, Hormonal Profiles, and Oxidative Stress in Letrozole-Induced Polycystic Ovary Syndrome Rats. Antioxidants 2022, 11, 1879. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cree-Green, M.; Bergman, B.C.; Coe, G.V.; Newnes, L.; Baumgartner, A.D.; Bacon, S.; Sherzinger, A.; Pyle, L.; Nadeau, K.J. Hepatic Steatosis is Common in Adolescents with Obesity and PCOS and Relates to De Novo Lipogenesis but not Insulin Resistance. Obesity (Silver Spring) 2016, 24, 2399–2406. [Google Scholar] [CrossRef] [Scilit]
- Ohkubo, R.; Mu, W.; Wang, C.; Song, Z.; Barthez, M.; Wang, Y.; Mitchener, N.; Abdullayev, R.; Lee, Y.; Ma, Y.; et al. The hepatic integrated stress response suppresses the somatotroph axis to control liver damage in nonalcoholic fatty liver disease. Cell Rep. 2022, 41, 111803. [Google Scholar] [CrossRef] [Scilit]
- Martin, S.; Cule, M.; Basty, N.; Tyrrell, J.; Beaumont, R.N.; Wood, A.R.; Frayling, T.M.; Sorokin, E.; Whitcher, B.; Liu, Y.; et al. Genetic Evidence for Different Adiposity Phenotypes and Their Opposing Influences on Ectopic Fat and Risk of Cardiometabolic Disease. Diabetes 2021, 70, 1843–1856. [Google Scholar] [CrossRef] [Scilit]
- Javed, Z.; Papageorgiou, M.; Deshmukh, H.; Kilpatrick, E.S.; Mann, V.; Corless, L.; Abouda, G.; Rigby, A.S.; Atkin, S.L.; Sathyapalan, T. A Randomized, Controlled Trial of Vitamin D Supplementation on Cardiovascular Risk Factors, Hormones, and Liver Markers in Women with Polycystic Ovary Syndrome. Nutrients 2019, 11, 188. [Google Scholar] [CrossRef] [Scilit]
- Kur, P.; Kolasa-Wolosiuk, A.; Misiakiewicz-Has, K.; Wiszniewska, B. Sex Hormone-Dependent Physiology and Diseases of Liver. Int. J. Environ. Res. Public Health 2020, 17, 2620. [Google Scholar] [CrossRef] [Scilit]
- Song, M.; Choi, J.J.F. Androgen dysfunction in non-alcoholic fatty liver disease: Role of sex hormone binding globulin. Front. Endocrinol. 2022, 13, 1053709. [Google Scholar] [CrossRef] [Scilit]
- Donnelly, K.L.; Smith, C.I.; Schwarzenberg, S.J.; Jessurun, J.; Boldt, M.D.; Parks, E.J. Sources of fatty acids stored in liver and secreted via lipoproteins in patients with nonalcoholic fatty liver disease. J. Clin. Investig. 2005, 115, 1343–1351. [Google Scholar] [CrossRef]
- Weber, M.; Mera, P.; Casas, J.; Salvador, J.; Rodriguez, A.; Alonso, S.; Sebastian, D.; Soler-Vazquez, M.C.; Montironi, C.; Recalde, S.; et al. Liver CPT1A gene therapy reduces diet-induced hepatic steatosis in mice and highlights potential lipid biomarkers for human NAFLD. FASEB J. 2020, 34, 11816–11837. [Google Scholar] [CrossRef] [Scilit]
- Zhong, Y.; Li, Z.; Jin, R.; Yao, Y.; He, S.; Lei, M.; Wang, X.; Shi, C.; Gao, L.; Peng, X.J.N. Diosgenin Ameliorated Type II Diabetes-Associated Nonalcoholic Fatty Liver Disease through Inhibiting De Novo Lipogenesis and Improving Fatty Acid Oxidation and Mitochondrial Function in Rats. Nutrients 2022, 14, 4994. [Google Scholar] [CrossRef] [Scilit]
