A Multiwell-Based Assay for Screening Thyroid Hormone Signaling Disruptors Using thibz Expression as a Sensitive Endpoint in Xenopus laevis
Abstract
:1. Introduction
2. Results
2.1. Determination of T3 Induction Concentration
2.2. Antagonistic Actions of BPA and TBBPA on T3-Induced Gene Expression
2.3. TH Signaling Disrupting Activity of Several Suspected TH Signaling Disruptors
3. Discussion
4. Materials and Methods
4.1. Chemicals
4.2. Animals and Housing Conditions
4.3. Chemical Exposure and Sampling
4.4. RNA Extraction and Quantitative Real-Time PCR
4.5. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Sachs, L.M.; Campinho, M.A. Editorial: The Role of Thyroid Hormones in Vertebrate Development. Front. Endocrinol. 2019, 10, 863. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shi, Y.B. Dual functions of thyroid hormone receptors in vertebrate development: The roles of histone-modifying cofactor complexes. Thyroid 2009, 19, 987–999. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yen, P.M.; Ando, S.; Feng, X.; Liu, Y.; Maruvada, P.; Xia, X.M. Thyroid hormone action at the cellular, genomic and target gene levels. Mol. Cell. Endocrinol. 2006, 246, 121–127. [Google Scholar] [CrossRef]
- DeVito, M.; Biegel, L.; Brouwer, A.; Brown, S.; Brucker-Davis, F.; Cheek, A.O.; Christensen, R.; Colborn, T.; Cooke, P.; Crissman, J.; et al. Screening methods for thyroid hormone disruptors. Environ. Health Perspect. 1999, 107, 407–415. [Google Scholar] [CrossRef]
- Zhang, J.; Li, Y.Z.; Gupta, A.A.; Nam, K.; Andersson, P.L. Identification and Molecular Interaction Studies of Thyroid Hormone Receptor Disruptors among Household Dust Contaminants. Chem. Res. Toxicol. 2016, 29, 1345–1354. [Google Scholar] [CrossRef] [PubMed]
- Leemans, M.; Couderq, S.; Demeneix, B.; Fini, J.B. Pesticides with Potential Thyroid Hormone-Disrupting Effects: A Review of Recent Data. Front. Endocrinol. 2019, 10, 743. [Google Scholar] [CrossRef] [Green Version]
- Gilbert, M.E.; O’Shaughnessy, K.L.; Axelstad, M. Regulation of Thyroid-disrupting Chemicals to Protect the Developing Brain. Endocrinology 2020, 161. [Google Scholar] [CrossRef]
- Moriyama, K.; Tagami, T.; Akamizu, T.; Usui, T.; Saijo, M.; Kanamoto, N.; Hataya, Y.; Shimatsu, A.; Kuzuya, H.; Nakao, K. Thyroid hormone action is disrupted by bisphenol A as an antagonist. J. Clin. Endocr. Metab. 2002, 87, 5185–5190. [Google Scholar] [CrossRef]
- Sun, H.; Shen, O.X.; Wang, X.R.; Zhou, L.; Zhen, S.Q.; Chen, X.D. Anti-thyroid hormone activity of bisphenol A, tetrabromobisphenol A and tetrachlorobisphenol A in an improved reporter gene assay. Toxicol. In Vitro 2009, 23, 950–954. [Google Scholar] [CrossRef] [PubMed]
- Niu, Y.; Zhu, M.; Dong, M.; Li, J.; Li, Y.; Xiong, Y.; Liu, P.; Qin, Z. Bisphenols disrupt thyroid hormone (TH) signaling in the brain and affect TH-dependent brain development in Xenopus laevis. Aquat. Toxicol. 2021, 237, 105902. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.F.; Xu, W.; Lou, Q.Q.; Li, Y.Y.; Zhao, Y.X.; Wei, W.J.; Qin, Z.F.; Wang, H.L.; Li, J.Z. Tetrabromobisphenol A disrupts vertebrate development via thyroid hormone signaling pathway in a developmental stage-dependent manner. Environ. Sci. Technol. 2014, 48, 8227–8234. [Google Scholar] [CrossRef]
- Freitas, J.; Cano, P.; Craig-Veit, C.; Goodson, M.L.; Furlow, J.D.; Murk, A.J. Detection of thyroid hormone receptor disruptors by a novel stable in vitro reporter gene assay. Toxicol. In Vitro 2011, 25, 257–266. [Google Scholar] [CrossRef] [PubMed]
