The Essential Oil Derived from Perilla frutescens (L.) Britt. Attenuates Imiquimod–Induced Psoriasis-like Skin Lesions in BALB/c Mice
Abstract
1. Introduction
2. Materials and Methods
2.1. Material
2.2. Essential Oil Extraction and Gas Chromatography and Mass Spectrometry (GC-MS)
2.3. Animals and Treatment
2.4. Evaluation of the Severity of Psoriasis-like Skin Lesions
2.5. Spleen Index Calculation
2.6. Histopathological and Immunohistochemical Examination
2.7. RNA Extract and Real-Time Polymerase Chain Reaction
2.8. Enzyme-Linked Immunosorbent Assay (Elisa)
2.9. Statistical Analysis
3. Results
3.1. GC–MS Analysis
3.2. PO Relieves IMQ-Induced Psoriasis-like Symptoms
3.3. PO Inhibited Neutrophil Activation and the Expression of Inflammation-Related Factors
3.4. PO Downregulates mRNA Levels of Immune-Related Factors in Skin Tissues
3.5. PO Inhibits the Expression of Inflammatory Factors in IMQ-Induced Mice in Serum
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Sample Availability
References
- Griffiths, C.E.M.; Armstrong, A.W.; Gudjonsson, J.E.; Barker, J. Psoriasis. Lancet 2021, 397, 1301–1315. [Google Scholar] [CrossRef]
- Langley, R.G.; Krueger Gg Fau-Griffiths, C.E.M.; Griffiths, C.E. Psoriasis: Epidemiology, clinical features, and quality of life. Ann. Rheum. Dis. 2005, 64 (Suppl. S2), ii18–ii23, discussion ii24–ii25. [Google Scholar] [CrossRef] [PubMed]
- Rendon, A.; Schäkel, K. Psoriasis Pathogenesis and Treatment. Int. J. Mol. Sci. 2019, 20, 1475. [Google Scholar] [CrossRef]
- Oji, V.; Luger, T.A. The skin in psoriasis: Assessment and challenges. Clin. Exp. Rheumatol. 2015, 33, 14–19. [Google Scholar]
- Choi, H.K.; Hwang, K.; Hong, Y.D.; Cho, Y.H.; Kim, J.W.; Lee, E.O.; Park, W.S.; Park, C.S. Ceramide NPs Derived from Natural Oils of Korean Traditional Plants Enhance Skin Barrier Functions and Stimulate Expressions of Genes for Epidermal Homeostasis. J. Cosmet. Dermatol. 2022. [CrossRef]
- Hartman-Petrycka, M.; Lebiedowska, A. The Assessment of Quality of Products Called Sandalwood Oil Based on the Information Provided by Manufacturer of the Oil on Polish, German, and English Websites. Evid.-Based Complementary Altern. Med. 2021, 2021, 9934143. [Google Scholar] [CrossRef]
- Maugeri, A.; Lombardo, G.E.; Musumeci, L.; Russo, C.; Gangemi, S.; Calapai, G.; Cirmi, S.; Navarra, M. Bergamottin and 5-Geranyloxy-7-methoxycoumarin Cooperate in the Cytotoxic Effect of Citrus bergamia (Bergamot) Essential Oil in Human Neuroblastoma SH-SY5Y Cell Line. Toxins 2021, 13, 275. [Google Scholar] [CrossRef]
- Singh, S.; Singh, S.; Kumar, S.; Verma, S. Biological activities and therapeutic potential of Perilla frutescens (purple mint): A review. Int. J. Pharm. Sci. Res. 2022, 13, 645–653. [Google Scholar]
- Lee, J.H.; Cho, Y.-S. Assessment of phenolic profiles from various organs in different species of perilla plant (Perilla frutescens (L.) Britt.) and their antioxidant and enzyme inhibitory potential. Ind. Crops Prod. 2021, 171, 113914. [Google Scholar] [CrossRef]