- Mashek, D.G. Hepatic fatty acid trafficking: Multiple forks in the road. Adv. Nutr. 2013, 4, 697–710. [Google Scholar] [CrossRef] [Scilit]
- Koo, S.H. Nonalcoholic fatty liver disease: Molecular mechanisms for the hepatic steatosis. Clin. Mol. Hepatol. 2013, 19, 210–215. [Google Scholar] [CrossRef] [Scilit]
- Miquilena-Colina, M.E.; Lima-Cabello, E.; Sanchez-Campos, S.; Garcia-Mediavilla, M.V.; Fernandez-Bermejo, M.; Lozano-Rodriguez, T.; Vargas-Castrillon, J.; Buque, X.; Ochoa, B.; Aspichueta, P.; et al. Hepatic fatty acid translocase CD36 upregulation is associated with insulin resistance, hyperinsulinaemia and increased steatosis in non-alcoholic steatohepatitis and chronic hepatitis C. Gut 2011, 60, 1394–1402. [Google Scholar] [CrossRef] [Scilit]
- Ipsen, D.H.; Lykkesfeldt, J.; Tveden-Nyborg, P. Molecular mechanisms of hepatic lipid accumulation in non-alcoholic fatty liver disease. Cell Mol. Life Sci. 2018, 75, 3313–3327. [Google Scholar] [CrossRef] [Scilit]
- Wang, M.; Gao, H.; Li, W.; Wu, B. Icariin and its metabolites regulate lipid metabolism: From effects to molecular mechanisms. Biomed. Pharm. 2020, 131, 110675. [Google Scholar] [CrossRef] [Scilit]
- Yao, W.; Wang, K.; Wang, X.; Li, X.; Dong, J.; Zhang, Y.; Ding, X. Icariin ameliorates endothelial dysfunction in type 1 diabetic rats by suppressing ER stress via the PPARalpha/Sirt1/AMPKalpha pathway. J. Cell Physiol. 2021, 236, 1889–1902. [Google Scholar] [CrossRef] [Scilit]
- Yang, J.M.; Sun, Y.; Wang, M.; Zhang, X.L.; Zhang, S.J.; Gao, Y.S.; Chen, L.; Wu, M.Y.; Zhou, L.; Zhou, Y.M.; et al. Regulatory effect of a Chinese herbal medicine formula on non-alcoholic fatty liver disease. World J. Gastroenterol. 2019, 25, 5105–5119. [Google Scholar] [CrossRef] [Scilit]
- Liu, J.; Liu, L.; Sun, J.; Luo, Q.; Yan, C.; Zhang, H.; Liu, F.; Wei, Y.; Dong, J. Icariin Protects Hippocampal Neurons From Endoplasmic Reticulum Stress and NF-kappaB Mediated Apoptosis in Fetal Rat Hippocampal Neurons and Asthma Rats. Front. Pharmacol. 2019, 10, 1660. [Google Scholar]
- Zhao, Y.; Hou, Y.; Tang, G.; Cai, E.; Liu, S.; Yang, H.; Zhang, L.; Wang, S. Optimization of Ultrasonic Extraction of Phenolic Compounds from Epimedium brevicornum Maxim Using Response Surface Methodology and Evaluation of Its Antioxidant Activities In Vitro. J. Anal. Methods Chem. 2014, 2014, 864654. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hong, Y.; Yin, Y.; Tan, Y.; Hong, K.; Zhou, H. The Flavanone, Naringenin, Modifies Antioxidant and Steroidogenic Enzyme Activity in a Rat Model of Letrozole-Induced Polycystic Ovary Syndrome. Med. Sci. Monit. 2019, 25, 395–401. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Link, V.M.; Duttke, S.H.; Chun, H.B.; Holtman, I.R.; Westin, E.; Hoeksema, M.A.; Abe, Y.; Skola, D.; Romanoski, C.E.; Tao, J.; et al. Analysis of Genetically Diverse Macrophages Reveals Local and Domain-wide Mechanisms that Control Transcription Factor Binding and Function. Cell 2018, 173, 1796–1809.e17. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kroetz, D.L.; Yook, P.; Costet, P.; Bianchi, P.; Pineau, T. Peroxisome proliferator-activated receptor alpha controls the hepatic CYP4A induction adaptive response to starvation and diabetes. J. Biol. Chem. 1998, 273, 31581–31589. [Google Scholar] [CrossRef] [Scilit]