- Hofmann, P.J.; Schomburg, L.; Kohrle, J. Interference of Endocrine Disrupters with Thyroid Hormone Receptor-Dependent Transactivation. Toxicol. Sci. 2009, 110, 125–137. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zoeller, R.T.; Tyl, R.W.; Tan, S.W. Current and potential rodent screens and tests for thyroid toxicants. Crit. Rev. Toxicol. 2007, 37, 55–95. [Google Scholar] [CrossRef] [PubMed]
- Grimaldi, M.; Boulahtouf, A.; Delfosse, V.; Thouennon, E.; Bourguet, W.; Balaguer, P. Reporter cell lines for the characterization of the interactions between human nuclear receptors and endocrine disruptors. Front. Endocrinol. 2015, 6. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Thambirajah, A.A.; Koide, E.M.; Imbery, J.J.; Helbing, C.C. Contaminant and Environmental Influences on Thyroid Hormone Action in Amphibian Metamorphosis. Front. Endocrinol. 2019, 10, 276. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sachs, L.M.; Buchholz, D.R. Frogs model man: In vivo thyroid hormone signaling during development. Genesis 2017, 55. [Google Scholar] [CrossRef]
- OECD/OCDE. Test No. 231: Amphibian Metamorphosis Assay. In OECD Guidelines for the Testing of Chemicals, Section 2; OECD Publishing: Paris, France, 2009. [Google Scholar] [CrossRef]
- Fini, J.B.; Le Mevel, S.; Turque, N.; Palmier, K.; Zalko, D.; Cravedi, J.P.; Demeneix, B.A. An in vivo multiwell-based fluorescent screen for monitoring vertebrate thyroid hormone disruption. Environ. Sci. Technol. 2007, 41, 5908–5914. [Google Scholar] [CrossRef]
- OECD/OCDE. Test No. 248: Xenopus Eleutheroembryonic Thyroid Assay (XETA). In OECD Guidelines for the Testing of Chemicals, Section 2; OECD Publishing: Paris, France, 2019. [Google Scholar] [CrossRef]
- Yao, X.; Chen, X.; Zhang, Y.; Li, Y.; Wang, Y.; Zheng, Z.; Qin, Z.; Zhang, Q. Optimization of the T3-induced Xenopus metamorphosis assay for detecting thyroid hormone signaling disruption of chemicals. J. Environ. Sci. (China) 2017, 52, 314–324. [Google Scholar] [CrossRef]
- Wang, Y.; Li, Y.; Qin, Z.; Wei, W. Re-evaluation of thyroid hormone signaling antagonism of tetrabromobisphenol A for validating the T3-induced Xenopus metamorphosis assay. J. Environ. Sci. (China) 2017, 52, 325–332. [Google Scholar] [CrossRef] [PubMed]
- Yaoita, Y.; Brown, D.D. A correlation of thyroid hormone receptor gene expression with amphibian metamorphosis. Genes Dev. 1990, 4, 1917–1924. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Morvan-Dubois, G.; Demeneix, B.A.; Sachs, L.M. Xenopus laevis as a model for studying thyroid hormone signalling: From development to metamorphosis. Mol. Cell. Endocrinol. 2008, 293, 71–79. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Saxen, L.; Saxen, E.; Toivonen, S.; Salimaki, K. Quantitative investigation on the anterior pituitary-thyroid mechanism during frog metamorphosis. Endocrinology 1957, 61, 35–44. [Google Scholar] [CrossRef] [PubMed]
- Faber, J.; Nieuwkoop, P.D. Normal Table of Xenopus Laevis (Daudin). A Systematical and Chronological Survey of the Development from the Fertilized Egg till the End of Metamorphosis; Garland Publishing: New York, NY, USA, 1994; p. 252. [Google Scholar]
- Hirouchi, Y.; Naganuma, H.; Kawahara, Y.; Okada, R.; Kamiya, A.; Inui, K.; Hori, R. Preventive Effect of Betamipron on Nephrotoxicity and Uptake of Carbapenems in Rabbit Renal-Cortex. Jpn. J. Pharmacol. 1994, 66, 1–6. [Google Scholar] [CrossRef] [Green Version]