- Dimita, R.; Min Allah, S.; Luvisi, A.; Greco, D.; De Bellis, L.; Accogli, R.; Mininni, C.; Negro, C. Volatile Compounds and Total Phenolic Content of Perilla frutescens at Microgreens and Mature Stages. Horticulturae 2022, 8, 71. [Google Scholar] [CrossRef]
- Zi, Y.; Yao, M.; Lu, Z.; Lu, F.; Bie, X.; Zhang, C.; Zhao, H. Glycoglycerolipids from the leaves of Perilla frutescens (L.) Britton (Labiatae) and their anti-inflammatory activities in lipopolysaccharide-stimulated RAW264.7 cells. Phytochemistry 2021, 184, 112679. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.; Guo, L.; Liu, L.; Han, B.; Niu, X. Composite chitosan films prepared using nisin and Perilla frutescense essential oil and their use to extend strawberry shelf life. Food Biosci. 2021, 41, 101037. [Google Scholar] [CrossRef]
- Bocheńska, K.; Smolińska, E.; Moskot, M.; Jakóbkiewicz-Banecka, J.; Gabig-Cimińska, M. Models in the Research Process of Psoriasis. Int. J. Mol. Sci. 2017, 18, 2514. [Google Scholar] [CrossRef] [PubMed]
- Luo, W.; Du, Z.; Zheng, Y.; Liang, X.; Huang, G.; Zhang, Q.; Liu, Z.; Zhang, K.; Zheng, X.; Lin, L.; et al. Phytochemical composition and bioactivities of essential oils from six Lamiaceae species. Ind. Crops Prod. 2019, 133, 357–364. [Google Scholar] [CrossRef]
- Zhang, L.; Ye, M.; Shi, Y.; Zhu, H.; Chi, L.; Pan, C.; Xu, Y.; Zheng, X.; Xiang, H.; Li, C. Phytochemical components and biological activities of essential oils from three selected medicinal plants. Ind. Crops Prod. 2021, 160, 113127. [Google Scholar] [CrossRef]
- Zheng, Y.; Pan, C.; Zhang, Z.; Luo, W.; Liang, X.; Shi, Y.; Liang, L.; Zheng, X.; Zhang, L.; Du, Z. Antiaging effect of Curcuma longa L. essential oil on ultraviolet-irradiated skin. Microchem. J. 2020, 154, 104608. [Google Scholar] [CrossRef]
- Zhou, W.; Hu, M.; Zang, X.; Liu, Q.; Du, J.; Hu, J.; Zhang, L.; Du, Z.; Xiang, Z. Luteolin attenuates imiquimod–induced psoriasis-like skin lesions in BALB/c mice via suppression of inflammation response. Biomed. Pharmacother. 2020, 131, 110696. [Google Scholar] [CrossRef]
- Ota, Y.; Ito, M. Sedative effects of inhaled Perilla frutescens essential oils on mice. J. Nat. Med. 2021, 75, 664–669. [Google Scholar] [CrossRef]
- Chen, F.; Liu, S.; Zhao, Z.; Gao, W.; Ma, Y.; Wang, X.; Yan, S.; Luo, D. Ultrasound pre-treatment combined with microwave-assisted hydrodistillation of essential oils from Perilla frutescens (L.) Britt. leaves and its chemical composition and biological activity. Ind. Crops Prod. 2020, 143, 111908. [Google Scholar] [CrossRef]
- Tian, J.; Zeng, X.; Zhang, S.; Wang, Y.; Zhang, P.; Lü, A.; Peng, X. Regional variation in components and antioxidant and antifungal activities of Perilla frutescens essential oils in China. Ind. Crops Prod. 2014, 59, 69–79. [Google Scholar] [CrossRef]
- Zhang, Z.-J.; Li, N.; Li, H.-Z.; Li, X.-J.; Cao, J.-M.; Zhang, G.-P.; He, D.-L. Preparation and characterization of biocomposite chitosan film containing Perilla frutescens (L.) Britt. essential oil. Ind. Crops Prod. 2018, 112, 660–667. [Google Scholar] [CrossRef]