- Su, G.M.; Fiala-Beer, E.; Weber, J.; Jahn, D.; Robertson, G.R.; Murray, M. Pretranslational upregulation of microsomal CYP4A in rat liver by intake of a high-sucrose, lipid-devoid diet containing orotic acid. Biochem. Pharmacol. 2005, 69, 709–717. [Google Scholar] [CrossRef] [Scilit]
- Bougarne, N.; Weyers, B.; Desmet, S.J.; Deckers, J.; Ray, D.W.; Staels, B.; De Bosscher, K. Molecular Actions of PPARalpha in Lipid Metabolism and Inflammation. Endocr. Rev. 2018, 39, 760–802. [Google Scholar] [CrossRef] [Scilit]
- Li, J.X.; Ke, D.Z.; Yao, L.; Wang, S.; Ma, P.; Liu, L.; Zuo, G.W.; Jiang, L.R.; Wang, J.W. Response of genes involved in lipid metabolism in rat epididymal white adipose tissue to different fasting conditions after long-term fructose consumption. Biochem. Biophys. Res. Commun. 2017, 484, 336–341. [Google Scholar] [CrossRef] [Scilit]
- Xi, Y.; Xuan, C.; Zhang, J.; Wang, T.; Jin, Y.; Guo, H.; Yao, L.; Johji, Y.; Luo, X.; Wang, J. Study on the effect of 6-gingerenol on improving hepatic insulin resistence in aged rats. Chin. Pharmacol. Clin. 2021, 1, 73–79. (In Chinese) [Google Scholar]
- Jiang, G.Z.; Zhou, M.; Zhang, D.D.; Li, X.F.; Liu, W.B. The mechanism of action of a fat regulator: Glycyrrhetinic acid (GA) stimulating fatty acid transmembrane and intracellular transport in blunt snout bream (Megalobrama amblycephala). Comp. Biochem. Physiol. A Mol. Integr. Physiol. 2018, 226, 83–90. [Google Scholar] [CrossRef] [Scilit]
- Zhao, L.; Zhang, C.; Luo, X.; Wang, P.; Zhou, W.; Zhong, S.; Xie, Y.; Jiang, Y.; Yang, P.; Tang, R.; et al. CD36 palmitoylation disrupts free fatty acid metabolism and promotes tissue inflammation in non-alcoholic steatohepatitis. J. Hepatol. 2018, 69, 705–717. [Google Scholar] [CrossRef] [Scilit]
- Zeng, S.; Wu, F.; Chen, M.; Li, Y.; You, M.; Zhang, Y.; Yang, P.; Wei, L.; Ruan, X.Z.; Zhao, L.; et al. Inhibition of Fatty Acid Translocase (FAT/CD36) Palmitoylation Enhances Hepatic Fatty Acid beta-Oxidation by Increasing Its Localization to Mitochondria and Interaction with Long-Chain Acyl-CoA Synthetase 1. Antioxid. Redox Signal. 2022, 36, 1081–1100. [Google Scholar] [CrossRef] [Scilit]
- Li, P.; Zhang, R.; Wang, M.; Chen, Y.; Chen, Z.; Ke, X.; Zuo, L.; Wang, J. Baicalein Prevents Fructose-Induced Hepatic Steatosis in Rats: In the Regulation of Fatty Acid De Novo Synthesis, Fatty Acid Elongation and Fatty Acid Oxidation. Front. Pharmacol. 2022, 13, 917329. [Google Scholar] [CrossRef] [Scilit]