- Paul-Friedman, K.; Martin, M.; Crofton, K.M.; Hsu, C.W.; Sakamuru, S.; Zhao, J.; Xia, M.; Huang, R.; Stavreva, D.A.; Soni, V.; et al. Limited Chemical Structural Diversity Found to Modulate Thyroid Hormone Receptor in the Tox21 Chemical Library. Environ. Health Perspect. 2019, 127, 97009. [Google Scholar] [CrossRef] [PubMed]
- Wu, Y.; Beland, F.A.; Fang, J.-L. Effect of triclosan, triclocarban, 2,2′,4,4′-tetrabromodiphenyl ether, and bisphenol A on the iodide uptake, thyroid peroxidase activity, and expression of genes involved in thyroid hormone synthesis. Toxicol. In Vitro 2016, 32, 310–319. [Google Scholar] [CrossRef] [Green Version]
- Mihaich, E.; Capdevielle, M.; Urbach-Ross, D.; Slezak, B. Hypothesis-driven weight-of-evidence analysis of endocrine disruption potential: A case study with triclosan. Crit. Rev. Toxicol. 2017, 47, 263–285. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.; Kim, S.; Park, Y.J.; Moon, H.-B.; Choi, K. Thyroid Hormone-Disrupting Potentials of Major Benzophenones in Two Cell Lines (GH3 and FRTL-5) and Embryo-Larval Zebrafish. Environ. Sci. Technol. 2018, 52, 8858–8865. [Google Scholar] [CrossRef] [PubMed]
- Kashiwagi, K.; Hanada, H.; Yamamoto, T.; Goto, Y.; Furuno, N.; Kitamura, S.; Ohta, S.; Sugihara, K.; Taniguci, K.; Tooi, O.; et al. 2-Hydroxy-4-methoxybenzophenone (HMB) and 2,4,4′-trihydroxybenzophenone (THB) Suppress Amphibian Metamorphosis. In Progress in Safety Science and Technology Series; International Symposium on Safety Science and Technology: Beijing, China, 2008; Volume 7, pp. 970–976. [Google Scholar]
- Jiang, Y.; Yuan, L.; Lin, Q.; Ma, S.; Yu, Y. Polybrominated diphenyl ethers in the environment and human external and internal exposure in China: A review. Sci. Total Environ. 2019, 696, 133902. [Google Scholar] [CrossRef] [PubMed]
- Furlow, J.D.; Brown, D.D. In vitro and in vivo analysis of the regulation of a transcription factor gene by thyroid hormone during Xenopus laevis metamorphosis. Mol. Endocrinol. 1999, 13, 2076–2089. [Google Scholar] [CrossRef] [PubMed]
- Yost, A.T.; Thornton, L.M.; Venables, B.J.; Jeffries, M.K.S. Dietary exposure to polybrominated diphenyl ether 47 (BDE-47) inhibits development and alters thyroid hormone-related gene expression in the brain of Xenopus laevis tadpoles. Environ. Toxicol. Phar. 2016, 48, 237–244. [Google Scholar] [CrossRef] [PubMed]
- Balch, G.C.; Velez-Espino, L.A.; Sweet, C.; Alaee, M.; Metcalfe, C.D. Inhibition of metamorphosis in tadpoles of Xenopus laevis exposed to polybrominated diphenyl ethers (PBDEs). Chemosphere 2006, 64, 328–338. [Google Scholar] [CrossRef] [PubMed]
- Fort, D.J.; Mathis, M.B.; Pawlowski, S.; Wolf, J.C.; Peter, R.; Champ, S. Effect of triclosan on anuran development and growth in a larval amphibian growth and development assay. J. Appl. Toxicol. 2017, 37, 1182–1194. [Google Scholar] [CrossRef] [PubMed]
- Marlatt, V.L.; Veldhoen, N.; Lo, B.P.; Bakker, D.; Rehaume, V.; Vallee, K.; Haberl, M.; Shang, D.; van Aggelen, G.C.; Skirrow, R.C.; et al. Triclosan exposure alters postembryonic development in a Pacific tree frog (Pseudacris regilla) Amphibian Metamorphosis Assay (TREEMA). Aquat. Toxicol. 2013, 126, 85–94. [Google Scholar] [CrossRef] [PubMed]