- Huang, B.; Lei, Y.; Tang, Y.; Zhang, J.; Qin, L.; Liu, J. Comparison of HS-SPME with hydrodistillation and SFE for the analysis of the volatile compounds of Zisu and Baisu, two varietal species of Perilla frutescens of Chinese origin. Food Chem. 2011, 125, 268–275. [Google Scholar] [CrossRef]
- Liu, Y.; Wang, H.; Zhang, J. Comparison of MAHD with UAE and hydrodistillation for the analysis of volatile oil from four parts of Perilla frutescens cultivated in southern China. Anal. Lett. 2012, 45, 1894–1909. [Google Scholar] [CrossRef]
- Cheng, W.J.; Chiang, C.C.; Lin, C.Y.; Chen, Y.L.; Leu, Y.L.; Sie, J.Y.; Chen, W.L.; Hsu, C.Y.; Kuo, J.J.; Hwang, T.L. Astragalus mongholicus Bunge Water Extract Exhibits Anti-inflammatory Effects in Human Neutrophils and Alleviates Imiquimod-Induced Psoriasis-Like Skin Inflammation in Mice. Front. Pharmacol. 2021, 12, 762829. [Google Scholar] [CrossRef] [PubMed]
- Ormerod, A.D.; Weller, R.; Fau-Copeland, P.; Copeland, P.; Fau-Benjamin, N.; Benjamin, N.; Fau-Ralston, S.H.; Ralston Sh Fau-Grabowksi, P.; Grabowksi, P.; Fau-Herriot, R.; et al. Detection of nitric oxide and nitric oxide synthases in psoriasis. Arch. Dermatol. Res. 1998, 290, 3–8. [Google Scholar] [CrossRef] [PubMed]
- Duan, X.; Cheng, Y.; Gao, L.; Li, L.; Wang, T.; Zhang, M. Evaluation of the Potential Association between NOS Gene Polymorphisms (iNOS G-954C and eNOS G894T) and Psoriasis. Ann. Dermatol. 2016, 28, 110–112. [Google Scholar] [CrossRef][Green Version]
- More, N.B.; Sharma, N.; Pulivendala, G.; Bale, S.; Godugu, C. Natural product topical therapy in mitigating imiquimod-induced psoriasis-like skin inflammation-underscoring the anti-psoriatic potential of Nimbolide. Indian J. Pharmacol. 2021, 53, 278. [Google Scholar]
- Dillmann, C.; Ringel, C.; Ringleb, J.; Mora, J.A.-O.; Olesch, C.; Fink, A.F.; Roberts, E.; Brüne, B.; Weigert, A. S1PR4 Signaling Attenuates ILT 7 Internalization To Limit IFN-α Production by Human Plasmacytoid Dendritic Cells. J. Immunol. 2016, 196, 1579–1590. [Google Scholar] [CrossRef]
- Arakura, F.; Hida, S.; Ichikawa, E.; Yajima, C.; Nakajima, S.; Saida, T.; Taki, S. Genetic control directed toward spontaneous IFN-α/IFN-β responses and downstream IFN-γ expression influences the pathogenesis of a murine psoriasis-like skin disease. J. Immunol. 2007, 179, 3249–3257. [Google Scholar] [CrossRef]
- Works, M.G.; Yin, F.; Yin, C.C.; Yiu, Y.; Shew, K.; Tran, T.T.; Dunlap, N.; Lam, J.; Mitchell, T.; Reader, J.; et al. Inhibition of TYK2 and JAK1 ameliorates imiquimod-induced psoriasis-like dermatitis by inhibiting IL-22 and the IL-23/IL-17 axis. J. Immunol. 2014, 193, 3278–3287. [Google Scholar] [CrossRef]
- Dobrzyńska, I.A.-O.; Szachowicz-Petelska, B.; Wroński, A.; Jarocka-Karpowicz, I.; Skrzydlewska, E.A.-O. Changes in the Physicochemical Properties of Blood and Skin Cell Membranes as a Result of Psoriasis Vulgaris and Psoriatic Arthritis Development. Int. J. Mol. Sci. 2020, 21, 9129. [Google Scholar] [CrossRef] [PubMed]