- Liou, C.J.; Lee, Y.K.; Ting, N.C.; Chen, Y.L.; Shen, S.C.; Wu, S.J.; Huang, W.C. Protective Effects of Licochalcone A Ameliorates Obesity and Non-Alcoholic Fatty Liver Disease Via Promotion of the Sirt-1/AMPK Pathway in Mice Fed a High-Fat Diet. Cells 2019, 8, 447. [Google Scholar] [CrossRef] [Scilit]
- Oishi, Y.; Spann, N.J.; Link, V.M.; Muse, E.D.; Strid, T.; Edillor, C.; Kolar, M.J.; Matsuzaka, T.; Hayakawa, S.; Tao, J.; et al. SREBP1 Contributes to Resolution of Pro-inflammatory TLR4 Signaling by Reprogramming Fatty Acid Metabolism. Cell Metab. 2017, 25, 412–427. [Google Scholar] [CrossRef] [Scilit]
- Yilmaz, Y. Review article: Is non-alcoholic fatty liver disease a spectrum, or are steatosis and non-alcoholic steatohepatitis distinct conditions? Aliment Pharmacol. Ther. 2012, 36, 815–823. [Google Scholar] [CrossRef] [Scilit]
- Chen, M.J.; Ho, H.N. Hepatic manifestations of women with polycystic ovary syndrome. Best Pract. Res. Clin. Obstet. Gynaecol. 2016, 37, 119–128. [Google Scholar] [CrossRef] [Scilit]
- Frohlich, E.; Wahl, R. Insight into Potential Interactions of Thyroid Hormones, Sex Hormones and Their Stimulating Hormones in the Development of Non-Alcoholic Fatty Liver Disease. Metabolites 2022, 12, 718. [Google Scholar] [CrossRef] [Scilit]
- Lan, T.; Yu, Y.; Zhang, J.; Li, H.; Weng, Q.; Jiang, S.; Tian, S.; Xu, T.; Hu, S.; Yang, G.; et al. Cordycepin Ameliorates Nonalcoholic Steatohepatitis by Activation of the AMP-Activated Protein Kinase Signaling Pathway. Hepatology 2021, 74, 686–703. [Google Scholar] [CrossRef] [Scilit]
- Spremovic Radenovic, S.; Pupovac, M.; Andjic, M.; Bila, J.; Sreckovic, S.; Gudovic, A.; Dragas, B.; Radunovic, N. Prevalence, Risk Factors, and Pathophysiology of Nonalcoholic Fatty Liver Disease (NAFLD) in Women with Polycystic Ovary Syndrome (PCOS). Biomedicines 2022, 10, 131. [Google Scholar] [CrossRef] [Scilit]
- Zhou, H.; Ma, C.; Wang, C.; Gong, L.; Zhang, Y.; Li, Y. Research progress in use of traditional Chinese medicine monomer for treatment of non-alcoholic fatty liver disease. Eur. J. Pharmacol. 2021, 898, 173976. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, L.; Jia, Z.; Wang, B.; Zhang, B. Berberine inhibits liver damage in rats with non-alcoholic fatty liver disease by regulating TLR4/MyD88/NF-kappaB pathway. Turk J. Gastroenterol. 2020, 31, 902–909. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, X.L.; Zou, X.Y.; Zhang, M.; Hu, H.Q.; Wei, X.L.; Jin, M.L.; Cheng, H.W.; Jiang, S. Osteocalcin prevents insulin resistance, hepatic inflammation, and activates autophagy associated with high-fat diet-induced fatty liver hemorrhagic syndrome in aged laying hens. Poult Sci. 2021, 100, 73–83. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Marechal, L.; Laviolette, M.; Rodrigue-Way, A.; Sow, B.; Brochu, M.; Caron, V.; Tremblay, A. The CD36-PPARgamma Pathway in Metabolic Disorders. Int. J. Mol. Sci. 2018, 19, 1529. [Google Scholar] [CrossRef] [Scilit]