- Veldhoen, N.; Skirrow, R.C.; Osachoff, H.; Wigmore, H.; Clapson, D.J.; Gunderson, M.P.; Van Aggelen, G.; Helbing, C.C. The bactericidal agent triclosan modulates thyroid hormone-associated gene expression and disrupts postembryonic anuran development. Aquat. Toxicol. 2006, 80, 217–227. [Google Scholar] [CrossRef]
- Schmutzler, C.; Bacinski, A.; Gotthardt, I.; Huhne, K.; Ambrugger, P.; Klammer, H.; Schlecht, C.; Hoang-Vu, C.; Grueters, A.; Wuttke, W.; et al. The ultraviolet filter benzophenone 2 interferes with the thyroid hormone axis in rats and is a potent in vitro inhibitor of human recombinant thyroid peroxidase. Endocrinology 2007, 148, 2835–2844. [Google Scholar] [CrossRef]
- Lou, Q.Q.; Zhang, Y.F.; Zhou, Z.; Shi, Y.L.; Ge, Y.N.; Ren, D.K.; Xu, H.M.; Zhao, Y.X.; Wei, W.J.; Qin, Z.F. Effects of perfluorooctanesulfonate and perfluorobutanesulfonate on the growth and sexual development of Xenopus laevis. Ecotoxicology 2013, 22, 1133–1144. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y. Methods for Evaluating Thyroid Disruption by Chemicals Using Amphibians and Their Application. Ph.D. Thesis, University of Chinese Academy of Sciences, Beijing, China, 2014. [Google Scholar]
- Shi, Y.B.; Liang, V.C.-T. Cloning and characterization of the ribosomal protein L8 gene from Xenopus laevis. Biochim. Biophys. Acta 1994, 1217, 227–228. [Google Scholar] [CrossRef]
- Zhu, M.; Chen, X.Y.; Li, Y.Y.; Yin, N.Y.; Faiola, F.; Qin, Z.F.; Wei, W.J. Bisphenol F Disrupts Thyroid Hormone Signaling and Postembryonic Development in Xenopus laevis. Environ. Sci. Technol. 2018, 52, 1602–1611. [Google Scholar] [CrossRef]
- Crespi, E.J.; Denver, R.J. Leptin (ob gene) of the South African clawed frog Xenopus laevis. Proc. Natl. Acad. Sci. USA 2006, 103, 10092–10097. [Google Scholar] [CrossRef] [Green Version]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCt method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
Gene | Primer Sequences (5′–3′) | Annealing Temperature (°C) | GeneBank ID |
---|---|---|---|
rpl8 | F: CCGTGGTGTGGCTATGAATC | 58 | NM_001086996.1 |
R: TACGACGAGCAGCAATAAGAC | |||
klf9 | F: GTGGCCACTTGATTTCCCCT | 64 | NM_001085597.1 |
R: AAAGACACAAAACAGCGGCG | |||
thibz | F: CCACCTCCACAGAATCAGCAG | 62 | NM_001085805.1 |
R: AGAAGTGTTCCGACAGCCAAG | |||
thrb | F: GAGATGGCAGTGACAAGG | 58 | NM_001087781.1 |
R: CAAGGCGACTTCGGTATC | |||
st3 | F: CCTCTGTCATACACTTACCTT | 62 | NM_001086342.1 |
R: TGAACCGTGAGCATTGAG | |||
dio3 | F: GATGCTGTGGCTGCTGGAT | 62 | NM_001087863.1 |
R: ATTCGGTTGGAGTCGGACAC | |||
mmp13 | F: CCTTGTCAGTGCTTGTCCTATC | 62 | NM_001100931.1 |
R: TCCTGGTGTCAGTTCAGAGTC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, J.; Li, Y.; Zhu, M.; Song, S.; Qin, Z. A Multiwell-Based Assay for Screening Thyroid Hormone Signaling Disruptors Using thibz Expression as a Sensitive Endpoint in Xenopus laevis. Molecules 2022, 27, 798. https://doi.org/10.3390/molecules27030798
Li J, Li Y, Zhu M, Song S, Qin Z. A Multiwell-Based Assay for Screening Thyroid Hormone Signaling Disruptors Using thibz Expression as a Sensitive Endpoint in Xenopus laevis. Molecules. 2022; 27(3):798. https://doi.org/10.3390/molecules27030798
Chicago/Turabian StyleLi, Jinbo, Yuanyuan Li, Min Zhu, Shilin Song, and Zhanfen Qin. 2022. "A Multiwell-Based Assay for Screening Thyroid Hormone Signaling Disruptors Using thibz Expression as a Sensitive Endpoint in Xenopus laevis" Molecules 27, no. 3: 798. https://doi.org/10.3390/molecules27030798