- Zhou, F.; Zhu, Z.; Gao, J.; Yang, C.; Wen, L.; Liu, L.; Zuo, X.; Zheng, X.; Shi, Y.; Zhu, C.; et al. NFKB1 mediates Th1/Th17 activation in the pathogenesis of psoriasis. Cell. Immunol. 2018, 331, 16–21. [Google Scholar] [CrossRef] [PubMed]
- Sun, Y.; Zhang, J.; Zhai, T.; Li, H.; Li, H.; Huo, R.; Shen, B.; Wang, B.; Chen, X.; Li, N.; et al. CCN1 promotes IL-1β production in keratinocytes by activating p38 MAPK signaling in psoriasis. Sci. Rep. 2017, 7, 43310. [Google Scholar] [CrossRef] [PubMed]
- Hoegler, K.M.; John, A.M.; Handler, M.Z.; Schwartz, R.A. Generalized pustular psoriasis: A review and update on treatment. J. Eur. Acad. Dermatol.Venereol. JEADV 2018, 32, 1645–1651. [Google Scholar] [CrossRef]
- Rajitha, P.; Biswas, R.; Sabitha, M.; Jayakumar, R. Methotrexate in the Treatment of Psoriasis and Rheumatoid Arthritis: Mechanistic Insights, Current Issues and Novel Delivery Approaches. Curr. Pharm. Des. 2017, 23, 3550–3566. [Google Scholar] [CrossRef]
- Griffiths, C.E.; Voorhees, J.J. Cyclosporine A in the treatment of psoriasis: A clinical and mechanistic perspective. J. Investig. Dermatol. 1990, 95, 53s–55s. [Google Scholar] [CrossRef]
- Ahmed, H.M.; Tavaszi-Sarosi, S. Identification and quantification of essential oil content and composition, total polyphenols and antioxidant capacity of Perilla frutescens (L.) Britt. Food Chem. 2019, 275, 730–738. [Google Scholar] [CrossRef]
- Chen, Z.; Wu, K.; Zhu, W.; Wang, Y.; Su, C.; Yi, F. Chemical compositions and bioactivities of essential oil from perilla leaf (Perillae Folium) obtained by ultrasonic-assisted hydro-distillation with natural deep eutectic solvents. Food Chem. 2022, 375, 131834. [Google Scholar] [CrossRef]
- Ji, W.W.; Li, R.P.; Li, M.; Wang, S.Y.; Zhang, X.; Niu, X.X.; Li, W.; Yan, L.; Wang, Y.; Fu, Q.; et al. Antidepressant-like effect of essential oil of Perilla frutescens in a chronic, unpredictable, mild stress-induced depression model mice. Chin. J. Nat. Med. 2014, 12, 753–759. [Google Scholar] [CrossRef]
- Mungmai, L.; Predalikit, W.; Aunsri, N.; Peerakam, N. Bioactivity test and GC–MS analysis of different solvent extracts from Perilla frutescens (Linn.) Britton and cosmetic product application for sensitive skin. Prog. Appl. Sci. Technol. 2019, 9, 78–93. [Google Scholar]
- Ugbogu, E.A.; Emmanuel, O.; Uche, M.E.; Dike, E.D.; Okoro, B.C.; Ibe, C.; Ude, V.C.; Ekweogu, C.N.; Ugbogu, O.C. The Ethnobotanical, Phytochemistry and Pharmacological Activities of Psidium guajava L. Arab. J. Chem. 2022, 15, 103759. [Google Scholar] [CrossRef]
- Moos, S.; Mohebiany, A.N.; Waisman, A.; Kurschus, F.C. Imiquimod-Induced Psoriasis in Mice Depends on the IL-17 Signaling of Keratinocytes. J. Investig. Dermatol. 2019, 139, 1110–1117. [Google Scholar] [CrossRef]
- Yang, B.Y.; Cheng, Y.G.; Liu, Y.; Liu, Y.; Tan, J.Y.; Guan, W.; Guo, S.; Kuang, H.X. Datura Metel L. Ameliorates Imiquimod-Induced Psoriasis-Like Dermatitis and Inhibits Inflammatory Cytokines Production through TLR7/8-MyD88-NF-κB-NLRP3 Inflammasome Pathway. Molecules 2019, 24, 2157. [Google Scholar] [CrossRef] [PubMed]