- Pawlak, M.; Lefebvre, P.; Staels, B. Molecular mechanism of PPARalpha action and its impact on lipid metabolism, inflammation and fibrosis in non-alcoholic fatty liver disease. J. Hepatol. 2015, 62, 720–733. [Google Scholar] [CrossRef] [Scilit]
- Wang, C.; Yan, Y.; Hu, L.; Zhao, L.; Yang, P.; Moorhead, J.F.; Varghese, Z.; Chen, Y.; Ruan, X.Z. Rapamycin-mediated CD36 translational suppression contributes to alleviation of hepatic steatosis. Biochem. Biophys. Res. Commun. 2014, 447, 57–63. [Google Scholar] [CrossRef] [Scilit]







| Gene | Forward Primer | Reverse Primer |
|---|---|---|
| SCD1 | TGTCAAAGAGAAGGGCGGAAAGC | CAGGATGAAGCACATGAGCAGGAG |
| SREBP1c | CCTGCTTCTCTGGGCTCCTCTC | GCACGGACGGGTACATCTTTACAG |
| ChREBP | GAAGACCCAAAGACCAAGATGC | TCTGACAACAAAGCAGGAGGTG |
| NRIH3 | GTGCCTGATGTTTCTCCTGACTCTG | AAGTGTTGCCTCCCTGGTCTCC |
| CD36 | TGTACCTGTGAGTTGGCAAGAAGC | ACAGCCAGGACAGCACCAATAAC |
| FABP1 | GGTCAAGGCAGTGGTTAAGATGGAG | GTAGACGATGTCACCCAGTGTCATG |
| PPARα | GTCATCACAGACACCCTCTCCC | TGTCCCCACATATTCGACACTC |
| ACACA | TTCCCATCCGCCTCTTCCTGAC | TGCTTGTCTCCATACGCCTGAAAC |
| FATP2 | AGGTGAGGTTGGACTCTTGATTTGC | GGAGATCGCCACTGTTGAAGTAGAC |
| CPT1α | CAGGAGAGTGCCAGGAGGTCATAG | TGCCGAAAGAGTCAAATGGGAAGG |
| CYP4A3 | TCTCACCAGATTCTCCTCGCCATAG | CCACAGCCACCTTCAGCTCATTC |
| ACOX1 | AAATCAAGCAAAGCGAACCAGAACC | CGAAGTGGAAGGCATAGGCAGTG |
| LCAD | CCCTGGTTTCAGCCTCCATTCAG | AATACACTTGCCCGCCGTCATC |
| MCAD | AGAGGCTACAAGGTCCTGAGAAGTG | AACTCTTTCTGCTGCTCCGTCAAC |
| FASN | ACCTCATCACTAGAAGCCACCAG | GTGGTACTTGGCCTTGGGTTTA |
| GAPDH | TGCACCACCAACTGCTTAG | GGATGCAGGGATGATGTTC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hai, Y.; Zuo, L.; Wang, M.; Zhang, R.; Wang, M.; Ren, L.; Yang, C.; Wang, J. Icariin Alleviates Nonalcoholic Fatty Liver Disease in Polycystic Ovary Syndrome by Improving Liver Fatty Acid Oxidation and Inhibiting Lipid Accumulation. Molecules 2023, 28, 517. https://doi.org/10.3390/molecules28020517
Hai Y, Zuo L, Wang M, Zhang R, Wang M, Ren L, Yang C, Wang J. Icariin Alleviates Nonalcoholic Fatty Liver Disease in Polycystic Ovary Syndrome by Improving Liver Fatty Acid Oxidation and Inhibiting Lipid Accumulation. Molecules. 2023; 28(2):517. https://doi.org/10.3390/molecules28020517
Chicago/Turabian StyleHai, Yang, Ling Zuo, Meng Wang, Ruoyu Zhang, Munan Wang, Li Ren, Congwen Yang, and Jianwei Wang. 2023. "Icariin Alleviates Nonalcoholic Fatty Liver Disease in Polycystic Ovary Syndrome by Improving Liver Fatty Acid Oxidation and Inhibiting Lipid Accumulation" Molecules 28, no. 2: 517. https://doi.org/10.3390/molecules28020517
APA StyleHai, Y., Zuo, L., Wang, M., Zhang, R., Wang, M., Ren, L., Yang, C., & Wang, J. (2023). Icariin Alleviates Nonalcoholic Fatty Liver Disease in Polycystic Ovary Syndrome by Improving Liver Fatty Acid Oxidation and Inhibiting Lipid Accumulation. Molecules, 28(2), 517. https://doi.org/10.3390/molecules28020517