- Zhou, T.; Zhang, S.; Zhou, Y.; Lai, S.; Chen, Y.; Geng, Y.; Wang, J. Curcumin alleviates imiquimod-induced psoriasis in progranulin-knockout mice. Eur J Pharmacol 2021, 909, 174431. [Google Scholar] [CrossRef]
- Su, Y.; Zhang, F.; Wu, L.; Kuang, H.; Wang, Q.; Cheng, G. Total withanolides ameliorates imiquimod-induced psoriasis-like skin inflammation. J Ethnopharmacol 2022, 285, 114895. [Google Scholar] [CrossRef] [PubMed]
- Tokuyama, M.; Mabuchi, T. New Treatment Addressing the Pathogenesis of Psoriasis. Int. J. Mol. Sci. 2020, 21, 7488. [Google Scholar] [CrossRef] [PubMed]
- Ogawa, E.A.-O.; Sato, Y.; Minagawa, A.; Okuyama, R. Pathogenesis of psoriasis and development of treatment. J. Dermatol. 2018, 45, 264–272. [Google Scholar] [CrossRef] [PubMed]
- Gu, J.; Li, L.; Wang, D.; Zhu, W.; Han, L.; Zhao, R.; Xu, X.; Lu, C. Deciphering metabonomics biomarkers-targets interactions for psoriasis vulgaris by network pharmacology. Ann. Med. 2018, 50, 323–332. [Google Scholar] [CrossRef]
- Bendaif, H.; Melhaoui, A.; Ramdani, M.; Elmsellem, H.; Douez, C.; El Ouadi, Y. Antibacterial activity and virtual screening by molecular docking of lycorine from Pancratium foetidum Pom (Moroccan endemic Amaryllidaceae). Microb. Pathog. 2018, 115, 138–145. [Google Scholar] [CrossRef]
- El Moussaoui, A.; Jawhari, F.Z.; Almehdi, A.M.; Elmsellem, H.; Benbrahim, K.F.; Bousta, D.; Bari, A. Antibacterial, antifungal and antioxidant activity of total polyphenols of Withania frutescens L. Bioorganic Chem. 2019, 93, 103337. [Google Scholar] [CrossRef]
- Jin, C.H.; Park, H.C.; So, Y.; Nam, B.; Han, S.N.; Kim, J.-B. Comparison of the Anti-Inflammatory Activities of Supercritical Carbon Dioxide versus Ethanol Extracts from Leaves of Perilla frutescens Britt. Radiation Mutant. Molecules 2017, 22, 311. [Google Scholar] [CrossRef] [PubMed]
- Nam, B.; So, Y.; Kim, H.-Y.; Kim, J.-B.; Jin, C.H.; Han, A.-R. A new monoterpene from the leaves of a radiation mutant cultivar of Perilla frutescens var. crispa with inhibitory activity on LPS-induced NO production. Molecules 2017, 22, 1471. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.E.; Kim, N.; Yeo, J.Y.; Seo, D.-G.; Kim, S.; Lee, J.-S.; Hwang, K.W.; Park, S.-Y. Anti-amyloidogenic effects of asarone derivatives from Perilla frutescens leaves against beta-amyloid aggregation and nitric oxide production. Molecules 2019, 24, 4297. [Google Scholar] [CrossRef] [PubMed]




| Gene | Forward Primers | Reverse Primers |
|---|---|---|
| IL-17 | ATCTGTGTCTCTGATGCTGTTG | CGTGGAACGGTTGAGGTAGTCT |
| IL-22 | CTCACCGTGACGTTTTAGGGA | CCACCATAGGAGGCCACAAG |
| IL-23 | AGACTAAAAATAATGTGCCCCG | GCTATCAGGGAGTAGAGCAGGC |
| IFN-α | CCTGCTGGCTGTGAGGAAATAC | ACTTCTGCTCTGACCACCTCCC |
| IFN-γ | CCATCGGCTGACCTAGAGAAGAC | GCCACTTGAGTTAAAATAGTTATTCAGAC |
| GAPDH | CCTCGTCCCGTAGACAAAATG | TGAGGTCAATGAAGGGGTCGT |
| No | Compounds i | RI ii | Exp. RI | Ref. | Relative Content |
|---|---|---|---|---|---|
| Perilla frutescens | |||||
| 1 | 3-Octenol | 1004 | 972 | 0.11 | |
| 2 | 3-Octanol | 1011 | 1393 | a | 0.14 |
| 3 | Linalool | 1086 | 1104 | b | 5.45 |
| 4 | 2,2-Dimethyl-3-heptanone | 1176 | 965 | 0.53 | |
| 5 | borneol | 1183 | 1165 | b | 0.1 |
| 6 | 2-Cyclopenten-1-one, 2-(2-butenyl)-3-methyl-, (Z)- | 1186 | 1183 | c | 1.05 |
| 7 | 2-Hexanoylfuran | 1207 | 1283 | d | 42.15 |
| 8 | 3,4-Dihydro-5-methyl-2H-pyran-4-carboxylic acid ethyl ester | 1215 | 0.12 | ||
| 9 | 2-(2-Methyl-1-propenyl)bicyclo[2.2.1]heptane | 1241 | 18.61 | ||
| 10 | 2,6-Octadienoic acid, 3,7-dimethyl-, methyl ester | 1248 | 1326 | 0.16 | |
| 11 | Copaene | 1276 | 1387 | e | 0.59 |
| 12 | β-Bourbonene | 1283 | 1377 | b | 0.22 |
| 13 | β-Elemene | 1289 | 1398 | c | 0.48 |
| 14 | Isocaryophyllene | 1303 | 1407 | c | 13.02 |
| 15 | α–Caryophyllene | 1329 | 1452 | f | 1.52 |
| 16 | Germacrene D | 1347 | 1480 | f | 1.44 |
| 17 | α–Farnesene | 1352 | 1508 | d | 3.89 |
| 18 | γ-Muurolene | 1368 | 1456 | c | 0.1 |
| 19 | δ-Cadinene | 1375 | 1524 | c | 0.56 |
| 20 | Nerolidol | 1413 | 1565 | b | 0.87 |
| 21 | Caryophyllene oxide | 1445 | 1578 | b | 6.44 |
| 22 | Cedrol | 1447 | 1589 | 0.13 | |
| 23 | Humulene epoxide II | 1452 | 1605 | c | 0.46 |
| 24 | α-Cadinol | 1490 | 1653 | c | 0.34 |
| 25 | Viridiflorol | 1508 | 1590 | c | 0.18 |
| 26 | Hexahydrofarnesyl acetone | 1619 | 1846 | f | 0.14 |
| Total identified | 98.8 | ||||
| Total monoterpenoids/% | 42.15 | ||||
| Oxygenated monoterpenes/% | 42.15 | ||||
| Total sesquiterpenoids/% | 26.98 | ||||
| Sesquiterpene hydrocarbons/% | 20.08 | ||||
| Oxygenated sesquiterpenes/% | 6.9 | ||||
| Others/% | 2.69 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xu, Y.; Shi, Y.; Huang, J.; Gu, H.; Li, C.; Zhang, L.; Liu, G.; Zhou, W.; Du, Z. The Essential Oil Derived from Perilla frutescens (L.) Britt. Attenuates Imiquimod–Induced Psoriasis-like Skin Lesions in BALB/c Mice. Molecules 2022, 27, 2996. https://doi.org/10.3390/molecules27092996
Xu Y, Shi Y, Huang J, Gu H, Li C, Zhang L, Liu G, Zhou W, Du Z. The Essential Oil Derived from Perilla frutescens (L.) Britt. Attenuates Imiquimod–Induced Psoriasis-like Skin Lesions in BALB/c Mice. Molecules. 2022; 27(9):2996. https://doi.org/10.3390/molecules27092996
Chicago/Turabian StyleXu, Yani, Yaohui Shi, Jingxia Huang, Hongtao Gu, Chunlian Li, Lanyue Zhang, Guanting Liu, Wei Zhou, and Zhiyun Du. 2022. "The Essential Oil Derived from Perilla frutescens (L.) Britt. Attenuates Imiquimod–Induced Psoriasis-like Skin Lesions in BALB/c Mice" Molecules 27, no. 9: 2996. https://doi.org/10.3390/molecules27092996
APA StyleXu, Y., Shi, Y., Huang, J., Gu, H., Li, C., Zhang, L., Liu, G., Zhou, W., & Du, Z. (2022). The Essential Oil Derived from Perilla frutescens (L.) Britt. Attenuates Imiquimod–Induced Psoriasis-like Skin Lesions in BALB/c Mice. Molecules, 27(9), 2996. https://doi.org/10.3390/molecules27092996
